Promotion of chondrogenesis of marrow stromal stem cells by TGF-β3 fusion protein in vitro

J Huazhong Univ Sci Technol [Med Sci] 33(5):2013

692

Promotion of Chondrogenesis of Marrow Stromal Stem Cells by TGF-β3 Fusion Protein In Vitro*

Wei WU (吴薇)1†, Yang DAN (但洋)2†, Shu-hua YANG (杨述华)2, Cao YANG (杨操)2, Zeng-wu SHAO (邵增务)2, Wei-hua XU (许伟华)2, Jin LI (李进)2, Xian-zhe LIU (刘先哲)2, Dong ZHENG (郑东)2# 1Department of Pediatics, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430030, China 2Department of Orthopedics, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan 430022, China © Huazhong University of Science and Technology and Springer-Verlag Berlin Heidelberg 2013

Summary: The purpose of this study was to investigate the repair of the osteoarthritis(OA)-induced car-tilage injury by transfecting the new TGF-β3 fusion protein (LAP-MMP-mTGF-β3) with targeted ther-apy function into the bone marrow-derived mesenchymal stem cells (MSCs) in rats. The recombinant of pIRES-EGFP-MMP was constructed by combination of DNA encoding MMP enzyme cutting site and eukaryotic expression vector pIRES-EGFP. LAP and mTGF-β3 fragments were obtained from rat em-bryos by RT-PCR and inserted into the upstream and downstream of MMP from pIRES-EGFP-MMP respectively, so as to construct the recombinant plasmid of pIRES-EGFP-LAP-MMP-mTGF-β3. pIRES- EGFP-LAP-MMP-mTGF-β3 was transfected into rat MSCs. The genetically modified MSCs were cul-tured in medium with MMP-1 or not. The transfected MSCs were transplanted in the rat OA models. The OA animal models were surgically induced by anterior cruciate ligament transaction (ACLT). The pathological changes were observed under a microscope by HE staining, Alcian blue, Safranin-fast Gre- en and graded by Mankin’s scale. pIRES-EGFP-LAP-MMP-mTGF-β3 was successfully constructed by means of enzyme cutting and sequencing, and the mTGF-β3 fusion protein (39 kD) was certified by Western blotting. Those genetically modified MSCs could differentiate into chondrocytes induced by MMP and secrete the relevant-matrix. The transfected MSCs could promote chondrogenesis and matrix production in rat OA models in vivo. It was concluded that a new fusion protein LAP-MMP-mTGF-β3 was constructed successfully by gene engineering, and could be used to repair the OA-induced cartilage injury. Key words: fusion protein; marrow stromal cells; directional differentiation; transforming growth fac-tor-beta 3; cartilage injury

Osteoarthritis (OA) is the most common form of chronic arthritis, a major cause of pain, disability, and loss of life quality. Although the majority of the patients show slow disease progression and never need joint re-placement, there is an important loss in quality of life. Cartilage degradation is considered as a result of excess physical loading and friction associated with aging, ana-tomical variation and former traumatic injury. However, it is now widely accepted that degeneration is mediated by chemical factors such as proteinases and cytokines. Matrix metalloproteinases (MMPs) are the most critical proteases that degrade the extracellular matrix of carti-lage in OA[1–3]. MMP-1 is an interstitial collagenase that has ability to degrade interstitial collagens (types Ⅰ, Ⅱ and Ⅲ). Moreover it is a multifunctional molecule with an important role in diverse physiological processes that can maintain osteochondral integrity[4–6].

Wei WU, E-mail: [email protected]; Yang DAN, E-mail: [email protected] †These authors contributed equally to this work.

#Corresponding author, E-mail: [email protected] *This project was supported by the National Natural Science Foundation of China (No. 81101376).

Mesenchymal stem cells (MSCs) are progenitor cells which distribute in many tissues, including bone mar-row[7]. MSCs can easily be isolated and expanded with-out losing their ability to differentiate into different con-nective tissue cell types, such as chondrocytes and os-teoblasts. To induce chondrogenic differentiation, MS- Cs require the appropriate signals. Several previous studies have demonstrated that a variety of growth factors such as bone morphogenic proteins and transforming growth factor-beta 3 (TGF-β3) can induce the differen-tiation of MSCs into chondrocytes under certain culture conditions[8, 9].

Previous studies also reported that MMP inhibitors or implanted cells can repair OA-induced cartilage injury, but the outcome is not ideal and sometimes excessive repair phenomenon occurs. In this study, in order to rea-sonably repair the cartilage injury, we designed fusion protein LAP-MMP-mTGF-β3[10], in which LAP and ma-ture TGF-β3 has a stable connection, and the specific restriction sites of MMP contain a sequence of peptide chain (GGGSPLGLWAGGGS), so that the newly de-signed LAP-MMP-mTGF-β3 could release the mature TGF-β3 only in an environment with MMP enzymes, and the efficacy of inducing chondrogenesis of MSCs in rats was detected in vitro and in vivo.

33(5):692-699,2013J Huazhong Univ Sci Technol [Med Sci]

DOI 10.1007/s11596-013-1182-z


693

1 MATERIALS AND METHODS 1.1 Reagents and Cells

The strains of plasmid pIRES-EGFP and E. coli DH5α were maintained by our lab. Fetal bovine serum (FBS) were purchased from GBICO (USA), MMP-1 from R&D Co. (USA), Taq enzyme and Dntps from MBI (GB), EcoRⅠ, PstⅠ, Nhe, BgⅠ, KpnⅠ, ApaⅠ, T4 DNA ligase and gel extraction kit from TakaRa (Japan), Trizol kit and LipofectamineTM2000 from Invitrogen (USA), a small number of plasmid purification kits from Shanghai Waston Biological Co. (China), DNA molecu-lar weight standards from Beijing Beyotime Inc. (China), and primers were synthesized by the Shanghai Public Health (China). Other reagents were of analytical purity. 1.2 Construction and Identification of pIRES-EGFP- MMP

Two oligonucleotides were artificially synthesized on the basis of translation products of GGGSPLGLWA- GGGS (sense: 5'-GAATTCAGGGGGAGGCGGATCC- CCGCTCGGGCTTTGGGCGGGAGGGGGCTCAC-3'; antisense: 5'-CTGCAGTGAGCCCCCTCCCGCCCAA- AGCCCGAGCGGGGATCCGCCTCCCCCTG-3'). The underlined were the sticky end of EcoRⅠ and PstⅠAn- nealing of the two complementary oligonucleotides formed the complementary double-stranded with the sticky end (annealing buffer containing 10 mmol/L Tris- HCl, 100 mmol/L NaCl). The plasmid pIRES-EGFP was extracted by commercial kits according to the manufacturer’s instruction, and subjected to double restric-tion enzymes digestion with restriction endonuclease EcoRⅠ and PstⅠ. After 1% agarose gel electrophoresis, the products of the purified large fragment of linear pIRESEGFP were directionally connected with the abo- ve annealed double-stranded DNA by T4 ligase at 16°C overnight. The connection products were transformed into competent E. coli DH5α by using previously re-ported CaCl2 method, and spread in a LB agar with am-picillin (100 μg/mL). The positive clones were picked out and identified by using PCR. The primers of pIRES- EGFPMMP were as the follows: forward,5'-ACTCA- GATCTCGAGCTCAAGC-3'; downward, 5'-ACACC- GGCCTTATTCCAA-3' (123 bp). The PCR reaction conditions included pre-annealing at 94°C for 5 min, 33 cycles of annealing at 94°C for 30 s, degeneration at 55°C for 30 s, and at 72°C for 30 s, a final at complete extension at 72°C for 5 min. The amplified fragment was identified by 2% agarose gel electrophoresis. 1.3 Construction and Identification of pIRES-EGFP- LAP-MMP

The embryos mesodermal organization was taken from one-week-old Sprague-Dawley (SD) rat (fetal mou- se germ). After homogenization, the total RNA with Trizol kit was distilled. Then, 2 μg of total RNA was tra- nscriped into cDNA by using reverse transcription kit. The coding sequence of LAP was amplified by using PCR, including the upstream primer (5'-GCGCTAGCA- TGAAGATGCACTTACAA-3') and the downstream primer (5'-CGAGATCTGTTGTCCACTCCTTTG-3') (The underlined were endonuclease sites of NheⅠ and Bgl respectively), and the product of 781 bp was generated. The reaction conditions of PCR were 94ºC for 5 min, 94ºC for 30 s, 58ºC for 40 s, 72ºC for 60 s,30 cycles, and a final complete extension at 72ºC for 5 min. A total of 5

μL PCR products were separated by 1% agarose gel electrophoresis. The bands were visualized and photo-graphed under ultraviolet light.

The LAP fragments on gene TGF-β3 of PCR prod-uct and pIRES-EGFP-MMP were respectively subjected to double restriction enzyme digestion by Nhe Ⅰ and Bgl Ⅱ, and then recovered by agarose gel. The products were directionally connected by T4 ligase at 16ºC over-night. The ligated products were transformed into the competent E. coli DH5α. The positive colonies were picked up, and put into a tube for amplification. The plas-mids were identified by restriction enzyme digestion after purification. 1.4 Construction and Identification of pIRES-EGFP- LAP-MMP-mTGF-β3

One-week-old SD rat embryos mesodermal or-ganization was taken and mTGF-β3 was amplified according to the aforementioned method [the up-stream primer: 5'-CAGGTACCATGCTGTGTGCGCC- CCCTC-3' and the downstream primer: 5'-CAGGG- CCCTCAGCTGCACTTACACGA-3' (313 bp)]. The underlined were the sticky end of KpnⅠ and ApaⅠ respectively. The reaction conditions for PCR were as follows: 94ºC for 5 min, 94ºC for 30 s, 59ºC for 30 s, 72ºC for 50 s, 30 cycles, and a final at extension 72ºC for 5 min. A total of 5 μL of PCR product was sub-jected to 1% agarose gel electrophoresis and PCR re-sults were visualized under ultraviolet light.

The PCR products of gene fragments from mTGF- β3 and pIRES-EGFP-LAP-MMP were given double re-striction enzyme digestion by Kpn Ⅰ and Apa Ⅰrespectively, and then directionally connected. The con-nection products were identified by restriction enzyme digestion. The sequencing was done by Shanghai Life Technologies Co. (China). 1.5 Isolation and Culture of MSCs

The femurs and humerus were dissected from anes-thetized one-month-old SD rat under sterile conditions. Bone marrow cells were harvested by flushing the bone cavity and cultured in the medium containing 15% FBS, high-glucose DMEM, penicillin 100 U/mL, strep-tomycin 100 μg/mL, amphotericin 0.25 μg/mL. The MSCs were seeded in the culture bottle at a density of 1×104, and incubated for 48 h. The attached cells were washed with phosphate-buffered saline (PBS), and the culture medium changed every 3 days. When the cells were grown to the passage three (P3), the purity of MSCs was tested by using flow cytometry. The surface markers (CD34, CD45, STRO-1, and CD105) were examined by flow cytometry. MSCs were dissociated with 0.25% trypsin-EDTA and reseeded continuously at the same cell density and cultured under the same conditions until the fifth passage. 1.6 Transfection of pIRES-EGFP-LAP-MMP-mTGF- β3 into MSCs and Westen Blotting

The MSCs at P3 were transfected in serum-free me-dium by pIRES-EGFP-LAP-MMP-mTGF-β3 and pIR- ES-EGFP (experimental group) or pIRES-EGFP (control group) with cationic liposome Lipofectamine TM 2000 according to the manufacturer’s instructions. At 36th h, the protein expression of pIRES-EGFP was observed under fluorescence microscope. The supernatant was harvested after 48 h and concentrated with dialysis-PEG.

The concentrated supernatant incubated as 37ºC for


694

2 h in experimental group was then divided into two subgroups: one subgroup with 30 ng/mL MMP-1, and one subgroup without 30 ng/mL MMP-1 as negative sub-group. The concentrated supernatants in both subgroups were subjected to Western blotting. 1.7 Pellets Culture of Transfected MSCs

The modified MSCs were divided into two groups (MMP group and control group) at 48 h after transfection of pIRES-EGFP-LAP-MMP-mTGF-β3 plasmid. About 2×105 cells were seeded in each group and transferred into 15 mL sterilized centrifuge tubes, and centrifuged at 1000 r/m for 10 min. Cell clusters formed after precipita-tion with incomplete induction medium. In MMP group, MMP-1 10 ng/mL, high-glucose DMEM, 10–7 mol/L dexamethasone, and 50 μg/mL vitamine C were given, and in control group the same media were given except no addition of MMP-1. All MSCs were incubated in an incubator with 5% CO2 at 37°C. 1.8 Identification of MSCs Differentiation

MSCs pellets were obtained after induction in the medium at 7th, 14th, and 21st day, respectively, and di-gested by 3 mg/mL collagenase, 1 mg/mL hyaluronidase and 0.25% trypsin at 37°C for 3 h. The total RNA was extracted. The conditions of RT-PCR for β-actin, Ag-grecan (Agc) and TIMP were as follows: predegenera-tion at 94ºC for 5min, 94ºC for 45 s, 55ºC for 45 s, 72ºC for 45 s, 33 cycles, and a final extension at 72ºC for 10 min. The conditions for collagen Ⅱ (COL Ⅱ) was predegeneration at 94ºC for 5 min, 94ºC for 45 s, 57ºC for 45 s, 72ºC for 45 s, 33 cycles, and a final complete extension at 72ºC for 10 min.

The primers of COL Ⅱ , Agc and TIMP are shown in table 1. The expression of COL Ⅱ, Agc and TIMP was detected by using RT-PCR.

Table 1 The sequences of the primers

Genes Sequences Size (bp)

Upstream 5'GGCGAGTCTTGCGTCTACC3' COL Ⅱ

Downstream 5'AGGCGTGAGGTCTTCTGTGA3' 421

Upstream 5'GAATCCGAGACACCAACG3' Agc

Downstream 5'TCCTCTTCACCACCCACT3' 406

Upstream 5'CCGCAGCGAGGAGTTTCT3' TIMP

Downstream 5'GGGAAGGCTTCGGGTCAT3'

331

Upstream 5'GTAAAGACCTCTATGCCAACA3' β-actin

Downstream 5'TAGAAGCATTTGCGGTGC3' 259

1.9 Establishment of Animal Models and Injection of Cell Pellets

A total of thirty-five 18-week-old male SD rats, provided by the Experimental Animal Center, Tongji Medical College, Huazhong University of Science and Technology (China), weighing 250–300 g, were used in this experiment. All procedures and the care adminis-tered to the animals were approved by the University Ethics Committee, and performed according to institu-tional guidelines. OA was induced by unilateral transec-tion of the ACLT. The articular cavity of each ACLT knee was injected with transfected-MSCs pellets in 50 µL PBS (MSCs group, n=9) or 50 μL PBS (PBS group, n=6), once every week for 8 weeks. The right femoral condyle articular cartilages were observed grossly. For the histological evaluation, the condyles were fixed in 4% buffered formalin, decalcified, dehydrated and em-bedded in paraffin. The 6-μm thick sections were pre-

pared from the center of the repaired area and stained with hematoxylin and eosine to examine cellular distri-bution, Alcian blue was used to assess glycosami- noglycan synthesis, and Safranin-fast Green to evaluate proteoglycan accumulation. Semiquantitative histopa-thological grading was performed based on a modified Mankin scale[11]. 1.10 Statistical Analysis

Differences between experimental groups were as-sessed using a ANOVA. P values less than 0.05 were considered to be statistically significant.

2 RESULTS 2.1 Flow Chart of Construction of pIRES-EGFP- LAP-MMP-mTGF-β3

The recombinant plasmid pIRES-EGFP-MMP was identified by PCR with two positive clones and empty vector (fig. 1). The amplified products (170 bp) of two positive clones were slightly greater than that (123 bp) of pIRES-EGFP.

Fig. 1 The flow chart of construction of pIRES-EGFP-LAP- MMP-mTGF-β3

2.2 Identification of pIRES-EGFP-LAP-MMP The LAP fragments (781 bp) were amplified on TGF-

β3 through PCR. The agarose gel electrophoresis showed that the size of fragments of PCR products was in accord with that of LAP fragments. Through the digestion with NheⅠ and Bgl Ⅱ, recombinant plasmid pIRES-EGFP- LAP-MMP was cut into two fragments of 781 bp and 5.4 kb, which was in line with that expected[12]. 2.3 Identification of pIRES-EGFP-LAP-MMP-mT- GF-β3 by Enzyme Digestion

The active fragments (313 bp) of TGF-β3 were am-plified through PCR. The results of agarose gel lectro-phoresis showed that the size of PCR products were in accord with that of active fragments. Through the diges-tion with KpnⅠ and ApaⅠ, recombinant plasmid pIR-


695

ES-EGFP-LAP-MMP-mTGF-β3 were also cut into two fragments (313 bp and 6.2 kb). The recombinant plas-mids pIRES-EGFP-LAP-MMP-mTGF-β3 were verified and corrected by enzyme digestion, and sequenced by Shanghai Life Technologies Co. (China, fig. 2), which were fully consistent with the designed. The fragment

from 45 bp to 1195 bp was the full-length of engineering TGF-β3 (LAP and mTGF-β3 acquired from GenBank NM_013174), and the fragment from 830 bp to 887 bp was the inserted MMP restriction sites. The inserted di-rection was correct. After the analysis by DNA-Star software, there was no reading frame shift.


696

Fig. 2 Sequencing of pIRES-EGFP-LAP-MMP-mTGF-β3

2.4 Identification of MSCs and Transfection Effi-ciency

After three passages, the primary MSCs were puri-fied well. Flow cytometry showed that the positive ex-pression rate of STRO-1+ and CD105+ was 92.36% and

90.24%, and the negative expression rate of CD34– and CD45– was 2.8% and 2.7%, respectively. At the se- cond passage of BMSCs, the experimental group and control group showed the expression of green fluorescent protein (EGFP) at 36 h after transfection (fig. 3).


697

Fig. 3 The positive expression of EGFP at 36 h after transfec-tion in experimental group (×100)

2.5 Western Blotting Western blotting showed that the experimental

group had TGF-β3 expression at 39 kD at 48 h after transfection [the molecular weight of fusion protein LAP- MMP-mTGF-β3 was 39 kD (fig. 4A), and the molecular weight of wild TGF-β3 in rats was 47 kD). After addi-tion of MMP-1 in the supernatant of experimental group, there was obvious enzymolysis of fusion protein LAP-MMP-mTGF-β3 on SDS-PAGE, and the dimmer (22.2 kD) consisting of active fragments (11.1 kD) of TGF-β3 was generated. In negative group without MMP- 1, there was no active dimer (22.2 kD), and most of fu-sion proteins were inactive (39.3 kD) (fig. 4B).

Fig 4 Fusion protein LAP-MMP-mTGF-β3 expression by Western Blotting and SDS-PAGE A: Fusion protein LAP-MMP-mTGF-β3 expression at 39 kD; B: Fusion protein LAP-MMP-mTGF-β3 expression on SDS-PAGE at 39 kD. 1, 2, 3 and 4 represent the marker, control group without MMP-1, experimental group with MMP-1 and negative control group respectively.

2.6 RT-PCR

The significant cartilage pellets still formed in MMP group, suggesting that LAP-MMP-mTGF-β3 powerfully antagonized MMP-1 on cartilage matrix degrada-tion and promoted cartilage formation. The expression of COLⅡ, Agc and TIMP is shown in fig. 5. As compared with control group, the expression of COLⅡ, Agc and TIMP was obviously increased in MMP group on the 21st

day( fig. 5). 2.7 Preliminary Experiment for Cartilage Restoration

The rat ACLT model was used to assess the in vivo therapeutic effects of MSCs pellets in OA. The cartilage in PBS group exhibited a rough surface. The proteogly-can accumulation was reduced in PBS group as com-pared with MSCs group (fig. 6). OA severity in MSCs group was significantly alleviated as compared with PBS group. The result of pathological section dyeing by Ma- nkin’s scale demonstrated that there was statistical sig-nificance between the two groups (P<0.05, fig. 6). The results suggesting that transfection of LPA-MMP-TGF- β3 fusion protein into MSCs pellets can prevent cartilage degradation.

Fig. 5 The expression of COLⅡ, Agc and TIMP at 7th, 14th and 21st day after MSCs pellets culture The expression of COL Ⅱ was increased obviously with time and that of Agc increased obviously from 14th day to 21st day in MMP group as compared with control group


698

Fig. 6 Histologic changes of the articular cartilage by HE staining, Safranin-fast Green, and Alcian blue (×200)

Pathological staining of the articular cartilage was done at 8th week. The results demonstrated that the cartilage degeneration in pIRES-EGFP-LAP-MMP-mTGF-β3-transfected MSCs group was significantly alleviated as compared with PBS group.

3 DISCUSSION

MMP is a major effector contributing to cartilage

damage due to a variety of causes. In rheumatoid arthritis (RA) and OA models, some studies have shown that the more the expression of MMP-2 and MMP-9 in TRAP+ mononuclear cells, the severer the destruction of carti-lage. The expression of MMP-2 and MMP-9 is positively correlated with the extent of cartilage damage[13]. The increased MMP-1 and MMP-3 expression is an impor-tant factor leading to cartilage injury during ischemia- reperfusion process[6]. MMPs also play an important role in the pathogenesis of cartilage damage caused by trauma[14]. Even in the pathological process of necrosis of the femoral head, MMPs are the the main effectors contributing to the articular cartilage damage[15]. In re-cent years, many scholars considered that intervention of MMPs will be a new strategy to prevent cartilage dam-age and a large number of related drugs have been de-veloped, eg. MMPs inhibitors CGS227023A, Marimastat, etc. However, animal experiments or clinical trails of these drugs are not so satistactory, which may be attrib-uted to two factors: (1) MMPs inhibitor can only prevent cartilage destruction, but can not promote the repair process; (2) MMPs inhibitors may reduce the matrix re-versal, resulting the occurrence of side effects[16].

TGF-β3 is the key cytokine of cartilage develop-ment, and participates in cell aggregation, proliferation and differentiation in the cartilage maturation procedure. TGF-β3 also, successfully and efficiently, stimulates MSCs to differentiate into cartilage cells in vitro[17,18]. TGF-β3 can also inhibit inflammatory response and promote the expression of MMP inhibitor TIMP[19]. TGF-β3 is considered as one of primary means in curing cartilage damage caused by various reasons in the future. How-ever, in the normal physiological process of cartilage metabolism, destructive factors and repair factors are in an exquisite balance. If the destructive factors, such as MMPs, surpass repair factors of cartilage itself, the car-tilage damage will be cased. The excessive repair factors

intervened by human may also result in the onset of dis-ease. For example, in the pathological process of RA and OA, a large number of expression and activation of compensatory repairing cytokines often cause cartilage ossifications and osteophytes generation[20]. Grimaud et al reported that after injection of TGF-β3 into the joint cavity of ACLT in SD rats, although it makes exciting prelude, a large number of activation of TGF-β3 in the joint cavity results in the synovial membrane prolifera-tion and the surrounding muscle edema, and deteriotion of the components of the synovial fluid, finally leading to the restoration failure[21].

In this study, we conceived a new idea, the wild TGF-β3 was modified and activated in the presence of MMP for the specific repair of the cartilage injury and the new cytokinen can only be activated with the exis-tance of MMP enzymes to repair cartilage damage. In our experiment, by using restriction enzyme digestion and gene sequencing technique, an expression vector pIRES-EGFP-LAP-MMP-mTGF-β3 was constructed successfully, which can display the expression of in-serted target gene easily and immediately. After transfec-tion of pIRES-EGFP-LAP-MMP-mTGF-β3 into MSCs, the expression of fusion protein TGF-β3 in MSCs was observed. Furthermore, we confirmed ths expression of fusion protein TGF-β3 (39 kD) by Westen blotting. In addition, during the process of constructing expression vector of pIRES-EGFP-LAP-MMP-mTGF-β3, linker- (GGGGS)2 was inserted before and after the restriction sites of MMP in order to avoid the inserted pep-tide-induced interference on folding and conformation of LAP and active TGF-β3[22] (fig. 2). In subsequent ex-periments, Western blotting results revealed that after added MMP-1, TGF-β3 fusion proteins were success-fully digested and the active mTGF-β3 dimer (22.2 kD) was generated. In this study, the inserted sequence of restriction site of MMPs is PLGLWA, which is recog-nized as the enzyme digestion site of MMP-1 and MMP-9, and PLGL can also be enzymatically digested by MMP-2, 3[23, 24]. After the transfection of MSCs with pIRES-EGFP-LAP-MMP-mTGF-β3, the COL Ⅱ, Agc


699

and TIMP were increased with time in the presence of MMP (fig. 5). The mRNA expression levels of COL Ⅱ, Agc and TIMP in experimental group were significantly increased as compared with those in control group on the 21st day (P<0.05).

In the in vivo test, pathological staining results demonstrated MSCs spheres transfected with pIRES-EGFP- LAP-MMP-mTGF-β3 could significantly alleviate the OA severity in comparison to controls. The scarring of cartilage in control group was severer than in experi-mental group. It is suggested that the pIRES-EGFP- LAP-MMP-mTGF-β3-transfected MSCs spheres into the joint cavity of OA rats may promote the release of TGF-β3 in the presence of MMP, take part in the repair of the articular cartilage, or slow down the development of OA.

MSCs, as adult stem cells which can differentiate into chandrocytes efficiently, have the advantages of abundant source in vivo, relatively ease acquisition, and stable biological characteristics in vitro.MSCs are be-lieved to be the proper seeding cells for cartilage repair. In this experiment, the MSCs were transfected with LAP-MMP-mTGF-β3 fusion protein and cultured into spheres. In the presence of MMP-1, the transfection of MSCs powerfully promotes the differentiation of MSCs into chondrocytes and the synthesis of cartilage matrix. As a result, MSCs transfected with pIRES-EGFP-LAP- MMP-mTGF-β3 can be efficiently and specifically used for target repair of cartilage injury in inflammatory joint diseases. Conflict of Interest Statement

The authors declare that there is no confict of interest with any financial organization or corporation or individual that can inappropriately influence this work. REFERENCES 1 Hamerman D. The biology of osteoarthritis. New Eng J

Med, 1989,320(20):1322-1330 2 Malemud CJ. Matrix metalloproteinases (MMPs) in

health and disease: an overview. Front Biosci, 2006,11: 1696-1701

3 Meszaros E, Malemud CJ. Prospects for treating os-teoarthritis: enzyme–protein interactions regulating ma-trix metalloproteinase activity. Ther Adv Chronic Dis, 2012,3(5):219-229

4 Kaspiris A, Khaldi L, Grivas TB, et al. Subchondral cyst development and MMP-1 expression during progression of osteoarthritis: An immunohistochemical study. Orthop Traumatol Surg Res, 2013,99(5):523-529

5 Rubenhagen R, Schuttrumpf JP, Sturmer KM, et al. Interleukin-7 levels in synovial fluid increase with age and MMP-1 levels decrease with progression of os-teoarthritis. Acta Orthop, 2012,83(1):59-64

6 Wu HB, Du JY, Zheng QX, et al. Expression of MMP-1 in cartelage and synovium of experimentally induced rab-bit ACLT traumatic osteoarthritis: immunohistochemical study. Rheumatol Int, 2008,29(1):31-36

7 Majumdar MK, Thiede MA, Mosca JD, et al. Phenotypic and functional comparison of cultures of marrow-derived mesenchymal stem cells (MSCs) and stromal cells. J Cell Physiol, 1998,176(1):57-66

8 Takagi M, Umetsu Y, Fujiwara M, et al. High inoculation

cell density could accelerate the differentiation of human bone marrow mesenchymal stem cells to chondrocyte cells. J Biosci Bioeng, 2007,103(1):98-100

9 Bouffi C, Thomas O. The role of pharmacologically ac-tive microcarriers releasing TGF-β3 in cartilage forma-tion in vivo by mesenchymal stem cells. Biomaterials, 2010,31(25):6485-6493

10 Young GD, Murphy-Ullrich JE. Molecular interactions that confer latency to transforming growth factor-beta. J Biol Chem, 2004,279:38032-38039

11 Gerwin N, Bendele A M, Glasson S, et al. The OARSI histopathology initiative–recommendations for histologi-cal assessments of osteoarthritis in the rat. Osteoarthr Cartilage, 2010,18(Suppl 3):S24-S34

12 Li J, Yang SH, Zheng D, et al. The in vitro construction of engineered transforming growth factor-beta 3 protein with potential of targeted therapy. Zhong Hua Chuang Shang Gu Ke Za Zhi (Chinese), 2007,9(9):842-846

13 Galasso O, Familiari F, De GM, et al. Recent findings on the role of gelatinases (matrix metalloproteinase-2 and -9) in osteoarthritis. Adv Orthop, 2012,2012:834208

14 Felson DT. Osteoarthritis of the Knee. New Eng J Med, 2006,354(8): 841-848

15 Heard BJ, Martin L, Rattner JB, et al. Matrix metallopro-teinase protein expression profiles cannot distinguish between normal and early osteoarthritic synovial fluid. BMC Musculoskelet Disord, 2012,3(1):126

16 Baragi VM, Becher G, Bendele AM, et al.A new class of potent matrix metalloproteinase 13 inhibitors for potential treatment of osteoarthritis: Evidence of histologic and clinical efficacy without musculoskeletal toxicity in rat models. Arthritis Rheum, 2009,60(7):2008-2018

17 Spagnoli A, Longobardi L, Rear L, et al. Cartilage disor-ders: potential therapeutic use of mesenchymal stem cells. Endocr Dev, 2005,9:17-30

18 Lu CH, Lin KJ, Chiu HY, et al. Improved chondrogenesis and engineered cartilage formation from TGF-beta3-expressing adipose-derived stem cells cultured in the rotating-shaft biore-actor. Tissue Eng Part A, 2012,18(19-20):2114-2124

19 Qureshi HY, Sylvester J, El Mabrouk M, et al. TGF- beta-induced expression of tissue inhibitor of metallopro-teinases-3 gene in chondrocytes is mediated by extracel-lular signal-regulated kinase pathway and Sp1 transcrip-tion factor. J Cell Physiol, 2005,203(2):345-352

20 Scharstuhl A, Glansbeek HL, Beuningen HM, et al. Inhi-bition of endogenous TGF-beta during experimental os-teoarthritis prevents osteophyte formation and impairs cartilage repair. J Immunol, 2002,169(1):507-514

21 Grimaud E, Heymann D, Redini F, et al. Recent advances in TGF-beta effects on chondrocyte metabolism. Potential therapeutic roles of TGF-beta in cartilage disorders. Cy-tokine Growth Factor Rev, 2002,13(3):241-257

22 Wriggers W, Chakravarty S, Jennings PA, et al. Control of protein functional dynamics by peptide linkers. Bio-polymers, 2005,80(6):736-746

23 Peng KW, Morling FJ, Cosset FL, et al. A gene delivery system activatable by disease-associated matrix metallo-proteinases. Hum Gene Ther, 1997,8(6):729-738

24 Nagase H, Fields GB. Human matrix metalloproteinase specificity studies using collagen sequence-based syn-thetic peptides. Biopolymers, 1996,40(4):399-416

(Received May 14, 2013; revised Sep. 15, 2013)

Promotion of chondrogenesis of marrow stromal stem cells by TGF-β3 fusion protein in vitro

Documents

Transcript of Promotion of chondrogenesis of marrow stromal stem cells by TGF-β3 fusion protein in vitro