Rr

DRD

a

ARR2AA

KMHHAA

1

tta

foenlrpuP

P

0h

Molecular Immunology 57 (2014) 226– 235

Contents lists available at ScienceDirect

Molecular Immunology

jo u r n al homep age: www.elsev ier .com/ locate /mol imm

egulation of the HIF-system in human macrophages – Differentialegulation of HIF-� subunits under sustained hypoxia

avid M. Poitz ∗, Antje Augstein, Kathleen Hesse, Marian Christoph, Karim Ibrahim,üdiger C. Braun-Dullaeus1, Ruth H. Strasser2, Alexander Schmeißer1,2

epartment of Internal Medicine and Cardiology, Dresden University of Technology, Fetscherstr. 74, 01307 Dresden, Germany

r t i c l e i n f o

rticle history:eceived 30 July 2013eceived in revised form3 September 2013ccepted 1 October 2013vailable online 29 October 2013

eywords:acrophagesIFypoxia-inducible factorsntisense

a b s t r a c t

Macrophages are often associated to pathophysiological processes and were found at hypoxic areas. How-ever, cell adaption greatly depends on hypoxia-inducible factors (HIF). Activation of these transcriptionfactors is induced by heterodimerization of an �-(HIF-1�, -2�, -3�) and HIF-1� subunit. The main regula-tory pathway is represented by �-subunit stability. Beside, little is known about the exact mechanisms offine-tuning in Hif-regulation. The present study characterizes the hypoxia-induced regulation of HIF-1�and -2� in human macrophages. The hypoxic increase of both subunits is initially mediated by proteinstabilization. Sustained hypoxia caused a distinct regulation of HIF-1� and -2�. The striking increase ofHIF-2� protein expression was contrasted by a dramatic decrease of HIF-1�. The long-term downreg-ulation of HIF-1� is due to downregulation of its mRNA. This decrease was accompanied by increasedexpression of ahif, a natural cis-antisense transcript of HIF-1�. The ahif-transcript was strongly inducibleby hypoxia and rapidly degraded under reoxygenation. Using an adenoviral overexpression and siRNA

hif silencing approach revealed that the targeted regulation of ahif is mediated by the HIF-system itself.Furthermore it could be shown that ahif indeed is able to modulate the hypoxic expression of HIF-1� andinfluences the expression of the HIF-target gene Enolase-2.

Taken together, this study characterizes a new regulation process of the HIF-transcription factor-systemin human macrophages under hypoxia. For the first time evidence is provided that ahif is regulated by

ences

the HIF-system and influ

. Introduction

The hypoxia-inducible factors play a major role in the adaptationo low oxygen tensions. Therefore they are indispensable for a mul-itude of cellular functions like survival, angiogenesis, apoptosisnd glucose metabolism.

The HIF transcription factor complex consists of a heterodimerormed by one HIF-� (HIF-1�, -2�, -3�) and the �-subunit (HIF-1�r ARNT). Whereas the �-subunit is constitutively and ubiquitouslyxpressed, the �-subunits are tightly regulated by oxygen. Underormoxic conditions the �-subunits are continuously hydroxy-

ated by HIF-prolylhydroxylases (PHD 1–3). This hydroxylation isequired for the binding of the von-Hippel–Lindau tumor sup-

ressor protein to the �-subunits, which leads to subsequentbiquitination and proteosomal degradation (Semenza, 2003). TheHDs belong to the enzyme family of dioxygenases. They need in

∗ Corresponding author. Tel.: +49 351 458 6627; fax: +49 351 458 6329.E-mail address: david.poitz@tu-dresden.de (D.M. Poitz).

1 Present address: Internal Medicine, Department of Cardiology, Angiology andneumology, Magdeburg University, Leipziger Str. 44, 39120 Magdeburg, Germany.2 These authors contributed equally to the work.

161-5890/$ – see front matter © 2013 Elsevier Ltd. All rights reserved.ttp://dx.doi.org/10.1016/j.molimm.2013.10.001

HIF-1� expression in primary human macrophages.© 2013 Elsevier Ltd. All rights reserved.

addition to the co-factors Fe2+, ascorbate and 2-oxogluterate, oxy-gen as substrate. Therefore, reduced oxygen tension leads to aninactivation of these enzymes, which consequently results in a sta-bilization of the HIF-�-subunits. The �-subunits translocate intothe nucleus, where they dimerize with the �-subunit and bindto the hypoxia response element (HRE) (Bruick, 2003). Besidesthis posttranscriptional regulation of the HIF-system, another reg-ulatory mechanism, meanwhile called the antisense effect, wasdescribed by the group of Tartof in 1999. They characterized atranscript, which is partly complementary to the 3′-UTR of HIF-1� and named it natural antisense transcript of HIF-1� (ahif)(Thrash-Bingham and Tartof, 1999). A further report correlated theexpression of ahif with the prognosis in breast cancer (Cayre et al.,2003). Uchida and his colleagues showed that the transcript itselfis regulated by hypoxia in the A549 lung epithelial cell line. Fur-thermore, they show an involvement of the HIF-system within thisregulation (Uchida et al., 2004). But the different impact of HIF-1and HIF-2 in the hypoxic ahif regulation remains unclear. In addi-

tion, until now, there is no direct evidence for a regulation of HIF-1�by ahif.

The HIF-system has exceeding importance for the developmentof the cardiovascular system and in pathophysiological processes:

Immu

kwmteM

phS2Ie2ste(ltish

2

2

Fshc(s(lcm

ptw

ld

S0Ca5

2

mHa1

cGBt

D.M. Poitz et al. / Molecular

nock-out models for HIF-1� and HIF-2� are lethal due to defectsithin the cardiovascular system during the embryonic develop-ent (Kotch et al., 1999; Peng et al., 2000). The progression of

he atherosclerotic plaque is greatly influenced by hypoxia andspecially the HIF-1� transcription factor (Bjornheden et al., 1999;urdoch et al., 2004).Macrophages have been shown to play a pivotal role in the

athogenesis of atherosclerosis and other diseases. Moreover theyome to the hypoxic sites of the plaque (Murdoch et al., 2004;luimer et al., 2008) and express large amounts of HIF-1� and HIF-� under these conditions (Sluimer et al., 2008; Vink et al., 2007).

n contrast to other cells, macrophages are one of the few cell typesxpressing both, HIF-1� and -2� (Elvidge et al., 2006; Lofstedt et al.,007) but not HIF-3� (Augstein et al., 2011). Furthermore, it washown that elements of the HIF-system are involved the regula-ion of crucial cellular functions in macrophages. This includes forxample vascular remodelling (Nakayama et al., 2013), cell survivalPoitz et al., 2011), leukocyte adhesion (Kong et al., 2004) and theipid uptake (Crucet et al., 2013). However little is known abouthe distinct regulation processes of the HIF-system under hypoxiancluding the antisense regulation in macrophages. The presenttudy focusses on the hypoxic regulation of HIF-1� within primaryuman macrophages.

. Materials and methods

.1. Cell culture and experimental design

Peripheral blood mononuclear cells (MNC) were obtained byicoll density gradient centrifugation (LSM 1077, PAA) with aubsequent Percoll gradient (� = 1.064 g cm−3, GE healthcare) ofuman buffy coats (DRK) from healthy donors. The mononuclearell fraction was resuspended in Medium 199 with Earle’s saltsPAA) supplemented with 10% FCS (Sigma–Aldrich), streptomycinulphate (100 �g/ml), penicillin (100 IU/ml) and amphotericin B0.25 �g/ml) and seeded at 1 × 106 cells per well in 6-well ultra-ow attachment plates (Corning Life Science). The cells were furtherultured for 12 days to allow differentiation into monocyte-derivedacrophages (MDMs).Macrophages were seeded for adherence to normal plastic

lates (BD Biosciences). Adenoviral infection was done using a mul-iplicity of infection of 100. The infection efficiency following 48 has nearly 100% as confirmed by lacZ-staining or GFP-expression.

Human umbilical venous endothelial cells (HUVEC) and vascu-ar smooth muscle cells were isolated and cultured as previouslyescribed (Augstein et al., 2011).

Exposure to hypoxia was done using a hypoxic chamber (Bio-pherix) within a standard incubator. The cells were exposed to.5% O2 balanced with a gas mixture consisting of 95% N2 and 5%O2. The normoxic controls were cultured for the indicated time inn incubator under normal culture conditions (humid atmosphere,% CO2).

.2. Protein extraction and immunoblot analysis

Antibodies and dilutions were used as follows: monoclonalouse-anti-HIF-1� (BD Biosciences) 1:500, polyclonal rabbit-anti-IF-2� (Novus biologicals) 1:1000, monoclonal mouse-anti-�-ctin (Santa Cruz) 1:1000, sheep-anti-mouse-HRP (Amersham):10,000 and goat-anti-rabbit-HRP (Santa Cruz) 1:2500.

Total cell extracts were prepared by scraping the cells from the

ulture plates in lysis buffer (50 mM Tris–Cl, pH 6.1, 2% SDS, 5%lycerol). The cell extracts were heated to 95 ◦C for 10 min andCA assay (Interchim) was performed in order to determine pro-ein concentrations. SDS-PAGE gels were run and electroblotted

nology 57 (2014) 226– 235 227

onto PVDF membranes (Pall Fluoro Trans® Membran, Pall Corpora-tion) using standard methods. The blots were probed with primaryantibodies in 0.1% TBST/5% non-fat dried milk before detection withsecondary antibody and visualization of protein bands by chemi-luminescence. Densitometric analysis of protein bands was doneusing “QuantityOne” software (BioRad). Equal loading of proteinswas determined by detection of �-actin.

2.3. RNA Isolation and real-time RT-PCR

Total RNA was isolated using the Invisorb Spin Cell RNA MiniKit (Invitek). cDNA was synthesized with the Revert AidTM H MinusFirst Strand Synthesis Kit (MBI Fermentas) from 1 to 5 �g total RNAwith Random Hexamer primers. PCR was done with the iCyclerreal-time PCR System (BioRad) using the SYBR®Premix ExTaqTM

(Lonza). The PCR conditions for all primer sets were as follows: ini-tial denaturation at 95 ◦C for 1 min followed by 45 amplificationcycles, each consisting of 95 ◦C for 20 s, 58 ◦C for 45 s and 72 ◦C for20 s with a final extension step at 72 ◦C for 2 min with a subsequentmelting point analysis. Identity of PCR products was proven bymelting point analysis, electrophoresis and sequencing of resultingPCR products (sequencing facility, MPI CBG Dresden) Relative quan-tification of gene expression was calculated using the ��ct methodusing Gene expression Macro Version 1.1 (BioRad) (Table 1).

2.4. Construction and purification of adenoviruses

Recombinant replication-deficient adenoviruses were con-structed using the AdenoX Expression System-1 (Clontech). Inbrief: the coding sequences of HIF-�-subunits and ahif were ampli-fied from oligodT-reverse-transcribed cDNA using primers with5′-extensions containing the recognition sequence for NheI andKpnI to allow cloning into the pShuttle vector and a stop-codonin the case of dominant-negative HIF-2� (HIF-�dn). The identityof the fragments was verified by sequencing (MPI CBG Dresden).The expression cassette including the fragment of interest wascut out of pShuttle vector and cloned into pAdenoX vector, fol-lowed by linearization using PacI and subsequent transfection intoHEK293 cells by calcium-phosphat-precipitation using the Calci-umphosphat Transfection Kit (Sigma–Aldrich). The resulting viruswas collected and amplified. High-titer stocks of the recombinantadenovirus were purified by caesium chloride density gradientcentrifugation. The virus-titer was determined using the AdenoX-Rapid-Titer-Kit (Clontech).

2.5. Nuclear extraction

Macrophages were seeded confluently on petri dishes (58 cm2)and incubated for 12 h under normoxic culture conditions to allowadherence. The culture media was exchanged after adhesion. Afterexposure to either normoxia or hypoxia cells were lysed andprocessed with the Nuclear Extract Kit (Active Motif) according tothe manufacturer’s manual.

2.6. Estimation of DNA binding activity

Nuclear protein extraction was performed as described above.An ELISA-based Kit for detection of HIF-1 DNA binding activity(TransAMTM HIF-1) was used according to manufacturer’s instruc-tions (Active Motif).

2.7. Transfection of siRNA

Transfection of macrophages with siRNA (siMAX siRNA, MWGBiotech) was done using the InterferinTM siRNA transfectionreagent (Polyplus Transfections) according to the manufacturer’s

228 D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235

Table 1Primers used for real-time PCR.

Gene NCBI no. Primer name Sequence Fragment-size

ahif U85044 ahifC-s AAC ATG ACA TTT AGG GAC TCA AC 135 bpahifC-as TGC TTC AAC ACC TCC AAC TC

EF2 NM 001961 EF2var s ATC CTC ACC GAC ATC ACC AAG 282 bpEF2var as CTG CTC TGG ACA CTG GAT CTC

ENO2 NM 001975 ENO2-s CTG AAG CCA TCC AAG CGT 161 bpENO2-as CAG ACG TTC AGA ACG GCA C

HIF-1˛ NM 001530 HIF1a-s GTT CAC CTG AGC CTA ATA GTC C 203 bpHIF1a-B-as GGA ACG TAA CTG GAG GTC ATC

HIF-1˛ (endogenous) NM 001530 HIF1aendo-s CCACAG CTG ACC AGT TAT GAT TG 213 bpHIF1aendo-as TGC AGT ATT GTA GCC AGG CTT C

HIF-2˛ NM 001430 HIF2a-s AGT CAC CAG AAC TTG TGC ACC 174 bpHIF2a-as CTT CTC AAT CTC ACT CAG GAC G

HRBP NM 021974 HRBP144-s GGCCAACCAGAAGCGAATC 166 bpHRBP144-as

HPRT1 NM 000194 HPRT1-h-s

HPRT1-uni-as

Table 2Used siRNA for silencing HIF-1�, -2� and ahif.

Targeted gene Sequence

HIF-1 ̨ AGUUCACCUGAGCCUAAUATTUAUUAGGCUCAGGUGAACUTT

HIF-2˛ GGAGCUAACAGGACAUAGUTTACUAUGUCCUGUUAGCUCCTT

Non-specific control (scramble) AGGUAGUGUAAUCGCCUUGTTCAAGGCGAUUACACUACCUTT

ahif1 AUCUUCAGAGAAGCUCUAGTTCUAGAGCUUCUCUGAAGAUTT

ipMTm[d4

2

2

fS

FochV

ahif2 GGUGAUGGCACUAAGAUAATTUUAUCUUAGUGCCAUCACCTT

nstructions. In brief, transfection was done in 12 well plates. Aremix of INTERFERinTM [1 �l/200 �l] and siRNA [1 �M] in Opti-EM I (Invitrogen) was incubated for 15 min at room temperature.

he transfection was done by reverse technique: 200 �l of the pre-ix was used per well of a 12-well plate. 800 �l cell suspension

5 × 105 cells] were added per well. This was followed by a spin-own of the cells for 5 min and 200 × g. Cells were incubated for8 h before starting the hypoxic cultivation.

The used siRNA sequences are listed in Table 2 (Augstein et al.,011).

.8. Statistical analysis

For statistical analyses two-tail Student’s t-test was per-ormed. In the case of time-course experiments, ANOVA withtudent–Newman–Keuls Posthoc test was used to identify

ig. 1. The HIF-1� antisense effect is most pronounced in Macrophages compared to HUVEr hypoxic conditions for 24 h and the expression levels of HIF-1�, HIF-2� (A) and ahif

ontrols. Expression levels were normalized to Hypoxanthine-Guanine Phosphoribosyl

ypoxia-mediated downregulation of HIF-1� and the induction of ahif, macrophages shSMC: n = 3, MDM: n = 7).

CTTTCGGGCCTTGAGTTCCTTGCGACCTTGACCATCTTTG 96 bpCTTTGCTGACCTGCTGGATTAC

significant changes. Results are expressed as mean ± standard errorand P-values below 0.05 (*), 0.01 (**) and 0.001 (***) were con-sidered to be statistically significant, very and highly significant,respectively.

3. Results

3.1. Regulation of HIF- ̨ subunits and ahif under normoxic andhypoxic conditions in macrophages and cells of the vascularsystem

To evaluate whether the expression of ahif and HIF-� subunitsare regulated in human primary cells present within the vascularsystem, HUVEC, VSMC and monocyte-derived macrophages (MDM)were cultured under either normoxic (21% O2) or hypoxic (0.5%O2) conditions for 24 h (Fig. 1). To reduce variations between thedifferent cell types, expression data was normalized to 2 house-keeping genes, Hypoxanthine-Guanine Phosphoribosyl Transferase(HPRT1) and RNA-Polymerase II small subunit (HRBP).

In all three cell types, the cultivation under hypoxic con-ditions led to significantly reduced HIF-1� mRNA levels. Themost pronounced repression of HIF-1� down to 25% after 24 hof hypoxic cultivations was observed in macrophages. HIF-1�is downregulated in HUVEC and VSMC to approximately 70%(Fig. 1A). Conversely, ahif was strongly induced by hypoxia andagain macrophages displayed the most extensive change: a 32-

fold induction of ahif by hypoxia was observed in macrophages,whereas in HUVEC and VSMC ahif was elevated 5-fold (Fig. 1B).The HIF-2� mRNA is not regulated by sustained hypoxia (>8 h) inall three cells types (Fig. 1A).

C and VSMC. HUVEC, human VSMC and MDM were cultured under either normoxic(B) were determined by real-time RT-PCR relative to the corresponding normoxiaTransferase (HPRT1) and RNA-Polymerase II small subunit (HRBP). Regarding theowed the most pronounced effects compared to HUVEC and VSMC (HUVEC: n = 5,

Immunology 57 (2014) 226– 235 229

amgrlcdofi

etoa

nihi

ecaatftuHtaba

3

baa3tadbrtAt

iuo(iie(ttHi(so

Fig. 2. Time-dependent mRNA expression of HIF-� subunits and ahif under hypoxiaand reoxygenation Human MDMs were incubated for the indicated times undereither normoxia or hypoxia (A/B). In the case of reoxygenation the cells were incu-bated under hypoxia for 24 h and further cultured under reoxygenation for theindicated times (C). The relative expression of HIF-1�, HIF-2� (A) or ahif (B) wasdetermined by real-time RT-PCR (n = 4). HIF-1� was continuously downregulatedby hypoxia, whereas ahif increased with the time of hypoxic cultivation. In contrast,

D.M. Poitz et al. / Molecular

Because the downregulation of HIF-1� and the induction ofhif were found to be most pronounced in macrophages, theRNA expression pattern for HIF-1� and -2� were analyzed in

reater detail. For the two �-subunits, different patterns of mRNA-egulation were observed in a time series of hypoxia. HIF-2� mRNAevels remain unchanged over 24 h under hypoxic conditions. Inontrast, the mRNA levels of HIF-1� decreased time-dependentlyuring hypoxia. This mRNA downregulation of HIF-1� started at 4 hf hypoxic cultivation and further progressed until 24 h of hypoxianally reaching 10% of the normoxic control (Fig. 2A).

As shown in Fig. 2B, the expression of ahif was greatly influ-nced by hypoxia. In contrast to the downregulation of HIF-1�,he expression of ahif was continuously increased with durationf hypoxia, beginning already at 2 h after the onset of hypoxia with

10fold elevation, reaching up to a 50-fold increase after 24 h.Further experiments revealed that ahif is highly unstable under

ormoxic conditions. The RNA was reduced by 50% within approx-mately 30 min of reoxygenation after an initial cultivation underypoxia for 24 h. This effect was accompanied by continuously ris-

ng HIF-1� mRNA levels (Fig. 2C).HIF-1� and HIF-2� protein levels were determined by West-

rn blotting at different time points under normoxic and hypoxiconditions. As expected, under normoxia both �-subunits werebsent, as they are continuously degraded by the proteasom (Fig. 3And B). Hypoxia stabilized the HIF-� subunits enabling them toranslocate into the nucleus (Fig. 3C). During hypoxic cultivationor up to 8 h the protein expression of both subunits was con-inuously increased. However, further cultivation of macrophagesnder hypoxia led to a distinct expression pattern of HIF-1� andIF-2�: whereas HIF-2� levels were further elevated, HIF-1� pro-

ein content was strongly decreased after 24 h of hypoxia (Fig. 3And B). The downregulation of HIF-1� protein was also reflectedy DNA-binding activity of HIF-1, which was significantly reducedfter 24 h compared to 4 h of hypoxia (Fig. 3D).

.2. HIF-1 ̨ and ahif regulation is controlled by the HIF-system

To investigate whether the induction of ahif and its possi-le effects on HIF-1� depend on active transcriptional processesnd therefore might be the result of transcriptional activation ofhif, macrophages were pretreated with ActinomycinD (1 �g/ml)0 min prior the hypoxic cultivation for 24 h. As shown in Fig. 4A,he blockade of ongoing transcription by ActinomycinD completelybolished the hypoxic induction of ahif. Furthermore, the hypoxicownregulation of HIF-1�, due to an antisense-mediated desta-ilization, was also blocked by ActinomycinD treatment. Theseesults were reflected on protein level, where a higher HIF-1� pro-ein content was detected in cells cultured under hypoxia withctinomycinD. In contrast this treatment did not alter HIF-2� pro-

ein levels compared to hypoxia alone (Fig. 4C).To test the hypothesis that the hypoxic regulation of ahif

nvolves the HIF-transcription factors, an inhibitory approach wassed. Inhibition of the entire HIF-system was achieved by aden-viral overexpression of a dominant-negative mutant of HIF-2�AdXHif�dn). This mutant is a C-terminal deletion mutant lack-ng the essential transactivation domains and acts by competitivenhibition of both, HIF-1� and HIF-2� (Maemura et al., 1999; Poitzt al., 2011; Jing et al., 2012). Adenovirus encoding �-galactosidaseAdXlacZ) served as control. Fig. 4B shows that on the mRNA level,he expression of Hif�dn led to a reduced hypoxia-mediated induc-ion of ahif and simultaneously to a blunted downregulation ofIF-1� mRNA. As expected, overexpression of HIF�dn also results

n elevated HIF-1� protein levels after 24 h of hypoxic cultivationFig. 4D). The influence of HIF-1� and HIF-2� on the putative anti-ense regulation of HIF-1� itself was investigated by adenoviralverexpression of the two �-subunits in macrophages prior to 24 h

reoxygenation rapidly decreases ahif levels and inversely increases the amount ofHIF-1� mRNA (n = 4).

hypoxia. The overexpression was successful, as determined by real-time PCR and Western blot (data not shown). Changes in mRNA andprotein expression of HIF-1� and ahif were determined (Fig. 4B andD). To study the influence of overexpressed HIF-1� on the mRNA

of endogenous HIF-1�, primers specifically detecting endogenousHIF-1� were used. After HIF-2� overexpression the induction ofahif under hypoxia was more pronounced than the rise mediated

230 D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235

Fig. 3. Time-dependent protein expression of HIF-�-subunits under normoxic and hypoxic conditions. Human MDMs were cultured under either normoxic or hypoxicconditions and total cell lysates were prepared at the indicated time points. 30 �g of protein were analyzed by immunoblotting using anti-HIF-1� (A) or anti-HIF-2� antibody(B) and quantified by densitometry. To verify homogeneous loading �-actin was analyzed in parallel on the same gel (n = 4). A distinct hypoxic regulation of the HIF-1� and-2� subunit was observed: transient upregulation of HIF-1� and a continuous increase of HIF-2� protein. Protein expression of HIF-1� and -2� was analyzed in nucleare essionu after tb fter 2

bdotespei

otourseH

3h

hm

tw

xtracts of normoxic and hypoxic macrophages. After 4 h hypoxic treatment an exprnder the detection limit after 24 h hypoxia. In contrast, HIF-2� was still detectabley an ELISA-based approach. Again, the binding activity was significantly reduced a

y overexpression of HIF-1�. This is remarkable, because a furtherownregulation of HIF-1� mRNA was observed by overexpressionf HIF-2� under hypoxia compared to the lacZ control. In contrasthe overexpression of HIF-1� did not modulate the expression ofndogenous HIF-1�. The effect of HIF-2� overexpression was alsotudied at the protein level and showed reduced levels of HIF-1�rotein compared to cells infected with AdXlacZ (Fig. 4D, left). Inter-stingly, cells overexpressing HIF-1� also showed a slight reductionn HIF-2� protein levels (Fig. 4D, right).

Beside the use of an overexpression approach, also the silencingf HIF-1� and -2� by siRNA was used to characterize the impact ofhe HIF-transcription factors on the antisense effect. The silencingf HIF-1� and HIF-2� or both, led to a reduced induction of ahifnder hypoxia (Fig. 5B). The consequence of this reduction waseflected by elevated HIF-1� mRNA levels (Fig. 5A, left) in Hif-2�ilenced macrophages and consequent increased HIF-1� proteinxpression (Fig. 5C). In contrast the silencing of HIF-1� did not alterIF-2� expression.

.3. Natural antisense transcript of Hif-1 ̨ regulates Hif-1 ̨ underypoxia

To investigate the consequence of elevated ahif levels onypoxic Hif-1� expression, ahif was adenovirally overexpressed in

acrophages under hypoxia.Cells were infected with ahif-expressing adenovirus 48 h before

he beginning of hypoxic cultivation. The overexpression of ahifas successful as determined by real-time RT-PCR (data not

of both �-subunits was observed within the nucleus. The expression of HIF-1� washis time within the nucleus (C). The DNA-binding activity of HIF-1 was determined4 h of hypoxic cultivation compared to 4 h hypoxia (D) (n = 4).

shown). As depicted in Fig. 6A, already after 4 h of hypoxia, HIF-1�mRNA was slightly reduced in cells overexpressing ahif in compar-ison to cells infected with control virus expressing lacZ. Whereasthe mRNA of HIF-1� was repressed by ahif overexpression, HIF-2� mRNA level were not modulated (Fig. 6A). Interestingly, undernormoxic conditions, overexpression of ahif has no influence on theHIF-1� and HIF-2� mRNA expression (data not shown), suggestingan exclusive and differential role of ahif for HIF-1� regulation underhypoxic conditions which was also mirrored by the fact that ahifwas highly unstable after reoxygenation (Fig. 2C).

The effect of ahif overexpression on Hif-1� expression was muchmore pronounced on protein level. As a result of the reduced HIF-1� mRNA expression, the HIF-1� protein levels after 8 h hypoxiawere repressed due to elevated ahif levels (Fig. 6B). Comparableto the mRNA results, ahif overexpression was not able to modu-late HIF-2� protein levels (Fig. 6B). To give further evidence for thenegative regulation of HIF-1� by ahif, the expression of Enolase-2(ENO2), which is known to be regulated by HIF-1� in hypoxia, wasevaluated after ahif overexpression. As demonstrated in Fig. 6C,ahif overexpression was sufficient to modulate ENO2 expression.In control cells hypoxia increases the mRNA expression of ENO25-fold after 24 h. Compared to this, overexpression of ahif reducedthe hypoxic induction of ENO2 by approximately 40% (Fig. 6C).

Beside the overexpression approach, also the silencing of ahif by

specific siRNAs was focussed. Therefore, two siRNAs, both targetingahif, were used to study the effect on HIF-regulation. As shownin Fig. 7A both siRNAs were able to significantly reduce hypoxicahif expression. This reduction is accompanied by elevated HIF-1�

D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235 231

Fig. 4. The antisense regulation depends on an active HIF-system. To block active transcriptional processes, human MDMs were pretreated with ActinomycinD [1 �g/ml] for30 min. After a further cultivation under normoxic or hypoxic conditions, the mRNA expression of HIF-1� and ahif was analyzed. Inhibition of active transcription abolishesthe hypoxic induction of ahif and the downregulation of HIF-1�, suggesting a transcriptional activation of ahif under hypoxia (A). The results are also reflected on protein level:treatment with ActinomycinD resulted in elevated HIF-1� expression without alteration of HIF-2� expression (C) (n = 5). To investigate the influence of the HIF-transcriptionfactors on the hypoxic ahif regulation, macrophages were adenovirally infected 48 h before cultivation under hypoxic conditions for 24 h to overexpress �-galactosidase(AdXlacZ), a dominant negative mutant of the HIF-system (AdXHif�dn), HIF-1� (AdXHif1�) or HIF-2� (AdXHif2�). The analysis of the mRNA expression of ahif and HIF-1�revealed that inhibition of the HIF-transcription factors (AdXHif�dn) led to a reduction in hypoxic ahif-expression and elevated HIF-1� expression. In contrast, overexpressionof HIF-1� and -2� increased the expression of ahif (AdXHif1�, AdXHif2�). Only in the case of HIF-2� a further reduction of endogenous HIF-1� was observed (B) (n = 6).T n facO ion, it

eHoic

4

mcntitps

a

his regulation was also reflected on protein level: inhibition of the HIF-transcriptioverexpression of HIF-2� led to decreased HIF-1� expression (D) (n = 5). In conclus

xpression after 8 h of hypoxic cultivation (Fig. 7C). In the case ofIF-2� a slight decrease on mRNA level was observed. The effectn HIF-1� protein expression is much more pronounced as shownn Fig. 7B. Here, ahif-silencing increases the hypoxic HIF-1� proteinontent without influencing HIF-2� expression.

. Discussion

Macrophages are known to be central mediators of inflam-ation, which in turn promote pathological processes such as

ancer, airway infection and atherosclerosis. Their association withecrotic regions resulting from hypoxic areas is often detrimentalo tumorigenesis and lesion development. Therefore it is of greatmportance to understand the molecular mechanisms regulatinghe cellular functions under hypoxia. In accordance with this, the

resent study was undertaken to analyze the regulation of the HIF-ystem in primary human macrophages.

To evaluate whether the formerly described correlation ofhif and HIF-1� expression (Cayre et al., 2003; Neckers, 1999;

tors by overexpression of HIF�dn increased HIF-1� and did not alter HIF-2� levels. was shown that ahif is regulated in a HIF-dependent manner.

Thrash-Bingham and Tartof, 1999; Uchida et al., 2004), is alsopresent in cells of the vasculature, the mRNA expression of HIF-� and ahif were analyzed under the influence of sustained hypoxia.These data revealed the most pronounced effect regarding a poten-tial antisense regulation in macrophages and therefore these cellswere used for further analysis.

These experiments revealed decreased Hif-1� expression underhypoxia and inversely to that, increased expression of the nat-ural antisense of HIF-1�, ahif. The delayed decrease of Hif-1�in comparison to the ahif induction can be explained by thelow basal expression of ahif as antisense-mediated repressionof a transcript is an equimolare process. In contrast, the HIF-2� mRNA is not modulated under hypoxia. In addition, previousresults of our group could show that hypoxia did not induce apo-ptosis in primary human macrophages under sustained hypoxia

(Poitz et al., 2011). The different regulation of both �-subunits isvery interesting as it was previously reported that hypoxia caninduce HIF-prolylhydroxylase PHD2 and can negatively influencethe HIF-system under hypoxia via this route (Ginouvès et al., 2008).

232 D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235

Fig. 5. Inhibition of the HIF-transcription factors decreases the hypoxic ahif-expression. Human MDMs were transfected with siRNAs to inhibit HIF-1� (siHif1�), HIF-2�(siHif2�) or both (siHif1�/2�). For control a nonsense siRNA was used in all experiments (siscr). 48 h after transfection, cells were cultured for 8 h under hypoxia and themRNA expression of HIF-1�, HIF-2� (A) and ahif (B) were determined. The silencing of HIF-1� and HIF-2� resulted in a decrease of the hypoxic ahif-induction. Furthermore,silencing HIF-2� increased the hypoxic expression of HIF-1� (n = 6). The results of the mRNA analysis are reflected on protein level (C) (n = 3).

Fig. 6. Overexpression of ahif reduces the hypoxic HIF-1� expression and target gene induction. Human macrophages were infected with an adenovirus encoding for eitherlacZ as a control or ahif for 48 h before exposure to hypoxia. The expression levels of HIF-1� and HIF-2� after 4 h of hypoxic cultivation were determined by real-time RT-PCR(A). Ahif overexpression slightly repressed HIF-1� mRNA without modulating HIF-2� mRNA expression (n = 4). Total cell extracts of adenovirally infected macrophagesoverexpressing lacZ or ahif cultured for 8 h under either normoxia or hypoxia were immunoblotted and probed for the expression of HIF-1� and HIF-2� (B). The results showthat ahif overexpression under hypoxia dramatically reduced HIF-1� protein expression without influencing HIF-2� expression (n = 3). The mRNA expression of Enolase-2was determined after exposure of the MDMs to 24 h hypoxia. Ahif overexpression also reduced the hypoxic induction of this HIF-target gene (C) (n = 5).

D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235 233

Fig. 7. Silencing of ahif increases HIF-1� expression. Human MDMs were transfected with siRNAs targeting ahif. The siRNAs are directed against the region within theahif RNA, which is not complementary to HIF-1�. 48 h after transfection, cells were cultured for further 4 h under either normoxic or hypoxic conditions. The efficiency ofa A expH

Hibalhmrdrvdimht2ooS

saodHwihTtTs

hif-silencing was about 20% by both siRNAs (siahif1/siahif2) (A). The hypoxic mRNIF-1� is dramatically increased by ahif-silencing (B) (n = 3).

owever, results presented so far give strong evidence for a PHD-ndependent mechanism: 1st: macrophages downregulate HIF-1�,ut not HIF-2� protein under sustained hypoxia and 2nd: hypoxiaffects the expression of HIF-1� also on mRNA level. On proteinevel HIF-2� protein kept accumulating over the entire time ofypoxia, whereas HIF-1� is downregulated specifically. In nor-oxia, our data confirm the commonly known PHD-dependent

egulation of the �-subunits, as in this case no HIF-�-subunits wereetectable and the short-term cultivation under hypoxic conditionsapidly stabilizes both �-subunits. But especially the second obser-ation cannot be explained by a PHD-dependent mechanism. PHDoes not influence the mRNA expression. Thus, in contrast to stud-

es performed on tumour cells or fibroblasts, in primary humanacrophages the main mechanism of regulation under long-term

ypoxia seems not to rely on enhanced expression and activa-ion of the PHD-system (Appelhoff et al., 2004; D’Angelo et al.,003; Ginouvès et al., 2008). Former studies in macrophages onlybserve a downregulation of HIF-1� protein but without focussingn mRNA data and the regulation of HIF-2� (Elbarghati et al., 2008;tiehl et al., 2006).

Beside the correlative observation of lowered HIF-1� expres-ion in concert with the hypoxia-mediated ahif induction, differentpproaches were used to characterize this hypoxic regulationf the HIF-transcription factors. Adenoviral overexpression of aominant-negative HIF-2�, resulting in a competitive inhibition ofIF-1� and HIF-2�, suggests the existence of a feedback regulationithin the HIF-system itself: lowered transcriptional activity of HIF

n macrophages led to reduced ability to induce ahif in response toypoxia and thus to higher HIF-1� mRNA and protein expression.

hese data suggest an involvement of the HIF-system in the regula-ion of the ahif-induction and also in the downregulation of HIF-1�.he impact of both subunits in ahif regulation was shown in thistudy by overexpression of HIF-1� and -2�. As in both cases the ahif

ression of HIF-1� was increased by ahif-silencing. (C) (n = 4). On the protein level

expression was enhanced, a contribution of both subunits becameevident. Interestingly, the expression of endogenous HIF-1� is onlyslightly modulated by HIF-1� overexpression, which might be dueto either compensatory mechanisms or comparatively high cellu-lar HIF-1� expression levels in the first place. The overexpressionof Hif-2� was associated with a downregulation of HIF-1� mRNAand protein, implying a cross-talk between the two subunits underhypoxia. The HIF-2� mediated downregulation of HIF-1� seemsto be an adaptive mechanism to distinguish between these twosubunits. On the background that functional differences betweenboth HIF Isoenzymes are not well understood until now, this time-dependent regulation of the HIF-system in macrophages might beof great interest. Interestingly, an overexpression of HIF-1� alsoled to reduced HIF-2� protein levels, but the dominant-negativemutant did not modulate the expression of HIF-2�, suggesting a yetunknown additional mode of regulation. It was shown that manygenes were regulated mainly by HIF-1�, especially genes regulat-ing the glycolytic activity of cells and other genes regulated by bothHIF-1� and HIF-2� (Hu et al., 2006). Thus, the modulation of thetime-dependent and quiet distinct expression pattern of both sub-units seems to be a new regulatory mechanism for the adaptationto hypoxia by avoiding an overactivation of HIF-1� under sustainedhypoxia.

Beside the involvement of the HIF-system in the regulationof ahif in human macrophages, our results further demonstratean ahif-mediated downregulation of HIF-1�. Previous studiesfocussing the regulation of ahif nicely enlighten its hypoxic regula-tion, but up to now no evidence exists for HIF-1� modulation by ahif(Rossignol et al., 2004; Thrash-Bingham and Tartof, 1999; Uchida

et al., 2004). In this context, we showed that in macrophages, thedownregulation of HIF-1� mRNA and the rapid induction of ahifnicely correlate: the effect of reoxygenation on the ahif expressiondemonstrates that the antisense transcript is relatively unstable

234 D.M. Poitz et al. / Molecular Immunology 57 (2014) 226– 235

Fig. 8. Mechanism of regulation. Under normoxia, the HIF-� subunits are continuously hydroxylated by the PHD-system. This leads to the degradation of the HIF-� subunits.In contrast, under hypoxia the activity of the PHDs is reduced as they need oxygen as an essential cosubstrate leading to the rapid stabilization of the HIF-� subunits. Theytranslocate into the nucleus and after dimerization with HIF-1� bind to the promotor region of appropriated target genes to induce transcription. One of these target genesis the natural antisense transcript of HIF-1�, which is activated by both HIF-1 and HIF-2. Increased levels of ahif reduce the amount of HIF-1� mRNA, leading to a loss ofHIF-1� under prolonged hypoxia (A). This regulation of the HIF-system in human macrophages leads to an imbalance of HIF-1� and HIF-2� under sustained hypoxia andt

uetasautHbaarwbtom

herefore to a change in the hypoxic response of macrophages (B).

nder normoxic conditions, while inversely the HIF-1� mRNAxpression rapidly increases during reoxygenation. Also the inhibi-ion of transcription and translation was associated with reducedhif induction and simultaneously increased HIF-1� mRNA expres-ion. But only the overexpression of ahif in macrophages would give

clear verification of the direct interrelation of elevated ahif-levelsnder hypoxia and reduced HIF-1� mRNA and protein levels. Addi-ionally, ahif overexpression also reduced the hypoxic induction ofIF-target gene Enolase-2, a glycolytic enzyme, which seems toe mainly regulated by HIF-1�. The exact mechanism of ahif neg-tively acting on Hif-1� expression is not completely clear. Thebsence of this effect under normoxia suggests that the antisenseegulation is a process, exclusively important under conditions,hen the HIF-system is activated. This assertion is also supported

y the fact that under reoxygenation ahif is rapidly degraded. Fur-hermore, the present siRNA-mediated inhibition of ahif showsnly a slightly downregulation of hypoxic ahif expression. Thisight be due to a high turnover of the ahif-RNA leading to a less

efficient silencing. In concert with this, only a slight elevation ofhypoxic Hif-1� mRNA expression was observed. But the impor-tance of these observations is reflected on protein level, wherethe hypoxic downregulation of Hif-1� was blunted by siRNA-mediated downregulation of ahif. In this context, a study of Faridaniet al. was published, where RNA:RNA interactions of differentsense-antisense transcripts were analyzed. Among others also theHIF-1�:ahif interaction was focussed (Faridani et al., 2008). Inter-estingly, they could not find any duplex formation within the3′-UTR of HIF-1�. It was argued that potentially other mechanisms,than simple duplex formation, were responsible for the observedantisense effect. Nevertheless, as also shown in this study, ahif isrelatively unstable and rapidly degraded under normoxic condi-tions which might be responsible for the fail in the detection of

RNA duplexes in the study of Faridani et al.

Recently, a study was published which shows beside the exist-ence of ahif, which is located in the 3′-UTR of HIF-1� also thatanother antisense transcript, located in the 5′UTR of HIF-1� exists.

Immu

IbtBm

thbUeoptusr

A

a

e

R

A

A

B

B

B

B

C

C

D

E

E

D.M. Poitz et al. / Molecular

n contrast to ahif, they describe that this transcript is not inducibley hypoxia mimetic desferrioxamin, but by treatment with camp-othecin, a DNA topoisomerase I inhibitor (Baranello et al., 2010;ertozzi et al., 2011). These results further fortify the multipleodes of regulation of the human HIF-1� gene.Taken together, this study shows an alternative regulation of

he HIF-system in primary human macrophages in adaptation toypoxia: Acute hypoxia initially stabilizes both HIF-� subunitsy inhibiting the PHD-mediated degradation of HIF-� proteins.nder continued hypoxia the HIF-transcription factors induces thexpression of ahif. This elevation of ahif leads to the reductionf HIF-1� mRNA expression followed by the reduction of HIF-1�rotein. This in turn decreases the HIF-1 mediated gene regula-ion. Therefore, the differential expression pattern of both subunitsnder sustained hypoxia might have importance for the target genepecificity and thus for the prevention of an overactivation of HIF-1egulated processes (Fig. 8).

cknowledgements

R.B.-D. was supported by grants of the SFB 655. This project waslso supported by grants of the Meddrive program and the CRTD.

Peggy Barthel, Janet Lehmann and Anita Männel are acknowl-dged for excellent technical assistance.

eferences

ppelhoff, R., Tian, Y., Raval, R., Turley, H., Harris, A., Pugh, C., Ratcliffe, P., Gleadle,J., 2004. Differential function of the prolyl hydroxylases PHD1, PHD2, and PHD3in the regulation of hypoxia-inducible factor. J. Biol. Chem. 279, 38458–38465.

ugstein, A., Poitz, D., Braun-Dullaeus, R., Strasser, R., Schmeisser, A., 2011. Cell-specific and hypoxia-dependent regulation of human HIF-3�: inhibition of theexpression of HIF target genes in vascular cells. Cell Mol. Life Sci. 68, 2627–2642.

aranello, L., Bertozzi, D., Fogli, M., Pommier, Y., Capranico, G., 2010. DNA topoiso-merase I inhibition by camptothecin induces escape of RNA polymerase II frompromoter-proximal pause site, antisense transcription and histone acetylationat the human HIF-1alpha gene locus. Nucleic Acids Res. 38, 159–171.

ertozzi, D., Iurlaro, R., Sordet, O., Marinello, J., Zaffaroni, N., Capranico, G., 2011.Characterization of novel antisense HIF-1alpha transcripts in human cancers.Cell Cycle 10, 3189–3197.

jornheden, T., Levin, M., Evaldsson, M., Wiklund, O., 1999. Evidence of hypoxic areaswithin the arterial wall in vivo. Arterioscler. Thromb. Vasc. Biol. 19, 870–876.

ruick, R., 2003. Oxygen sensing in the hypoxic response pathway: regulation of thehypoxia-inducible transcription factor. Genes Dev. 17, 2614–2623.

ayre, A., Rossignol, F., Clottes, E., Penault-Llorca, F., 2003. aHIF but not HIF-1alphatranscript is a poor prognostic marker in human breast cancer. Breast CancerRes. 5, R223–R230.

rucet, M., Wust, S.J., Spielmann, P., Luscher, T.F., Wenger, R.H., Matter, C.M., 2013.Hypoxia enhances lipid uptake in macrophages: role of the scavenger receptorsLox1, SRA, and CD36. Atherosclerosis 229, 110–117.

’Angelo, G., Duplan, E., Boyer, N., Vigne, P., Frelin, C., 2003. Hypoxia up-regulatesprolyl hydroxylase activity: a feedback mechanism that limits HIF-1 responseduring reoxygenation. J. Biol. Chem. 278, 38183–38187.

lbarghati, L., Murdoch, C., Lewis, C., 2008. Effects of hypoxia on transcription fac-tor expression in human monocytes and macrophages. Immunobiology 213,899–908.

lvidge, G., Glenny, L., Appelhoff, R., Ratcliffe, P., Ragoussis, J., Gleadle,J., 2006. Concordant regulation of gene expression by hypoxia and

nology 57 (2014) 226– 235 235

2-oxoglutarate-dependent dioxygenase inhibition: the role of HIF-1�, HIF-2�,and other pathways. J. Biol. Chem. 281, 15215–15226.

Faridani, O., McInerney, G., Gradin, K., Good, L., 2008. Specific ligation to double-stranded RNA for analysis of cellular RNA:RNA interactions. Nucleic Acids Res.36, e99.

Ginouvès, A., Ilc, K., Macías, N., Pouysségur, J., Berra, E., 2008. PHDs overactivationduring chronic hypoxia “desensitizes” HIF� and protects cells from necrosis.Proc. Natl. Acad. Sci. U.S.A. 105, 4745–4750.

Hu, C., Iyer, S., Sataur, A., Covello, K., Chodosh, L., Simon, M., 2006. Differential reg-ulation of the transcriptional activities of hypoxia-inducible factor 1� (HIF-1�)and HIF-2� in stem cells. Mol. Cell. Biol. 26, 3514–3526.

Jing, D., Wobus, M., Poitz, D.M., Bornhauser, M., Ehninger, G., Ordemann, R., 2012.Oxygen tension plays a critical role in the hematopoietic microenvironment invitro. Haematologica 97, 331–339.

Kong, T., Eltzschig, H.K., Karhausen, J., Colgan, S.P., Shelley, C.S., 2004. Leukocyteadhesion during hypoxia is mediated by HIF-1-dependent induction of beta2integrin gene expression. Proc. Natl. Acad. Sci. U.S.A. 101, 10440–10445.

Kotch, L., Iyer, N., Laughner, E., Semenza, G., 1999. Defective vascularization of HIF-1�-null embryos is not associated with VEGF deficiency but with mesenchymalcell death. Dev. Biol. 209, 254–267.

Lofstedt, T., Fredlund, E., Holmquist, M., Pietras, A., Ovenberger, M., Poellinger, L.,Pahlman, S., 2007. Hypoxia inducible factor-2� in cancer. Cell Cycle 6, 919–926.

Maemura, K., Hsieh, C., Jain, M., Fukumoto, S., Layne, M., Liu, Y., Kourembanas, S.,Yet, S., Perrella, M., Lee, M., 1999. Generation of a dominant-negative mutant ofendothelial PAS domain protein 1 by deletion of a potent C-terminal transacti-vation domain. J. Biol. Chem. 274, 31565–31570.

Murdoch, C., Giannoudis, A., Lewis, C., 2004. Mechanisms regulating the recruitmentof macrophages into hypoxic areas of tumors and other ischemic tissues. Blood104, 2224–2234.

Nakayama, T., Kurobe, H., Sugasawa, N., Kinoshita, H., Higashida, M., Matsuoka, Y.,Yoshida, Y., Hirata, Y., Sakata, M., Maxfield, M.W., Shimabukuro, M., Takahama,Y., Sata, M., Tamaki, T., Kitagawa, T., Tomita, S., 2013. Role of macrophage-derivedhypoxia-inducible factor (HIF)-1alpha as a mediator of vascular remodelling.Cardiovasc. Res. 99, 705–715.

Neckers, L., 1999. aHIF: the missing link between HIF-1 and VHL? J. Natl. Cancer Inst.91, 106–107.

Peng, J., Zhang, L., Drysdale, L., Fong, G., 2000. The transcription factor EPAS-1/hypoxia-inducible factor 2� plays an important role in vascular remodeling.Proc. Natl. Acad. Sci. U.S.A. 97, 8386–8391.

Poitz, D., Augstein, A., Weinert, S., Braun-Dullaeus, R., Strasser, R., Schmeisser,A., 2011. OxLDL and macrophage survival: essential and oxygen-independentinvolvement of the Hif-pathway. Basic Res. Cardiol. 106, 761–772.

Rossignol, F., de, L.E., Mounier, R., Bonnefont, J., Cayre, A., Godinot, C., Simonnet,H., Clottes, E., 2004. Natural antisense transcripts of HIF-1� are conserved inrodents. Gene 339, 121–130.

Semenza, G., 2003. Targeting HIF-1 for cancer therapy. Nat. Rev. Cancer 3, 721–732.Sluimer, J., Gasc, J., van Wanroij, J., Kisters, N., Groeneweg, M., Sollewijn Gelpke,

M., Cleutjens, J., van den Akker, L., Corvol, P., Wouters, B., Daemen, M., Bijnens,A., 2008. Hypoxia, hypoxia-inducible transcription factor, and macrophages inhuman atherosclerotic plaques are correlated with intraplaque angiogenesis. J.Am. Coll. Cardiol. 51, 1258–1265.

Stiehl, D., Wirthner, R., Koditz, J., Spielmann, P., Camenisch, G., Wenger, R., 2006.Increased prolyl 4-hydroxylase domain proteins compensate for decreased oxy-gen levels: evidence for an autoregulatory oxygen-sensing system. J. Biol. Chem.281, 23482–23491.

Thrash-Bingham, C., Tartof, K., 1999. aHIF: a natural antisense transcript overex-pressed in human renal cancer and during hypoxia. J. Natl. Cancer Inst. 91,143–151.

Uchida, T., Rossignol, F., Matthay, M., Mounier, R., Couette, S., Clottes, E., Clerici,C., 2004. Prolonged hypoxia differentially regulates hypoxia-inducible factor(HIF)-1� and HIF-2� expression in lung epithelial cells: implication of natural

antisense HIF-1�. J. Biol. Chem. 279, 14871–14878.

Vink, A., Schoneveld, A., Lamers, D., Houben, A., van der, G.P., van Diest, P.,Pasterkamp, G., 2007. HIF-1� expression is associated with an atheromatousinflammatory plaque phenotype and upregulated in activated macrophages.Atherosclerosis 195, e69–e75.