BiomaterialsScience

PAPER

Cite this: Biomater. Sci., 2014, 2,1230

Received 7th April 2014,Accepted 16th May 2014

DOI: 10.1039/c4bm00111g

www.rsc.org/biomaterialsscience

Lithium release from β-tricalcium phosphateinducing cementogenic and osteogenicdifferentiation of both hPDLCs and hBMSCs

Pingping Han,a Mengchi Xu,b Jiang Chang,b Nishant Chakravorty,a Chengtie Wu*b

and Yin Xiao*a

It is accepted that the accelerated differentiation of tissue cells on bioactive materials is of great impor-

tance to regenerate the lost tissues. It was previously reported that lithium (Li) ions could enhance the

in vitro proliferation and differentiation of retinoblastoma cells and endometrium epithelia by activating

the Wnt canonical signalling pathway. It is interesting to incorporate Li ions into bioactive ceramics, such

as β-tricalcium phosphate (Li-β-TCP), in order to stimulate both osteogenic and cementogenic differen-

tiation of different stem cells for the regeneration of bone/periodontal tissues. Therefore, the aim of this

study was to investigate the interactions of human periodontal ligament cells (hPDLCs) and human bone

marrow stromal cells (hBMSCs) with Li-β-TCP bioceramic bulks and their ionic extracts, and further

explore the osteogenic and cementogenic stimulation of Li-β-TCP bioceramics and the possible mole-

cular mechanisms. The results showed that Li-β-TCP bioceramic disks supported the cell attachment and

proliferation, and significantly enhanced bone/cementum-related gene expression, Wnt canonical signal-

ling pathway activation for both hPDLCs and hBMSCs, compared to conventional β-TCP bioceramic disks

without Li. The release of Li from Li-β-TCP powders could significantly promote the bone/cementum-

related gene expression for both hPDLCs and hBMSCs compared to pure β-TCP extracts without Li

release. Our results suggest that the combination of Li with β-TCP bioceramics may be a promising

method to enhance bone/cementum regeneration as Li-β-TCP possesses excellent in vitro osteogenic

and cementogenic stimulation properties by inducing bone/cementum-related gene expression in both

hPDLCs and hBMSCs.

1. Introduction

For bone/periodontal tissue regeneration application, it is gen-erally accepted that the quick differentiation of tissue cells onbioactive materials is of great importance to regenerate thedeficient and injured tissues.1–3 To achieve this target, thestrategy for applying growth factors to accelerate the differen-tiation of tissue cells has been widely studied;4,5 however, theusage of growth factors is highly expensive and may havepotential health risks.6,7 The third-generation of biomaterialsshould possess the ability to stimulate the differentiation ofstem cells for tissue regeneration.8–11 Increasing studies haveshown that bioactive materials with specific bioactive compo-

sitions and microstructures can induce the differentiation ofstem cells and promote tissue regeneration. For this reason, itis of great significance to prepare proper bioceramics torelease inorganic stimulus to stimulate the response of stemcells for bone and periodontal tissue regeneration without theusage of additional growth factors.12,13 It is well known thatbeta-tricalcium phosphate (β-TCP) is the most conventionallyused bioceramics for the regeneration of bone/periodontaltissues due to its high osteoconductivity and degradability;however, there are few reports stating that β-TCP bioceramicscan significantly induce the differentiation of stem cells andpresent the significant osteostimulation for the regenerationof bone/periodontal tissues.14–17 Although β-TCP bioceramicsare generally biodegradable and biocompatible, they are stillfar from optimal for stimulating the osteogenic/periodontaldifferentiation of stem cells to achieve the optimal healingtime of tissue defects.18,19 In the past several years, strontiummodified β-TCP bioceramics capable of enhancing the cell via-bility and differentiation of osteoblast-like cells with improvedbioactivity have been prepared for bone regeneration appli-cation.20 This suggested that bioactive ion modification of

aInstitute of Health & Biomedical Innovation, Queensland University of Technology,

Brisbane, Queensland 4059, Australia. E-mail: yin.xiao@qut.edu.au;

Fax: +61-7-31386030; Tel: +61-7-31386240bState Key Laboratory of High Performance Ceramics and Superfine Microstructure,

Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050,

People’s Republic of China. E-mail: chengtiewu@mail.sic.ac.cn;

Fax: +86-21-52413903; Tel: +86-21-52412249

1230 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

.

View Article OnlineView Journal | View Issue

β-TCP bioceramics may be a viable method to stimulate differ-entiation of mesenchymal stem cells for better tissueregeneration.

Lithium chloride (LiCl) has been used as a mood stabiliserwhich can stimulate the proliferation of retinoblastoma cellsand endometrium epithelia cells via elevated Wnt canonicalsignalling.21–24 Li can enhance fracture healing in mice, whileclinically it reduces the incidence of fractures with increasedbone mass and density with increasing accumulated dose ofLi.25–27 Its role in fracture healing is further demonstrated byincreased β-catenin expression in fractured tissue in patientstaking Li.28 Yet, there are some reports that argue against thepharmacological benefit of reducing fracture risks with Li.29

Cohen’s findings demonstrated that the clinical datasuggested an increase in bone turnover associated withlithium carbonate therapy treatment; however, no distincteffect was observed on the bone density after short and long-term lithium carbonate therapy, indicating that treatment withLi is not associated with increased risk for osteoporosis.30 Theresults suggest that the biological role of Li ions in bone is notfully clear. Although there are several studies showing that Liions could regulate the apatite mineralization of bioglass andenhance osteoblast proliferation of hydroxyapatite,31–33 theeffect of Li-containing bioceramics on the differentiation ofdifferent tissue cells, such as hBMSCs and hPDLCs, as well asthe related molecular mechanisms are unclear. It is believedthat multipotent hBMSCs are involved in bone and perio-dontal defect healing.34 As an attractive cell source for tissueengineering, hBMSCs are easily available, highly proliferativeand multipotent to differentiate into osteoblasts, chondro-cytes, adipose cells, ligament cells, and neural cells.35–39

hPDLCs are considered to be able to regenerate the alveolarbone, periodontal ligament and cementum.40 Activation ofosteogenic/cementogenic potential of both hPDLCs andhBMSCs by bioactive materials would greatly accelerate thenew bone and cementum formation in the bone/periodontaldefect site.

Therefore, the main aim of this study was to prepare Li-con-taining β-TCP bioceramics in an effort to improve their osteo/cementogenic capabilities compared to conventionally usedβ-TCP bioceramics, and to further elucidate the involved mech-anism in the activation of the pro-osteo/cementogenic Wntcanonical signalling pathway in hPDLCs and hBMSCs byrelease of Li ions from bioceramics. To achieve this aim, theeffect of both Li-β-TCP bioceramic disks and their ionic pro-ducts on the differentiation of hPDLCs and hBMSCs has beensystematically explored in comparison with conventional β-TCPbioceramics.

2. Experimental section2.1. Preparation and characterization of 5Li-β-TCPbioceramic powders and disks

The Li-containing β-TCP (5Li-β-TCP) powders with the chemi-cal composition of (Li0.10Ca0.95)3(PO4)2 were synthesized by a

chemical precipitation method using Ca(NO3)2·4H2O,(NH4)2HPO4 and lithium chloride (LiCl) as starting materials,in which 5% molar Ca was substituted by Li. The solution con-taining 0.5 M Ca(NO3)2 and LiCl in the desired molar ratio wasadded dropwise to 0.5 M (NH4)2HPO4 solution while stirring toproduce the target (Ca + Li)/P ratio of 1.5 (stoichiometric forβ-TCP). The pH of the solution was maintained between 7.5and 8 during precipitation with the aid of ammonia. After theprecipitation, the solution was aged overnight, washed sequen-tially in distilled water and anhydrous ethanol, dried at 60 °Cfor 24 h and finally calcined at 800 °C for 3 h. Pure β-TCPpowders were synthesized by a similar method without addingLiCl and used as controls. The synthesized powders wereobserved by scanning electron microscopy (SEM, FEICompany, USA). The real Li contents in Li-β-TCP powders weretested by inductive coupled plasma atomic emission spectro-metry (ICP-AES, Perkin-Elmer Optima 7000DV).

To prepare ceramic discs, the synthesized 5Li-β-TCPpowders were uniaxially pressed at 10 MPa in a mould of Φ10,using 6% polyvinyl alcohol as a binder. The green compactswere subsequently sintered in air at 1100 °C for 3 h at aheating rate of 2 °C min−1. Pure β-TCP ceramic discs were pre-pared by a similar method and used as controls. The crystalphase and surface morphology of the sintered ceramic discswere characterized by X-ray diffraction (XRD, Geigerflex,Rigaku, Japan) and SEM.

2.2. The cell morphology of hPDLCS and hBMSCs on5Li-β-TCP bioceramic disks

Human periodontal ligament cells (hPDLCs) and human bonemarrow stromal cells (hBMSCs) were isolated and culturedaccording to our previously published protocols.10,41 Theethics approval of hPDLCs and hBMSCs in this study wasgranted by the Human Ethics Committee of Queensland Uni-versity of Technology and The Prince Charles Hospital, follow-ing informed consents taken from all the participants. WhilehPDLCs were isolated from the teeth of healthy patients(18–25 years old) undergoing third molar extraction surgery,hBMSCs were isolated from patients (mean age of 65 years)undergoing elective knee and hip replacement surgery.hPDLCs and hBMSCs were seeded on 5Li-β-TCP ceramic disksat the initial seeding density of 105 cells per disk in 48-wellplates and cultured in osteogenic induction medium with thesupplement of 0.1 μM dexamethasone (Sigma-Aldrich, Austra-lia), 10 mM β-glycerophosphate (Sigma-Aldrich, Australia) and50 μg mL−1 ascorbate-2-phosphate (Sigma-Aldrich, Australia).In this study, all experiments were conducted in triplicate.Thus, the cells cultured on three β-TCP ceramic disks wereused as controls in this study; while gene expression wasassessed from samples harvested from 6 ceramic disks of both5Li-β-TCP and β-TCP groups.

The cell morphology on the disks was observed by SEM.The cell samples were fixed in 2.5% glutaraldehyde solutionand then dehydrated with graded ethanol series (30, 50, 70, 90,and 100%) and dried with hexamethyldisilizane (HMDS).Then, the disks were sputter-coated with gold and observed by

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1231

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

SEM (Quanta™ 200) for the morphological characteristics ofhPDLCs and hBMSCs on two ceramic disks.

Confocal laser scanning microscopy (CLSM) was carried outto further determine the morphology of the cell skeleton andnuclei of hPDLCs and hBMSCs on the two ceramic disks fromhigh-resolution optical images. After 1 and 7 days culture, thecell-ceramic complex was fixed with a 4% paraformaldehyde(PFA) solution for 30 min at room temperature and then waspermeabilized with a 0.2% Triton X-100/PBS solution for5 min after washing with PBS once. Samples were then incu-bated for 1 h with 0.5% BSA/PBS containing 0.8 U mL−1 fluor-escein isothiocyanate (FITC, Sigma-Aldrich, Australia) and 5 µgmL−1 DAPI (Sigma-Aldrich, Australia). The cells were visualizedwith a Leica SP5 confocal microscope (Leica Microsystems,Germany).

To investigate whether pH values of the medium will affectthe cell proliferation and differentiation, the culture mediumwas collected for both hBMSCs and hPDLCs after 7 daysculture on 5Li-β-TCP and β-TCP bioceramic disks. Then the pHvalues of the medium were tested using a pH meter (ThermoScientific, Australia).

2.3. Cell proliferation and alkaline phosphatase (ALP) activityassay for hPDLCs and hBMSCs on 5Li-β-TCP bioceramic disks

For the cell proliferation assay, the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was performedin triplicate as described in our previous study protocol.41,42

The formazan crystals were prepared by adding 0.5 mg mL−1

MTT solution (Sigma-Aldrich) for 4 h and then solubilisingwith dimethyl sulfoxide (DMSO, Sigma-Aldrich, Australia). Theabsorbance of formazan–DMSO solution was measured at λ =495 nm using a SpectraMax Microplate Reader (MolecularDevices, Inc., USA).

After 7 and 14 days, the relative ALP activity was determinedfor both cell lines cultured on 5Li-β-TCP ceramic disks usingprevious protocols.9 At each time point, the cells were lysed in200 μL of 0.2% Triton X-100 and then mixed with ALP workingsolution according to the manufacturer’s protocol (Quanti-Chrom™ alkaline phosphatase assay kit, BioAssay Systems,USA). The optical density (OD) value was measured at 405 nmon a plate reader. The relative ALP activity was calculated asthe changed OD values divided by the reaction time and thetotal protein content was measured using the bicinchoninicacid protein assay kit (Thermo Fisher Scientific, Australia).

2.4. Real-time quantitative (RT-qPCR) analysis ofcementogenic/osteogenic gene expression and signallingpathway for hPDLCs and hBMSCs on 5Li-β-TCP bioceramicdisks

Total RNA was extracted from the cells on 5Li-β-TCP and β-TCPceramic disks using the TRIzol® Reagent (Ambion®, LifeTechnologies Pty Ltd, Australia). RT-qPCR was performed onosteogenic-related markers of alkaline phosphatase (ALP) andosteocalcin (OCN), cementum-specific markers of cementumprotein 1 (CEMP1) and cementum attachment protein (CAP),and Wnt canonical-related genes of Wingless-3A (WNT3A)and axis inhibition protein 2 (AXIN2) as shown in Table 1. Allreactions were conducted in triplicate for three independentexperiments. The mean cycle threshold (Ct) value of targetgenes was normalized against the Ct value of the house-keeping gene glyceraldehyde-3-phosphate-dehydrogenase(GAPDH) and 18S ribosomal RNA (18S rRNA) and then therelative expression was calculated by the following formula:2−(normalized average Cts) × 104.

2.5. Ionic concentration analysis for the cell culture mediumafter culturing with 5Li-β-TCP bioceramic disks

To investigate the ion release from 5Li-β-TCP ceramic disks,the cell culture medium was collected after culturing ofhPDLCs and hBMSCs after a fixed culture time; then the con-centrations of Li, Ca and P ions in the medium were measuredby inductive coupled plasma atomic emission spectrometry(ICP-AES, Perkin-Elmer Optima 7000DV).

2.6. The effects of ionic extracts from 5Li-β-TCP powders onthe proliferation and cementum/bone-related gene expressionfor hPDLCs and hBMSCs

The effect of ionic extracts from 5Li-β-TCP powders was furtherinvestigated on the cell proliferation, and osteogenic/cemento-genic-related gene expression of hPDLCs and hBMSCs.43

According to International Standard Organization (ISO/EN)10993-5, the dissolution extracts were prepared by soaking5Li-β-TCP powders in serum-free DMEM at a concentration of200 mg mL−1. Then serial dilutions of extracts (200, 50 and6.25 mg mL−1) were prepared after sterilization using a 0.2 μmfilter in the following studies. The ionic concentrations of Ca,P and Li in the graded extracts were measured by ICP-AES.

Table 1 Primer pairs used in qRT-PCR analysis

Gene Forward primer Reverse primer

ALP 5′ TCAGAAGCTAACACCAACG 3′ 5′ TTGTACGTCTTGGAGAGGGC 3′OCN 5′ GCAAAGGTGCAGCCTTTGTG 3′ 5′ GGCTCCCAGCCATTGATACAG 3′CEMP1 5′ GGGCACATCAAGCACTGACAG 3′ 5′ CCCTTAGGAAGTGGCTGTCCAG3′CAP 5′ CTGCGCGCTGCACATGG 3′ 5′ GCGATGTCGTAGAAGGTGAGCC 3′WNT3A 5′ TGGACAAAGCTACCAGGGAGT 3′ 5′ CCCACCAAACTCGATGTCCTC 3′AXIN2 5′ CCCCAAAGCAGCGGTGC 3′ 5′ GCGTGGACACCTGCCAG 3′CTNNB 5′ GCTACTGTTGGATTGATTCGAAATC 3′ 5′ CCCTGCTCACGCAAAGGT 3′GAPDH 5′ TCAGCAATGCCTCCTGCAC 3′ 5′ TCTGGGTGGCAGTGATGGC 3′18s 5′ TTCGGAACTGAGGCCATGAT 3′ 5′ CGAACCTCCGACTTCGTTC 3′

Paper Biomaterials Science

1232 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

After hPDLCs and hBMSCs were cultured with the β-TCPand 5Li-β-TCP extracts, respectively, the cell proliferation assaywas performed as described in section 2.3. The RT-qPCR ana-lysis for the cementogenic/osteogenic gene expression wasperformed as described in section 2.4. All experiments wereconducted in triplicate.

2.7. Statistical analysis

The statistical analysis was performed using one-way ANOVAfollowed by Tukey’s HSD test, a post-hoc test. A p-value <0.05was considered statistically significant.

3. Results3.1. Characterization of 5Li-β-TCP bioceramic disks

SEM analysis showed the particle size of 5Li-β-TCP and β-TCPpowders to be around 287 ± 46 nm and 282 ± 47 nm, respecti-vely. There is no significant difference in the particles size oftwo kinds of powders (Fig. 1a and b). SEM analysis showedthat both the prepared 5Li-β-TCPand β-TCP bioceramics werefully sintered with dense surface microstructure and clearcrystal boundaries (Fig. 1c and d). The crystal size of 5Li-β-TCPbioceramics is generally smaller than that of β-TCP biocera-

Fig. 1 SEM analysis for 5Li-β-TCP (a) and β-TCP (b) powders, 5Li-β-TCP (c) and β-TCP (d) bioceramic disks. The XRD analysis (e) for 5Li-β-TCP andβ-TCP bioceramic disks. The particle size of 5Li-β-TCP and β-TCP powders is around 287 ± 46 nm and 282 ± 47 nm, respectively. There is no signifi-cant difference in the particle size of two kinds of powders (a and b).

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1233

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

mics (Fig. 1c and d). XRD analysis showed that 5Li-β-TCP cer-amics exhibits the same characteristic peaks as β-TCP ceramicswith the pure β-TCP crystal phase (JCPD 09-0169) (Fig. 1e). Themolar concentration of Li in β-TCP is around 1.83%.

3.2. The cell morphology, proliferation and ALP activity ofhPDLCs and hBMSCs on 5Li-β-TCP bioceramic disks

The cell morphology of hPDLCs and hBMSCs was analysed bySEM after 7 days culture on 5Li-β-TCP and β-TCP bioceramicdisks. Both hPDLCs and hBMSCs attached and spread well onthe surface of two ceramic disks with close contact with cer-amics at day 7 (Fig. 2). We conducted confocal laser scanningmicroscopy imaging to further confirm the cell morphology onthe surface of two bioceramic disks, and it was noted that bothhPDLCs and hBMSCs were healthy and attached on thesurface of disks very well after culturing on two bioceramicdisks for 1 and 7 days (Fig. 3). The CLSM results also demon-strated that 5Li-β-TCP bioceramic disks could enhance cell pro-liferation compared to β-TCP bioceramic disks for bothhPDLCs and hBMSCs at both day 1 and 7 (Fig. 3).

The MTT assay showed that the proliferation of both hPDLCsand hBMSCs increased obviously in a time dependent mannerin each group. The proliferation rate of hPDLCs on 5Li-β-TCPbioceramic disks was significantly higher (∼1.2 fold increase)than that on β-TCP ceramic disks at both day 1 and 7 (Fig. 4a).

The proliferation of hBMSCs was higher (∼1.3 fold higher) on5Li-β-TCP than that on β-TCP ceramic disks at day 1 (Fig. 4b).

The relative ALP activity of hPDLCs on the 5Li-β-TCPceramic disks showed a significant increase of around 2 foldcompared to the β-TCP group at both 7 and 14 days (p < 0.05,Fig. 4c). Fig. 4d revealed that 5Li-β-TCP ceramic disksenhanced the relative activity of ALP in hBMSCs (∼3 foldincrease) compared to the β-TCP group at day 14.

3.3. Cementogenic/osteogenic gene expression and theWnt-related signalling pathway for hPDLCs and hBMSCs on5Li-β-TCP bioceramic disks

At day 7, RT-qPCR analysis showed that 5Li-β-TCP ceramicscould significantly enhance the osteogenic/cementogenic geneexpression for both hPDLCs and hBMSCs compared to β-TCPceramics (Fig. 5). The 5Li-β-TCP ceramic disks significantlystimulated bone-related gene expression of ALP and OCN(∼3 fold increase for hPDLCs, ∼5 fold enhancement forhBMSCs) and cementum-specific genes of CEMP1 and CAP(∼6 fold increase for hPDLCs, ∼3 fold enhancement forhBMSCs) compared to those of other groups for both hPDLCsand hBMSCs at day 7 (Fig. 5a–h).

The analysis of the expression of Wnt canonical-relatedgenes such as WNT3A and AXIN2 was performed by RT-PCRafter culturing both hPDLCs and hBMSCs on two ceramicdisks for 3 and 7 days. The results showed that the expression

Fig. 2 The SEM analysis for the cell morphology of (a) hPDLCs on 5Li-β-TCP, (b) hBMSCs on 5Li-β-TCP, (c) hPDLCs on β-TCP and (d) hBMSCs onβ-TCP bioceramic disks after culturing for 7 days. The arrows indicate the represented cells.

Paper Biomaterials Science

1234 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

Fig. 3 The confocal fluorescence images for hPDLCs (a, e) and hBMSCs (b, f ) on β-TCP bioceramics and hPDLCs (c, g) and hBMSCs (d, h) on5Li-β-TCP bioceramics after culturing for 1, 7 days, respectively.

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1235

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

of WNT3A and AXIN2 genes in both hPDLCs (∼6 fold increase)and hBMSCs (∼4 fold increase) on 5Li-β-TCP bioceramic diskswas significantly higher than that on β-TCP ceramic disks atday 7 (Fig. 6a–d).

3.4. Ionic concentration and pH analysis for the cell culturemedium after culturing on 5Li-β-TCP bioceramic disks

It was noted that there were no Li ions in DMEM and TCP cer-amics only (0 mg mL−1); however, there were some Li ionsreleased from 5Li-β-TCP bioceramic disks when cultured withhPDLCs (0.34 mg mL−1 at day 3, 0.44 mg mL−1 at day 7) andhBMSCs (1.23 mg mL−1 at day 3, 0.89 mg mL−1 at day 7). Asexpected, the released Li ions from 5Li-β-TCP bioceramicdisks are significantly higher than those from β-TCP culturedwith hPDLCs (5Li-β-TCP vs. β-TCP groups, p < 0.0001, Table 2)and hBMSCs (5Li-β-TCP vs. β-TCP groups, p < 0.00001,Table 3) at days 3 and 7. Interestingly, the released Li ionsfrom hBMSCs cultured on 5Li-β-TCP disks were about 2 foldhigher than those from hPDLCs cultured on 5Li-β-TCP disks(5Li-β-TCP groups from hBMSCs vs. hPDLCs, p < 0.0001).There was no significant difference for P ions between5Li-β-TCP and β-TCP groups cultured with two cells; however,the concentration of Ca ions for 5Li-β-TCP was slightly lower(5Li-β-TCP groups from hPDLCs vs. hBMSCs, ∼1.3 fold lower,p < 0.0001) than those for β-TCP groups cultured with two cells(Tables 2 and 3). The data as shown in Table 4 demonstratedthat the pH value of cell culture medium with hBMSCs wasslightly lower (around 0.1 lower) than that of hPDLCs.

3.5. The effects of ionic extracts from 5Li-β-TCP powders onthe proliferation and bone/cementum-related gene expressionof hPDLCs and hBMSCs

The ionic concentrations of Li, Ca and P in the extractsfrom β-TCP and 5Li-β-TCP powders are shown in Table 5.At the concentration of 200 mg mL−1, it was obvious thatthe Li concentrations reached 7.42 mg L−1; however, therewere no Li ions in β-TCP extracts (Table 5). The concentrationsof Ca and P ions in β-TCP and 5Li-β-TCP groups werecomparable.

As determined by the MTT assay, the cell proliferation rateof both hBMSCs and hPDLCs cultured in the presence of 5Li-β-TCP extracts (∼1.2 fold increase) in a wide range of concen-trations (200, 100, 50 and 6.25 mg mL−1) was significantlyhigher than that cultured with the β-TCP group at day 7(Fig. 7a and b).

Results of bone/cementum-related gene expression analysisof ALP, OCN and CEMP1 showed that the 5Li-β-TCP extracts atall the concentrations enhanced hPDLC osteogenic andcementogenic differentiation compared to the β-TCP extractgroup at day 7 (>1 fold) (Fig. 8a, c and e). At day 7, theexpression of ALP for hBMSCs at 6.25 mg mL−1 of 5Li-β-TCPwas about 2 fold higher than that at 6.25 mg mL−1 of β-TCP(Fig. 8b). The expression of OCN and CEMP1 in both hPDLCsand hBMSCs was enhanced by 5Li-β-TCP extracts at all the con-centrations compared with that in the β-TCP extract group(>1.5 fold) (Fig. 8c–f ).

Fig. 4 The cell proliferation and relative ALP activity for hPDLCs (a, c) and hBMSCs (b, d) on β-TCP and 5Li-β-TCP bioceramics. *Significant differ-ence (p < 0.05) for the 5Li-β-TCP group compared to the β-TCP group with respect to the cell proliferation rate. **Significant difference (p < 0.05)for the 5Li-β-TCP group compared to the β-TCP group regarding relative ALP activity.

Paper Biomaterials Science

1236 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

4. Discussion

Our present study conducted a systematic investigation of thecell attachment, proliferation, bone/cementum and Wnt cano-nical related gene expression for both hPDLCs and hBMSCs

cultured on 5Li-β-TCP ceramic disks and with 5Li-β-TCPpowder extracts. To the best of our knowledge, this is the firststudy on preparation of Li-containing β-TCP bioceramics. Wehave successfully incorporated Li into β-TCP by a conventionalchemical precipitation method. The results showed that incor-

Fig. 5 The bone-related gene expression of ALP, OCN and cementum-specific markers of CAP and CEMP1 for hPDLCs (a, c, e, g) and hBMSCs(b, d, f, h) on β-TCP and 5Li-β-TCP bioceramics. *Significant difference (p < 0.05) for the 5Li-β-TCP group compared to other two groups at day3. **Significant difference (p < 0.05) for the 5Li-β-TCP group compared to two other groups at day 7.

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1237

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

porating parts of Li into β-TCP bioceramics did not change thecrystal phase structures. ICP analysis of both Li-β-TCP ceramicdisks and powder extracts further confirmed that Li ions hadbeen incorporated into β-TCP.

In this study, the cells cultured on β-TCP bioceramic diskswere used as controls. Our SEM and CLSM analysis resultsshowed that both hPDLCs and hBMSCs are well attached onthe surface of 5Li-β-TCP and β-TCP bioceramics. ALP is knownas an early marker for osteoblastic differentiation; OCN isanother important gene related to the bone mineraliz-ation.44,45 CEMP1 and CAP are the cementum-specific markerswhich have been identified to have limited and specificexpression in cementum or cementum-like tissues.46–48 Ourresults showed that 5Li-β-TCP had enhanced osteogenic andcementogenic differentiation of both cell lines over time.These data indicate that 5Li-β-TCP ceramic disks show excel-

Fig. 6 The WNT canonical-related gene expression of WNT3A and AXIN2 for hPDLCs (a, c) and hBMSCs (b, d) on β-TCP and 5Li-β-TCP bioceramics.*Significant difference (p < 0.05) for 5Li-β-TCP group compared to other two groups at day 3. **Significant difference (p < 0.05) for the 5Li-β-TCPgroup compared to two other groups at day 7.

Table 2 Ion release of 5Li-TCP ceramic disks in DMEM cultured withhPDLCs

Culture time Materials Li(mg L−1) P(mg L−1) Ca(mg L−1)

3 d DMEM 0 323.9 ± 5.15 78.03 ± 0.50β-TCP 0 304.1 ± 1.37 65.37 ± 0.245Li-β-TCP 0.34 ± 0.01 301.2 ± 1.17 62.58 ± 0.18

7 d DMEM 0 295.4 ± 0.75 75.38 ± 0.26β-TCP 0 280.4 ± 2.05 65.12 ± 0.415Li-β-TCP 0.44 ± 0.02 272 ± 1.22 63.14 ± 0.29

Table 3 Ion release of 5Li-TCP ceramic disks in DMEM cultured withhBMSCs

Culture time Materials Li(mg L−1) P(mg L−1) Ca(mg L−1)

3 d DMEM 0 317 ± 3.2 74.94 ± 0.83β-TCP 0 285.6 ± 1.99 62.55 ± 0.035Li-β-TCP 1.23 ± 0.01 281.7 ± 5.77 54.89 ± 0.24

7 d DMEM 0 290.2 ± 1.58 67.26 ± 0.81β-TCP 0 269.5 ± 0.70 62.59 ± 0.205Li-β-TCP 0.89 ± 0.04 269.3 ± 0.61 57.8 ± 0.44

Table 4 The pH values of medium for hPDLCs and hBMSCs culturedon β-TCP and 5Li-β-TCP ceramic disks

hPDLCs hBMSCs

β-TCP 8.02 ± 0.36 7.92 ± 0.355Li-β-TCP 7.92 ± 0.56 7.86 ± 0.32Blank 7.93 ± 0.45 7.82 ± 0.45

Table 5 The ionic concentrations of the extracts from β-TCP and 5Li-β-TCP powders

Extractconcentrations(mg mL−1) Materials Li(mg L−1) P(mg L−1) Ca(mg L−1)

200 mg mL−1 β-TCP 0 205.1 ± 3.15 55.53 ± 1.055Li-β-TCP 7.42 ± 0.05 202.2 ± 1.01 54.45 ± 1.75

50 mg mL−1 β-TCP 0 291.3 ± 3.12 71.3 ± 2.025Li-β-TCP 1.86 ± 0.02 290.5 ± 4.23 71.0 ± 1.65

6.25 mg mL−1 β-TCP 0 316.3 ± 5.32 75.9 ± 1.365Li-β-TCP 0.23 ± 0.01 316.4 ± 4.21 75.8 ± 0.96

Paper Biomaterials Science

1238 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

Fig. 7 The proliferation for hPDLCs (a) and hBMSCs (b) after culturing with different concentrations of β-TCP and 5Li-β-TCP powder extracts for 1and 7 days. *Significant difference (p < 0.05) for the 5Li-β-TCP group compared to the β-TCP group at day 7.

Fig. 8 The relative bone-related gene expression of ALP, OCN and cementum-specific markers of CEMP1 for hPDLCs (a, c, e) and hBMSCs (b, d, f )after culturing with different concentrations of β-TCP and 5Li-β-TCP extracts for 7 days. *Significant difference (p < 0.05) for the 5Li-β-TCP groupcompared to the β-TCP group.

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1239

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

lent in vitro osteogenic and cementogenic stimulation for bothhPDLCs and hBMSCs. Interestingly, in our study, hPDLCsshowed a slightly enhanced proliferation rate than hBMSCswhich may be due to the age difference between the donorswho donated the periodontal ligament and bone marrowstromal cells (i.e. 18–25 vs. 65 years).

Previous reports have shown that many bioactive ions con-taining β-TCP ceramics could enhance the in vitro bioactivity.Among them, strontium (Sr) is an element proposed topromote bone growth. Sr might have a positive effect on boneformation by inhibiting bone resorption and enhancing endo-steal and trabecular bone formation.49,50 There are increasingstudies on the stimulatory effect of Sr2+ ions from Sr-TCP onthe osteogenic differentiation of osteoblast-like cells andregeneration of lost bone.51 Silicon/strontium (Si or Sr)-con-taining β-TCP ceramics have been proven to stimulate bonecell proliferation and osteogenic differentiation by releasing Si/Sr ion products.18,52 Similar results were also obtained for Znor Mg-TCP ceramics. Zn-doped TCP exhibited good bioactivity,which enhanced cell differentiation and ALP expression for theosteoblast MC3T3-E1 cell line.53,54 Further studies indicatedthat the presence of Mg-TCP ceramics stabilized the cell–material interface and thus improved cell attachment andgrowth of osteoblasts.54 It is obvious that most of these bio-active ions, such as Sr, Si, Zn and Mg, play an important rolein inducing the osteogenic differentiation of bone cells. In thisstudy, it was found that the released Li+ ions from β-TCPstimulate the osteogenic and cementogenic differentiation ofboth PDLCs and BMSCs. In addition, we found that Li+ ionsreleased from mesoporous bioactive glass scaffolds couldpromote the regeneration of bone and cartilage.55 All theseresults suggest that Li+ ions have a multidirectional effect onthe PDLCs, BMSCs and chondrocyte cells. Therefore, Li+ ionsmay have more universal advantages than other ions for indu-cing the differentiation of different kinds of stem cells.

Li is an element and it is reported that Li may enhance frac-ture healing in mice, while clinically it reduces the incidenceof fractures with increasing accumulated dose of Li. In thisstudy, Li+ ions released from 5Li-β-TCP bioceramics stimulatedan increased osteogenic and cementogenic differentiation ofboth hPDLCs and hBMSCs in a general trend. Notably, Li+

ions could stimulate the Wnt canonical signalling pathway,suggesting that 5Li-β-TCP biomaterial could be potentiallyapplied for periodontal regeneration due to its excellent osteo-genic/cementogenic differentiation via activation of the Wntcanonical signalling pathway.

It is known that the chemical composition and surface pro-perties of bioceramics are two important factors to influencethe cell response.56,57 Our results showed that the incorpor-ation of Li into β-TCP ceramic disks did not influence thesurface morphology.58–62 Previous studies showed that thecrystal size of bioceramics also significantly influenced the cellattachment and proliferation.63,64 Therefore, it is reasonable tospeculate that the decreased crystal size of Li-containing β-TCPceramics may be the other important factor to influence thecell differentiation. In this study, 5Li-β-TCP ceramics have

smaller particle size and grains which may influence the celldifferentiation, while the crystal size is still in the range for thecell growth and differentiation. To further investigate whetherthe composition of 5Li-β-TCP plays the key role in stimulatingosteogenic/cementogenic differentiation of hPDLCs andhBMSCs, the ionic extracts of 5Li-β-TCP powders were pre-pared, which mainly contain Li+, Ca2+ and PO4

3− ionic pro-ducts released from 5Li-β-TCP (Table 5). Similar results wereobtained; ionic products from 5Li-β-TCP also significantly pro-moted bone/cementum-related gene expression of bothhPDLCs and hBMSCs. Therefore, it is reasonable to speculatethat the Li-containing ionic products play a key role instimulating osteogenic/cementogenic differentiation of bothhPDLCs and hBMSCs. It is known that LiCl has an effect in adose-dependent manner on cell proliferation and differen-tiation. Recent findings showed that osteogenic differentiationof primary osteoblasts was enhanced by LiCl at the concen-tration of 1 mM;65 however, a higher concentration of 10 mMshowed an inhibitory effect on osteoblastic differentiation.66

In this study, the Li+ ion concentration was only 0.2 mMreleased from 5Li-β-TCP bioceramic disks; however, it showedhigher Li+ ion release at the concentration of 1.1 mM when5Li-β-TCP extracts were of the concentration of 200 mg L−1.Therefore, the concentration range for Li ions is around0.2–1.1 mM, which is comparable to that reported by Galliet al. We further analysed the ionic composition of cell culturemedium for β-TCP and 5Li-β-TCP ceramic disks. Interestingly,it is also found that the concentrations of Li+ ions in theculture medium containing 5Li-β-TCP ceramic disks withhPDLCs are obviously lower than those with hBMSCs as shownin Tables 2 and 3. The possible reason is that different celltypes may lead to different surface dissolution in the micro-environment of cell and material surfaces. Furthermore, twotypes of cells may also possess different uptaking abilities forLi+ ions. The pH value of cell culture medium with hBMSCswas slightly lower than that of hPDLCs. The lower pH valuemay be the main reason to improve the Li+ ion release frommaterials. However, further study is needed to confirm thedifference between hPDLCs and hBMSCs on these materialsurfaces.

The effect of 5Li-β-TCP bioceramics on the Wnt signallingpathway for both hPDLCs and hBMSCs was further investi-gated to explore the possible underlying mechanisms for 5Li-β-TCP bioceramics to stimulate osteogenic/cementogenicdifferentiation of hPDLCs and hBMSCs. The Wnt signallingpathway plays a major role in various processes during devel-opment including cell proliferation and differentiation.67

WNT3a is a secreted glycoprotein that interacts with cell mem-brane-associated proteins and plays an important role in intra-cellular canonical Wnt signal transduction through thephosphorylation and accumulation of β-catenin which isanother critical member of the Wnt/β-catenin signallingpathway.35,68 Axin2, also known as axin-like protein (Axil) oraxis inhibition protein 2 (Axin2), is recognised as the mostaccurate reporter gene in the Wnt canonical pathway since it isa direct target gene for Wnt ligand binding and activation of

Paper Biomaterials Science

1240 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

the Wnt signalling pathway.69 To date, there have been fewreports involving the interaction of the Wnt canonical signallingand hPDLC osteogenic differentiation. Our results showed that5Li-β-TCP bioceramics significantly enhanced the Wnt canoni-cal-related gene expression (WNT3A and AXIN2) in both hPDLCsand hBMSCs compared to β-TCP bioceramics, suggesting thatLi+ ions from 5Li-β-TCP ceramics may be involved in the acti-vation of the Wnt canonical signalling pathway for enhancingthe osteogenic/cementogenic differentiation.

Therefore, it is speculated that 5Li-β-TCP bioceramicspossess distinct osteogenic/cementogenic stimulation pro-perties for promoting the bone/cementum-related geneexpression. The schematic illustration of the possible mechan-ism is shown in Fig. 9, in which Wnt canonical signallingpathways in both hPDLCs and hBMSCs have been distinctivelyregulated by 5Li-β-TCP bioceramics. However, this conceptneeds to be further investigated for other Wnt pathway regula-tors and a future in vivo evaluation of the bone/cementumforming capacity is also needed to demonstrate that the5Li-β-TCP bioceramic scaffolds can initiate bone/cementumregeneration.

5. Conclusion

In summary, Li-containing β-TCP bioceramics were success-fully prepared. 5Li-β-TCP bioceramics supported cell attach-ment and proliferation. The release of Li from Li-β-TCPbioceramics significantly enhanced bone/cementum-relatedgene expression maybe via the regulation of Wnt canonical sig-nalling pathways in both hPDLCs and hBMSCs. Li-β-TCP bio-ceramics show promising application in bone/cementumtissue regeneration due to their distinctively osteogenic andcementogenic stimulation properties.

Acknowledgements

The authors thank the Pujiang Talent Program of Shanghai(12PJ1409500), the Recruitment Program of Global YoungTalent, China (Dr Wu), the Natural Science Foundation ofChina (Grant 81201202 and 81190132), ARC Discovery(DP120103697) and The State Key Lab of High PerformanceCeramics and Superfine microstructure, SICCAS(SKL201203SIC) for the support of research.

References

1 P. M. Bartold, Y. Xiao, S. P. Lyngstaadas, M. L. Paine andM. L. Snead, Periodontology 2000, 2006, 41, 123–135.

2 J. E. Ellingsen, P. Thomsen and S. P. Lyngstadaas, Perio-dontology 2000, 2006, 41, 136–156.

3 L. F. Wolff and B. Mullally, Int. Dent. J., 2000, 50, 235–244.4 P. Koria, Biodrugs, 2012, 26, 163–175.5 R. Vasita and D. S. Katti, Expert Rev. Med. Devices, 2006, 3,

29–47.6 L. L. Hench and J. M. Polak, Science, 2002, 295, 1014–1017.7 L. L. Hench and I. Thompson, J. R. Soc. Interface, 2010, 7

(Suppl 4), S379–S391.8 C. Wu, Y. Zhang, Y. Zhu, T. Friis and Y. Xiao, Biomaterials,

2010, 31, 3429–3438.9 C. Wu, Y. Zhou, W. Fan, P. Han, J. Chang, J. Yuen,

M. Zhang and Y. Xiao, Biomaterials, 2012, 33, 2076–2085.10 C. Wu, Y. Zhou, M. Xu, P. Han, L. Chen, J. Chang and

Y. Xiao, Biomaterials, 2013, 34, 422–433.11 C. Wu, Y. Zhang, Y. Zhou, W. Fan and Y. Xiao, Acta Bio-

mater., 2011, 7, 2229–2236.12 P. Asvanund and P. Chunhabundit, Implant Dent., 2012, 21,

248–253.13 U. W. Jung, J. S. Lee, W. Y. Park, J. K. Cha, J. W. Hwang,

J. C. Park, C. S. Kim, K. S. Cho, J. K. Chai and S. H. Choi,J. Periodontal Implant Sci., 2011, 41, 285–292.

14 L. Xia, Z. Zhang, L. Chen, W. Zhang, D. Zeng, X. Zhang,J. Chang and X. Jiang, Eur. Cell. Mater., 2011, 22, 68–82.

15 S. Ni, K. Lin, J. Chang and L. Chou, J. Biomed. Mater. Res.,Part A, 2008, 85, 72–82.

16 C. Wang, Y. Xue, K. Lin, J. Lu, J. Chang and J. Sun, ActaBiomater., 2012, 8, 350–360.

Fig. 9 Schematic illustration for the effect of 5Li-β-TCP bioactive cer-amics on osteogenic and cementogenic differentiation of both hPDLCsand hBMSCs.

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1241

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

17 C. T. Wu, W. Fan, Y. H. Zhou, Y. X. Luo, M. Gelinsky,J. Chang and Y. Xiao, J. Mater. Chem., 2012, 22, 12288–12295.

18 M. Roy and S. Bose, J. Biomed. Mater. Res., Part A, 2012,100, 2450–2461.

19 M. Sayer, A. D. Stratilatov, J. Reid, L. Calderin, M. J. Stott,X. Yin, M. MacKenzie, T. J. Smith, J. A. Hendry andS. D. Langstaff, Biomaterials, 2003, 24, 369–382.

20 H. W. Kim, Y. H. Koh, Y. M. Kong, J. G. Kang andH. E. Kim, J. Mater. Sci. Mater. Med., 2004, 15, 1129–1134.

21 A. J. Harwood, Mol. Psychiatry, 2005, 10, 117–126.22 O. F. O’Leary, R. M. O’Connor and J. F. Cryan, Neuro-

pharmacology, 2012, 62, 247–255.23 A. J. Polotsky, L. Y. Zhu, N. Santoro and J. W. Pollard, Hum.

Reprod., 2009, 24, 1960–1967.24 A. K. Silva, H. Yi, S. H. Hayes, G. M. Seigel and

A. S. Hackam, Mol. Vis, 2010, 16, 36–45.25 Y. Chen, H. C. Whetstone, A. C. Lin, P. Nadesan, Q. Wei,

R. Poon and B. A. Alman, PLoS Med., 2007, 4, e249.26 P. Vestergaard, L. Rejnmark and L. Mosekilde, Calcif.

Tissue Int., 2005, 77, 1–8.27 A. Zamani, G. R. Omrani and M. M. Nasab, Bone, 2009, 44,

331–334.28 Y. Chen and B. A. Alman, J. Cell. Biochem., 2009, 106, 353–

362.29 I. Wilting, F. de Vries, B. M. Thio, C. Cooper,

E. R. Heerdink, H. G. Leufkens, W. A. Nolen, A. C. Egbertsand T. P. van Staa, Bone, 2007, 40, 1252–1258.

30 O. Cohen, T. Rais, E. Lepkifker and I. Vered, Horm. Metab.Res., 1998, 30, 594–597.

31 M. Khorami, S. Hesaraki, A. Behnamghader, H. Nazarianand S. Shahrabi, Mater. Sci. Eng., C, 2011, 31, 1584–1592.

32 M. Tylkowski and D. S. Brauer, J. Non-Cryst. Solids, 2013,375, 175–181.

33 A. P. M. Shainberg, P. Valerio, A. Zonari, F. N. Oktar,L. S. Ozyegin, M. P. F. Graca, M. F. Leite and A. M. Goes,Adv. Mater. Sci. Eng., 2012, 650574, 1–10.

34 B. M. Seo, M. Miura, S. Gronthos, P. M. Bartold, S. Batouli,J. Brahim, M. Young, P. G. Robey, C. Y. Wang and S. Shi,Lancet, 2004, 364, 149–155.

35 A. Derfoul, A. L. Carlberg, R. S. Tuan and D. J. Hall, Differ-entiation, 2004, 72, 209–223.

36 R. O. Oreffo, C. Cooper, C. Mason and M. Clements, StemCell Rev., 2005, 1, 169–178.

37 T. Mygind, M. Stiehler, A. Baatrup, et al., Biomaterials,2007, 28, 1036–1047.

38 J. R. Mauneya, T. Nguyena, K. Gillena, C. Kirker-Headb,J. M. Gimblec and D. L. Kaplana, Biomaterials, 2007, 28,5280–5290.

39 X. Liu, R. K. Fu, R. W. Poon, P. Chen, P. K. Chu andC. Ding, Biomaterials, 2004, 25, 5575–5581.

40 S. C. Kenneth and M. Hargreaves, Pathways of the pulp,2011, p. 553.

41 P. Han, C. Wu, J. Chang and Y. Xiao, Biomaterials, 2012, 33,6370–6379.

42 C. Wu, W. Fan, J. Chang and Y. Xiao, J. Mater. Chem., 2011,21, 18300–18307.

43 ISO/EN 10993-5. Biological evaluation of medical devices-part5 tests for cytotoxicity, in vitro methods 8.2 tests on extracts.,ISO/EN 10993–10995. Biological evaluation of medicaldevices-part 10995 tests for cytotoxicity, in vitro methods10998.10992 tests on extracts.

44 A. I. Alford and K. D. Hankenson, Bone, 2006, 38,749–757.

45 K. K. Ivaska, T. A. Hentunen, J. Vaaraniemi, H. Ylipahkala,K. Pettersson and H. K. Vaananen, J. Biol. Chem., 2004, 279,18361–18369.

46 M. A. Alvarez-Perez, S. Narayanan, M. Zeichner-David,B. Rodriguez Carmona and H. Arzate, Bone, 2006, 38, 409–419.

47 H. Arzate, S. W. Olson, R. C. Page, A. M. Gown andA. S. Narayanan, FASEB J., 1992, 6, 2990–2995.

48 D. Wu, K. Ikezawa, T. Parker, M. Saito and A. S. Narayanan,J. Bone Miner. Res., 1996, 11, 686–692.

49 S. G. Dahl, P. Allain, P. J. Marie, Y. Mauras, G. Boivin,P. Ammann, Y. Tsouderos, P. D. Delmas andC. Christiansen, Bone, 2001, 28, 446–453.

50 M. D. Grynpas, E. Hamilton, R. Cheung, Y. Tsouderos,P. Deloffre, M. Hott and P. J. Marie, Bone, 1996, 18, 253–259.

51 M. Tian, F. Chen, W. Song, Y. C. Song, Y. W. Chen,C. X. Wan, X. X. Yu and X. H. Zhang, J. Mater. Sci. Mater.Med., 2009, 20, 1505–1512.

52 G. Mestres, C. Le Van and M. P. Ginebra, Acta Biomater.,2012, 8, 1169–1179.

53 A. Ito, K. Ojima, H. Naito, N. Ichinose and T. Tateishi,J. Biomed. Mater. Res., 2000, 50, 178–183.

54 W. C. Xue, K. Dahlquist, A. Banerjee, A. Bandyopadhyayand S. Bose, J. Mater. Sci. Mater. Med., 2008, 19, 2669–2677.

55 Y. Wu, S. Zhu, C. Wu, P. Lu, C. Hu, S. Xiong, J. Chang,B. C. Heng, Y. Xiao and H. W. Ouyang, Adv. Funct. Mater.,2014, DOI: 10.1002/adfm.201304304.

56 P. Han, C. Wu and Y. Xiao, Biomater. Sci., 2013, 1, 379–392.57 M. Xu, Y. Zhang, D. Zhai, J. Chang and C. Wu, Biomater.

Sci., 2013, 1, 933–941.58 P. Han, C. Wu, J. Chang and Y. Xiao, Biomaterials, 2012, 33,

6370–6379.59 C. Wu, Y. Zhou, C. Lin, J. Chang and Y. Xiao, Acta Bioma-

ter., 2012, 8, 3805–3815.60 E. S. Thian, Z. Ahmad, J. Huang, M. J. Edirisinghe,

S. N. Jayasinghe, D. C. Ireland, R. A. Brooks, N. Rushton,W. Bonfield and S. M. Best, Acta Biomater., 2010, 6,750–755.

61 C. Wu, Y. Ramaswamy, D. Gale, W. Yang, K. Xiao, L. Zhang,Y. Yin and H. Zreiqat, Acta Biomater., 2008, 4, 569–576.

62 A. Hoppe, N. S. Guldal and A. R. Boccaccini, Biomaterials,2011, 32, 2757–2774.

63 A. Lopez-oriega, D. Arcos, I. Izquierdo-Barb, Y. Sakamoto,O. Terasaki and M. Vallet-Regi, Chem. Mater., 2006, 18,3137–3144.

Paper Biomaterials Science

1242 | Biomater. Sci., 2014, 2, 1230–1243 This journal is © The Royal Society of Chemistry 2014

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online

64 A. J. Dulgar-Tulloch, R. Bizios and R. W. Siegel, J. Biomed.Mater. Res., Part A, 2009, 90, 586–594.

65 C. Galli, M. Piemontese, S. Lumetti, E. Manfredi,G. M. Macaluso and G. Passeri, Clin. Oral Implants Res.,2013, 24, 921–927.

66 J. Li, Z. Khavandgar, S. H. Lin and M. Murshed, Bone, 2011,48, 321–331.

67 C. Y. Logan and R. Nusse, Annu. Rev. Cell Dev. Biol., 2004,20, 781–810.

68 L. Schweizer and H. Varmus, BMC Cell Biol, 2003,4, 4.

69 H. M. Yu, B. Jerchow, T. J. Sheu, B. Liu, F. Costantini,J. E. Puzas, W. Birchmeier and W. Hsu, Development, 2005,132, 1995–2005.

Biomaterials Science Paper

This journal is © The Royal Society of Chemistry 2014 Biomater. Sci., 2014, 2, 1230–1243 | 1243

Publ

ishe

d on

05

June

201

4. D

ownl

oade

d on

16/

10/2

014

04:0

6:50

. View Article Online