Pergamon J. Steroid Biochem. Molec. Biol. Vol. 60, No. 1-2, pp. 43-50, 1997

Copyright ~ 1997 Elsevier Science Ltd. All rights reserved Printed in Great Britain

P I I : S 0 9 6 0 - 0 7 6 0 ( 9 6 ) 0 0 1 6 7 - 7 0960-0760/97 $17.o0 + 0.0o

Inhibition of Mineralocorticoid Activity by the fl-isoform of the Human Glucocorticoid

Receptor C h r i s t o p h M. B a m b e r g e r , 1'2. A n a - M a r i a B a m b e r g e r , 1 M a r t i n W a l d , 1

G e o r g e P . C h r o u s o s " a n d H e i n r i c h M . S c h u l t e 1

'IHF Institute for Hormone and Fertility Research, University of Hamburg, 22529 Hamburg, Germany; 2Department of Medicine, University of Hamburg, 20246 Hamburg, Germany and 3National Institutes of Health, National Institute

of Child Health and Human Development Developmental Endocrinology Branch, Building 10, Room 10N262, Bethesda, MD 20892, U.S.A.

M i n e r a l o c o r t i c o i d s a n d g lucoco r t i co id s a re i m p o r t a n t r e g u l a t o r s o f e l ec t ro ly te h o m e o s t a s i s a n d a r t e r i a l b lood p r e s s u r e . T h e i r ef fects a r e m e d i a t e d b y the m i n e r a l o c o r t i c o i d (MR) a n d the g lu coco r - t i co id r e c e p t o r (GR) , r e spec t ive ly . T h e p r e s e n t s t u d y was des igned to d e t e r m i n e h o w the two iso- f o r m s o f the h u m a n GR, the " c l a s s i c " GR~ a n d the n o n - h o r m o n e - b i n d i n g GRfl, i n t e r f e r e wi th the t r a n s c r i p t i o n a l e f fec ts o f the h o r m o n e - a c t i v a t e d h u m a n MR. C O S - 7 m o n k e y k i d n e y cells w e re t r a n s - f ec t ed wi th different: m i n e r a l o c o r t i c o i d - r e s p o n s i v e r e p o r t e r p l a s m i d s a n d a v e c t o r e x p r e s s i n g the h u m a n M R p r o t e i n . D i f f e r e n t a m o u n t s o f e i t h e r con t ro l , GRa, o r GRfl p l a s m i d w e re c o - t r a n s f e c t e d , a n d l uc i f e r a se ac t iv i ty was m e a s u r e d a f t e r s t i m u l a t i o n wi th a l d o s t e r o n e a n d / o r d e x a m e t h a s o n e . M R - m e d i a t e d s t i m u l a t i o n o f t r a n s c r i p t i o n was e n h a n c e d b y c o - t r a n s f e c t i o n o f the GR~ e x p r e s s i o n vec- to r . In c o n t r a s t , M R - m e d i a t e d s t i m u l a t i o n o f t r a n s c r i p t i o n was s t rong ly i n h i b i t e d b y c o - t r a n s f e c t i o n o f e qua l a m o u n t s o f the GRfl e x p r e s s i o n vec to r . Rev e r se t r a n s c r i p t i o n - p o l y m e r a s e c h a i n r e a c t i o n ( R T - P C R ) s h o w e d e x p r e s s i o n o f b o t h G R i s o f o r m s as well as o f M R in the h u m a n k idney . T h e s e d a t a i nd i ca t e t h a t the two i s o f o r m s o f the h u m a n G R ex e r t oppos i t e effects on m i n e r a l o c o r t i c o i d ac- t ivi ty . We c o n c l u d e t ha t the r a t io b e t w e e n GR~ a n d GRfl c an def ine the sens i t iv i ty o f m i n e r a l o c o r t i - co ld t a r g e t t i s sues to a l d o s t e r o n e . I m b a l a n c e s o f this r a t i o m a y p a r t i c i p a t e in c l in ical s y n d r o m e s o f i m p a i r e d o r a u g m e n t e d m i n e r a l o c o r t i c o i d sens i t iv i ty , such as c e r t a i n cases o f p s e u d o h y p o a l d o s t e r - o n i s m or , poss ib ly , p r i m a r y a r t e r i a l h y p e r t e n s i o n . © 1997 E l sev i e r Sc i ence Ltd .

J. Steroid Biochem. Molec. Biol., Vol. 60, No. 1-2, pp. 43-50, 1997

INTRODUCTION

The renin-angiotensin-aldosterone system is a critical

part of the complex regulatory network maintaining an adequate arterial blood pressure. Aldosterone, the

major mineralocorticoid in humans, stimulates the readsorption of sodium in the distal convoluted tubule

of the kidney. Water passively follows the transported sodium, causing an increase in extracellular fluid volume and, thus, blood pressure [1]. In addition to

Presented in part at the ]:2th International Symposium of the Journal of Steroid Biochemistry and Molecular Biology, Berlin, Germany, 1995.

*Correspondence to Christoph M. Bamberger. Tel: +49 40 561 908 88; Fax: +49 40 561 908 64.

Received 21 Mar. 1996; accepted 31 Jul. 1996.

its peripheral effects, aldosterone also elevates blood pressure by acting on mineralocorticoid receptors in the central nervous system [2]. The production and release of aldosterone by the zona glomerulosa of the adrenal cortex is under the regulatory control of angiotensin II, potassium, atrial natriuretic factor, and A C T H [1, 3]. Imbalances within this regulatory sys- tem as well as primary dysfunction of the aldosterone- producing cells lead to clinically apparent symptoms of hypo- or hyperaldosteronism, which include arterial hypo- or hypertension, respectively [ 1 ]. Interindividual differences in the response to a given level of aldosterone, i.e. in mineralocorticoid sensi- tivity, are less well analysed, even though they may be pathophysiogically relevant. To analyse the possible pathophysiological implications of impaired mineralo-

43

44 C.M. Bamberger et al.

• • • aldo

\ /

' r

t HRE H diminished transcriptional activity

• a ldo

• •

M R M R

~r

HRE I t r a n s c r i p t i o n

• a ldo

• •

MR (~R,J

~r

HRE y enhanced

transcriptional activity

Fig. 1. Mechanism of MR-medlated transactivation and hypothetical model of MR/GR interaction in tissues that are selectively mineralocorticoid-responsive (e.g. the collecting ducts in the kidney). (Middle panel) In the unliganded state, MR is bound to a complex of different heat shock proteins (HSPs) , which keeps the receptor inactive in the absence of ligand. Binding of aldosterone (aldo) causes MR to dissociate from this complex, to bind as a homodimer to specific hormone response elements (HREs) in the promoter region of target genes, and thus to activate transcription of these genes. In the presence of GR~ (right panel) or GRfl

(left panel) , MR-mediated transactivation is enhanced or diminished, respectively.

corticoid sensitivity, it is thus essential to define how aldosterone acts at the cellular and molecular levels.

The effects of aldosterone are mediated by a cyto- solic protein, termed mineralocorticoid receptor (MR; Fig. 1) [4]. M R belongs to the phylogenetically con- served family of nuclear hormone receptors, which also comprises the receptors for glucocorticoids, estro- gens, progestins, androgens, thyroid hormone, vitamin D, retinoic acid, and a growing number of so-called orphan receptors [5-7]. In the unliganded state, M R is bound to a heterocomplex of heat shock proteins (HSPs), which prevents the receptor from binding to the D N A in the absence of hormone [8, 9]. Aldosterone passively diffuses through the cell m e m - brane, binds to MR, and causes the M R / H S P com- plex to dissociate. The activated M R then translocates into the cell nucleus [10, 11], where it binds as a homodimer to hormone response elements (HREs) in the promoter region of mineralocorticoid-responsive genes [12-14]. These elements are identical to those occupied by the glucocorticoid receptor (GR) [14]. The D N A - b o u n d receptor dimer modulates the ac- tivity of the basal transcription machinery, probably via "bridging factors", such as the recently described steroid receptor coactivator-1 (SRC- 1) [15].

In addition to forming homodimers , the activated M R has also been shown to heterodimerize with G R

in gel shift experiments [16, 17]. However, the func- tional consequences of M R / G R heterodimerization are not well understood. As opposed to MR, G R exists in two distinct isoforms, termed GR~ and GRfl, which are generated by alternative splicing of the G R p r e - m R N A [18, 19]. We have previously shown that the effects of the hormone-act ivated GRa on gene transcription are antagonized by the non-hormone- binding GRfi [20]. The present study was designed to evaluate whether the transcriptional activity of the aldosterone-activated MR, and thus mineralocorticoid sensitivity, are influenced by co-expression of either GRct or GRfl.

M A T E R I A L S A N D M E T H O D S

P l a s m i d s

pRShMR, pRShGR~, and pRShGRfl express the human MR, GRg, and GRfl under the control of the constitutively active Rous sarcoma virus (RSV) pro- moter. The plasmid pRSv-erbA -1 contains a thyroid receptor c D N A in inverse orientation and was used as negative control. These plasmids were kindly donated by Dr R. Evans (Salk Institute, La Jolla, CA). The mineralocorticoid-inducible reporter plasmids M M T V - I u c (mouse m a m m a r y tumor virus-lucifer- ase) and HRE2-tk81-1uc were kind gifts of Dr B.

1 6 0 , 0 0 0 --

1 4 0 , 0 0 0

1 2 0 , 0 0 0

1 0 0 , 0 0 0

8 0 , 0 0 0

6 0 , 0 0 0

4 0 , 0 0 0

2 0 0 , 0 0 0

a l d o

d e x

M R / G R a

- - + - - __ _ + -- + +

_ _ + + -- + + + +

0 . 2 Ixg/O ~ g 0 . 2 Ixg /0 .2 txg 0 . 2 Ixg /2 .0 Ixg

MR/GR Interactions 45

Fig. 2. Synerg i sm between MR and GR~ transcriptional activity. COS-7 cells were transfected with the MMTV-Iuc reporter p lasmid and a MR express ion vector (0.2 pg/well). GR~ or GR/~ were co-expressed , and cells were treated with aldosterone and/or dexamethasone as indicated. Stars indicate significant changes c o m -

pared to the respect ive co lumns in cells transfected with MR only (P < 0.001).

Gellersen (Institute for Hormone and Fertility Research, Hamburg, Germany). tk81-1uc contains the luciferase reporter gene under the control of a trun- cated, mineralocorticoid-independent herpes simplex virus thymidine kinase promotor. We are grateful to Dr S. Nordeen (University of Colorado, Denver, CO) for this plasmid.

Cell culture and transfection

COS-7 monkey kidney tumor cells were obtained from A T C C (Rockville, MD). Cells were grown in Dulbecco's modified Eagle's medium (Gibco BRL, Eggenstein, Germany) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and streptomycin, and L-glutamine. Cells were incubated at 37°C in an atmosphere of 5% COz. Twenty-four hours before transfection, cells were removed from their culture flasks by trypsinization, resuspended in supplemented medium, and plated ill 12-well plates (1.5 × 105 cells/ well).

Cells were transfected by the lipofection method as previously described [:21]. An aliquot of 21.6/A trans- fectant (DOTAP, Boehringer Mannheim, Mannheim, Germany) was used per well (6pl//~g transfected DNA). Cells were co-transfected with pRShMR (0.2 #g/plate) and 1 pg/well reporter plasmid

(MMTV- luc or HRE2-tk81-1uc). Different amounts of pRShGR~ or pRShGRfi (0, 0.2, 2 pg/well) were added to the transfection mixture. Each transfection mixture also contained 0.2 #g/well of a fi-galactosidase expression vector (Promega, Madison, WI) to control for transfection efficiency. Appropriate amounts of pRSv-erbA -~ were added to yield a constant amount of 3.6/~g DNA/well. Twenty-four hours after transfec- tion, the medium was replaced with either normal charcoal-stripped medium or charcoal-stripped med- ium containing 10 -7M aldosterone and/or dexa- methasone.

Luciferase and [~-galactosidase assays

Luciferase activity in cell lysates was determined following standard protocols [22]. Thirty-six hours after transfection, cells were washed with phosphate buffered saline, trypsinized, washed, pelleted, and lysed with reporter lysis buffer (Promega). After one freeze-thaw cycle, luciferase activity in the lysate was determined in a luminometer (Lumat LB 9501, Berthold, Wildbad, Germany). /%galactosidase activity was determined in the same samples with a fi-galacto- sidase enzyme assay system (Promega), following the instructions of the manufacturer. Luciferase activity was divided by galactosidase activity to normalize for

46 C.M. Bamberger et aL

3 0 0 , 0 0 0 F 3 5 0 , 0 0 0

,--a

2 5 0 , 0 0 0

2 0 0 , 0 0 0

1 5 0 , 0 0 0

1 0 0 , 0 0 0

5 0 , 0 0 0

a l d o + - + + - + - +

dex - + + + + +

M R / G R [ 3 0 . 2 p .g /0 p~g 0 . 2 i xg / 2 .0 Ixg

Fig. 3. Inhibition of MR-mediated transactivation by co-transfection of Gaff. Stars indicate significant changes compared to the respective columns in cells transfected with M R o n l y ( P < 0 . 0 0 1 ) .

transfection efficiency. All experiments were repeated at least three times in triplicates. Statistical analysis (Mann-Whitney test) was carried out using Macintosh StatView software.

Reverse transcription-polymerase chain reaction (RT- PCR) and Southern hybridization

Human kidney and liver cDNAs (Clontech, Palo Alto, CA) were analysed by PCR using the following pairs of primers: 5' ACCAAT CAGATACCAAAATA 3' (GR~ sense primer, 5' position at 2404 bp of GR~ cDNA; [18]) and 5' ATACACCAACAGAAAGT CTA 3' (GR~ antisense primer, 5' position at 2867 bp of GR~ cDNA; [ 18]); 5' AAAGCA CATCTCACACATI 'A 3' (GR/~ sense primer, 5' pos- ition at 2336bp of GRfl cDNA; [18]) and 5' AAAACACATTCACCTACAGC 3' (GR/~ antisense primer, 5' position at 3132 bp of GRfl cDNA; [18]); 5' CAGAACCAA CAAGGAAGCAT 3' (MR sense primer, 5' position at 580 bp of MR cDNA; [4]) and 5' T G A C T T G G A G G G C T G G A A A T 3' (MR anti- sense primer, 5' position at 1049 bp of MR cDNA; [4]). Thirty cycles of PCR were carried out in a Perkin Elmer-Cetus thermal cycler. Each cycle con- sisted of incubations at 95°C for denaturation (1 min), 54°C for annealing (1.5 rain), and 72°C for primer extension (2 rain). The initial denaturation period was 5min, the final extension time was

10 min. PCR products were electrophoresed in a 1% agarose gel and visualized by ethidium bromide stain- ing. PCR products were further analysed by restric- tion enzyme digestion and non-radioactive Southern hybridization using PCR-generated, digoxigenin- labelled cDNA probes as described in the instructions provided by the manufacturer (PCR DIG Probe Synthesis Kit and DIG Luminescence Detection Kit; Boehringer Mannheim). The plasmids OB7 and OB10 [18], kind gifts of Dr R. Evans (Salk Institute), served as templates for the generation of GRc~- and GR/%specific probes, respectively. The MR-specific probe was amplified from the vector pRShMR.

R E S U L T S

Transfections

The results of the reporter gene experiments are shown in Figs 2 and 3. In COS-7 cells transfected with MMTV-luc and the human MR expression vector, luciferase activity was significantly stimulated by aldosterone (9.8 + 1.49-fold), dexamethasone (5.6 + 0.51-fold; mean + SD), and the combination of both (14.3 + 2.26-fold). Co-expression of GR~ pro- foundly enhanced the effects of both hormones on luciferase activity (24.9 _ 4.55, 46.4_+ 8.1, and 53__ 7.76-fold stimulation, respectively), indepen- dently of its expression level (MR/GRa ratio 1:1 or

MR/GR Interactions 47

35,000

30,000

25,000

20,000

15,000

1 0 , 0 0 0

5000

aldo

MR/GRI3

reporter

F

- - + I - - + I + [ - - + I - - + I - - +

0.2 tLg/0 tzg [ 0.2 bg/0.2 I~g ] 0.2 p~g/2.0 I~g [ 0.2 txg/0 I~g [ 0.2 ~g/0.2 I~g I 0.2 Ixg/2.0 txg

GRE2-tk81 -luc tk81 -luc

Fig . 4. GRfl inhibits the effects of the a ldosterone-act ivated MR on a s i m p l e HREz- tk81 -1uc reporter gene. The t k S l - l u c p l a s m i d , which contains no HREs , is nei ther activated by MR nor inhibited by GRfl. Stars indicate

s ignif icant changes compared to the respect ive co lumns in ceUs transfected w i t h M R on ly (P < 0.001).

1:10) (Fig. 2). This was not due to an increased total level of receptors, because overexpression of MR alone (>0.1 #g/well) did not result in enhanced luci- ferase activity (data not shown).

In contrast, co-expression of GRfl strongly inhibited the activity of the hormone-activated MR (Fig. 3). When expressed at equal concentrations, GRfl caused a 6 2 . 4 _ 12.2% inhibition of aldosterone-, a 61.3_+9.6% inhibition of dexamethasone-, and a 5 8 . 8 + 12.5% inhibition of aldosterone/dexametha- sone-stimulated reporter gene activity. When GRfl was 10-fold overexpre,~sed, MR activity was no longer inducible by aldosterone and/or dexamethasone. Similar effects were observed with a simple HREe- tk81-1uc reporter construct (Fig. 4; 49.3 + 15.3% in- hibition of aldosterone-stimulated luciferase activity at a 1:1 ratio of MR and GRfl, complete inhibition at 1:10). However, the mineralocorticoid-independent tk81-1uc reporter gene was neither activated by MR nor inhibited by GRfl.~ indicating the specificity of the above effects (Fig. 4).

R T - P C R

To study the expression of GR~, GRfl, and MR mRNAs in human kidney and liver (positive control for GR expression), we performed R T - P C R on these tissues. As would be expected, we demonstrated the expression of GRit and M R mRNA in both tissues. A GRfl-specific product of the predicted size (797 bp) was also amplified in both tissues (Fig. 5A). The

specific sequence of the amplification products was confirmed by restriction enzyme digestion (not shown) and Southern hybridization (Fig. 5B).

D I S C U S S I O N

In this study, we describe for the first time that the two isoforms of the human G R exert opposite effects on mineralocorticoid receptor-mediated transcrip- tional activity. Whereas GR~ synergizes with MR on a steroid-responsive MMTV-dr iven reporter gene, hGRfl strongly inhibits the effects of the hormone- activated MR. The mRNAs for MR, GR~ and GRfl are expressed in the normal human kidney, as shown by R T - P C R .

Synergism between the human MR and the human GR~ was previously demonstrated by Trapp et al.

[16], whereas Liu et al. [17] observed no synergistic effects between the rat MR and the rat GR. This may indicate species-specific differences and/or may be due to the different reporter gene construct employed by the latter group. We have demonstrated in a pre- vious study that GRfl could act as an inhibitor of GR~ on glucocorticoid-responsive genes [20]. However, to exert this effect, GRfl had to be overex- pressed at least five-fold, and suppression of GR~ ac- tivity was not complete at a G R ~ / G R f l ratio of 1:15. In contrast, GRfl inhibited the effects of MR at equal concentrations in this study, and completely abolished mineralocorticoid activity when 10-fold overexpressed.

48 C.M. Bamberger et al.

(a) GRa GRI3 MR

M 1 2 3 1 2 3 1 2 3

( b )

G R a

J I

G R B

M R

Fig. 5. (A) R T - P C R of cDNAs from human kidney and liver. The m R N A s for GR~, GRfl, and M R are expressed in both t issues. M, D N A size marker (,~/I-IindIII + ~bX174/HaeIII); lane 1, water; lane 2, kidney; lane 3, liver. (B) Southern hybridizat ion o f the same gel us ing DIG-label led GR~-, GRfl-, and MR-speci f ic c D N A

probes.

These effects may be due to the lower transcriptional potency of MR compared to GRa [23]. They indicate that the actual physiological role of GRfi might be that of an MR inhibitor.

The mechanism underlying the observed effects probably involves heterodimerization between MR and the two GR isoforms. First, MR and GR~ modu- late transcription by binding to the same consensus element in target DNAs [14, 16, 17, 24, 25]. Furthermore, we have shown that GRfi also bound to this type of response element [20]. Finally, heterodi- merization between MR and GR was recently demon- strated in gel shift experiments [16, 17]. The following hypothetical model can be inferred from these data (Fig. 1). In cells expressing significant levels of MR, e.g. the kidney and the hippocampus, the direction of GR pre-mRNA splicing can co-deter- mine the amplitude of MR-mediated transcription by creating dimers of different transcriptional potency.

Whereas MR/GR~ heterodimers seem to be more potent transactivators than MR/MR homodimers, MR/GRfl heterodimers appear to be less active.

The observed effects are not hormone-specific, because they were demonstrated in the presence of mineralocorticoids, glucocorticoids, or both. This is consistent with previous reports showing activation of both G R and MR by either type of hormone [24, 26, 27]. One may therefore conclude that the physiologi- cal role of differential G R pre-mRNA splicing is to modulate MR activity in classic mineralocorticoid tar- gets, e.g. the kidney, in which cortisol is inactivated by means of 1 lfl-hydroxysteroid dehydrogenase [28- 30], as well as in tissues that respond to both minera- locorticoids and glucocorticoids, e.g. the hippocampus [26, 31, 32]. As indicated by our R T - P C R data, both GRa and GRfl mRNAs are expressed in the human kidney. In a previous study, we have shown ex- pression of both isoforms in various other tissues,

MR/GR Interactions 49

inc lud ing the h i p p o c a m p u s [20]. M o r e recent ly, we

deve loped G R ~ - and GRfi-specif ic ant ibodies and

d e m o n s t r a t e d approx imate ly equal express ion levels of

GR~ and GRfl b o t h in the k idney and h i p p o c a m p u s

[33], again po in t ing to the physiological s ignificance

o f the above effects.

In summary , the oppos ing effects o f G R ~ and GRfl

on M R - m e d i a t e d gene t ranscr ip t ion and their ex-

press ion in var ious h u m a n tissues, inc lud ing the kid-

ney and the h i p p o c a m p u s , indicate that the ratio

be tween these two isoforms is likely to play an im-

por tan t role in regula t ing the h o r m o n e sensitivity of

mine ra locor t i co id target tissues. In addi t ion, one can

assume that the abnorma l express ion and /or activity

of GRc~ and GRfl may lead to impa i red minera locor t i -

coid sensitivity and wou ld thus b e c o m e clinically

apparent .

An abnormal ly low G R c ~ / G R f i ratio, for instance,

could lead to genera l ized mine ra locor t i co id resistance,

also known as p seudohypoa ldos t e ron i sm. It is known

that the s t ructure o f the M R itself is no t a l tered in

this syndrome, ind ica t ing that targets o f and/or factors

in te rac t ing with M R are likely to be dysfunct ional

[34-37] . Recent ly , C h a n g et al. [38] r epor t ed that

mu ta t ions in the genes cod ing for the alpha or beta

subuni ts o f the ami lor ide-sens i t ive s o d i u m channel

co-segrega ted wi th the disease in five kindreds.

The re fo re , the m e c h a n i s m we p roposed should be

sought in those cases o f hypoa ldos t e ron i sm that are

no t associated with sod ium channel abnormal i t ies .

M o r e impor tan t ly , .'in abnormal ly high G R ~ / G R f l

ratio could lead to e n h a n c e d mine ra locor t i co id ac-

tivity in the presence o f n o r m a l se rum a ldos te rone

levels. Because the regula t ion o f b lood pressure is the

fo remos t physiological role of minera locor t i co ids [2],

it is t e m p t i n g to speculate that an abnormal ly high

GRc~/GRfl ratio may be involved in the pa thogenes is

o f p r imary hyper tens ion . In suppor t o f this concept ,

PanareUi et al. [39] recent ly d e m o n s t r a t e d a high inci-

dence o f cer ta in res t r ic t ion f r agment length poly-

m o r p h i s m s (RFLPs ) in the g lucocor t i co id r ecep to r

gene o f pat ients wi th Jhmilial hyper tens ion . T o eluci-

date whe the r these R F L P s are associated with al tered

G R p r e - m R N A splicing will be an excit ing goal for

future research.

Acknowledgement--This wo:rk was supported by the Deutsche Forschungsgemeinschaft (DFG grant Ka 1039/2-1). Part of this work will be used for the doctoral thesis of M. Wald.

R E F E R E N C E S

1. Orth D. N., Kovacs W. J. and De Bold C. R.: The adrenal cor- tex. In William's Textbook of Endocrinology (Edited by Wilson J. D. and Foster D. W.). Saunders, Philadelphia, PA (1992) pp. 489-620.

2. Funder J. W.: Mineralocorticoid receptors and hypertension. ft. Steroid Biochem. Molec. Biol. 53 (1995) 53-55.

3. Bahr V., Sander-Bahr C., Ardevol R., Tuchelt H., Beland B. Oelkers W.: Effects of natriuretic factor on the renin-aldoster- one system: in vivo and in vitro studies. J. Steroid Biochem. Molec. BioL 45 (1993) 173-178.

4. Arriza J. L., Weinberger C., Cerelli G., Glaser T. M., Handelin B. L., Housman D. E. and Evans R. M.: Cloning of human mineralocorticoid receptor complementary DNA: struc- tural and functional kinship with the glucocorticoid receptor. Science 237 (1987) 268-275.

5. Evans R. M.: The steroid and thyroid hormone receptor super- family. Science 240 (1988) 889-895.

6. Beato M., Herrlich P. and Schiitz G.: Steroid hormone recep- tors: many actors in search of a plot. Cell 83 (1995) 851-857.

7. Mangelsdorf D. J., Thummel C., Beato M., Herrlich P., Sch/~tz G., Umesono K., Blumberg B., Kasmer P., Mark M., Chambon P. and Evans R. M.: The nuclear receptor superfam- ily: the second decade. Cell 83 (1995) 835-839.

8. Rafestin-Oblin M.-E., Couette B., Lombes M. and Baulieu E.- E.: Biochemical studies of the mineralocorticoid receptor: oli- gomeric structure and anti-hormone action. In Aldosterone: Fundamental Aspects (Edited by Bonvalet F., Lombes M. and Rafestin-Oblin M. E.). Colloque INSERM/John Libbey Eurotext (1991) pp. 55-64.

9. Caamano C. A., Morano M. I., Patel P. D., Watson S. J. and Akil H.: A bacterially expressed mineralocorticoid receptor is associated in vitro with the 90-kilodalton heat shock protein and shows typical hormone- and DNA-binding characteristics. Biochemistry 32 (1993) 8589-8595.

10. Robertson N. M., Schulman G., Kamik S., Alnemri E. and Litwack G.: Demonstration of nuclear translocation of the mineralocorticoid receptor (MR) using an anti-MR antibody and confocal laser scanning microscopy. Molec. Endocr. 7 (1993) 1226-1239.

11. Lombes M., Binart N., Delahaye F., Baulieu E.-E. and Rafestin-Oblin M. E.: Differential intracellular localization of human mineralocorticosteroid receptor on binding of agonists and antagonists. Biochem_7. 302 (1994) 191-197.

12. Alnemri E. S., Maksymowych A. B., Robertson N. M. and Litwack G.: Overexpression and characterization of the human mineralocorticoid receptor, ft. Biol. Chem. 266 (1991) 18072- 18081.

13. Binart N., Lombes M., Rafestin-Oblin M. E. and Baulieu E.- E.: Characterization of human mineralocorticoidsteroid recep- tor expressed in a baculovirus system. Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 10681-10685.

14. Lombes M., Binart N., Oblin M.-E., Joulin V. and Baulieu E. E.: Characterization of the interaction of the human mineralo- corticosteroid receptor with hormone response elements. Biochem. J. 292 (1993) 577-583.

15. Onate S. A., Tsai S. Y., Tsai M.-J. and O'Malley B. W.: Sequence and characterization of a coactivator for the steroid hormone receptor superfamily. Science 270 (1995) 1354-1357.

16. Trapp T., Rupprecht R., Castren M., Reul J. M. and Holsboer F.: Heterodimerization between mineralocorticoid and gluco- corticoid receptor: a new principle of glucocorticoid action in the CNS. Neuron 13 (1994) 1457-1462.

17. Liu W., Wang J., Sauter N. K. and Pearce D.: Steroid receptor heterodimerization in vitro and in vivo. Proc. Natl. Acad. Sci. U.S.A. 92 (1995) 12480-12848.

18. Hollenberg S. M., Weinberger C., Ong E. S., Cerelli G., Oro A., Lebo R., Thompson E. B., Rosenfeld M. G. and Evans R. M.: Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 318 (1985) 635-641.

19. Ehcio I. J. and Detera-Wadleigh S. D.: The genomic structure of the human glucocorticoid receptor. J. Biol. Chem. 266 (1991) 7182-7188.

20. Bamberger C. M., Bamberger A.-M., De Castro M. and Chrousos G. P.: Glucocorticoid receptor beta, a potential en- dogenous inhibitor of glucocorticoid action in humans..7. Clin. Invest. 95 (1995) 2435-2441.

21. Feigner P. L., Gadek T. R., Holm M., Roman R., Chan H. W., Wenz M., Northrop J. P., Ringold G. M. and Danielsen M.: Lipofection: a highly efficient, lipid-mediated DNA-trans- fection procedure. Proc. Natl. Acad. Sci. U.S.A. 84 (1987) 7413-7417.

50 C. M . B a m b e r g e r et al.

22. Brasier A. R., Tate J. E. and Habener J. F.: Optimized use of the firefly luciferase assay as a reporter gene in mammalian cell lines. Biotechniques 7 (1989) 1116-1122.

23. Rupprecht R., Arriza J. L., Spengler D., Reul J. M., Evans R. M., Holsboer F. and D a m m K.: Transactivation and synergis- tic properties of the mineralocorticoid receptor: relationship to the glucocorticoid receptor. Molec. Endocr. 7 (1993) 597-603.

24. Govindan M. V., Leclerc S., Roy R., Rathanaswami P. and Xie B.: Differential regulation of mouse mammary tumor virus-bac- terial chloramphenicol acetyltransferase chimeric gene by human mineralocorticoid hormone-receptor complexes. J. Steroid Biochem. Molec. Biol. 39 (1991) 91-103.

25. Zilliacus J., Wright A. P. H., Carlstedt-Duke J. and Gustafsson J.-A.: Structural determinants of DNA-binding specificity by steroid receptors. Molec. Endocr. 9 (1995) 389-400.

26. Arriza J. L., Simerly R. B., Swanson L. W. and Evans R. M.: The neuronal mineralocorticoid receptor as a mediator of glu- cocorticoid response. Neuron 1 (1988) 887-900.

27. Lombes M., Kenouch S., Souque A., Farman N. and Rafestin- Oblin M.-E.: The mineralocorticoid receptor discriminates aldosterone from glucocorticoids independently of the 1 lbeta- hydroxysteroid dehydrogenase. Endocrinology 135 (1994) 834- 840.

28. Funder J. W., Pearce P. T., Smith R. and Smith A. I.: Mineralocorticoid action: target tissue specificity is enzyme, not receptor, mediated. Science 242 (1988) 583-585.

29. Albiston A. L., Obeyesekere V. R., Smith R. E. and Krozowski Z. S.: Cloning and tissue distribution of the human beta-hy- droxysteroid dehydrogenase type 2 enzyme. Molec. Cell Endocr. 105 (1994) R11-R17.

30. Funder J. W.: Enzymes and receptors: challenges and future directions. Steroids 59 (1994) 164-169.

31. van Ekelen J. A. M., Jiang W., de Kloet E. R. and Bohn M. C.: Distribution of the mineralocorticoid and the glucocorticoid

receptor mRNAs in the rat hippocampus. J. Neurosci. Res. 21 (1988) 88-94.

32. de Kloet E. R.: Brain corticosteroid receptor balance and homeostatic control. Front. Neuroendocr. 12 (1991) 95-164.

33. De Castro M., Elliot S., Kino T., Bamberger C. M., Karl M., Webster E. and Chrousos G. P.: The non-ligand-binding fl-iso- form of the human glucocorticoid receptor (hGRfl): tissue levels, mechanism of action, and potential physiological role. Mol. Med. 2 (1996) 597-607.

34. Arai K., Tsigos C., Suzuki Y., Irony I., Karl M., Listwak S. Chrousos G. P.: Physiological and molecular aspects of minera- locorticoid receptor action in pseudohypoaldosteronism: a responsiveness test and therapy. J. Clin. Endocr. Metab. 79 (1994) 1019-1023.

35. Komesaroff P. A., Verity K. and Fuller P. J.: Pseudohypoaldosteronism: molecular characterization of the mineralocorticoid receptor. J. Clin. Endocr. Metab. 79 (1994) 27 31.

36. Zennaro M. C., Borensztein P., Jeunemaitre X., Armanini D. Soubrier F.: No alteration in the primary structure of the mineralocorticoid receptor in a family with pseudohypoaldos- teronism. J. Clin. Endocr. Metab. 79 (1994) 32-38.

37. Arai K., Tsigos C., Suzuki Y., Listwak S., Zachman K., Zangeneh F., Rapaport R., Chanoine J. P. and Chrousos G. P.: No apparent mineralocorticoid receptor defect in a series of sporadic cases of pseudohypoaldosteronism. J. Clin. Endocr. Metab. 80 (1995) 814-817.

38. Chang S. S., Grunder S., Hanukoglu A., Rosier A., Mathew P. M., Hanukoglu I., Schild L., Lu Y., Shimkets R. A., Nelson- Williams C., Rossier B. C. and Liffon R. P.: Mutations in sub- units of the epithelial sodium channel cause salt wasting with hyperkalaemic acidosis, pseudohypoaldosteronism type I. Nature Genet. 12 (1996) 248-253.

39. Panarelli M. and Fraser R.: The glucocorticoid receptor and hypertension. Endocr. Res. 20 (1994) 101-116.