HIF-1a Acts Downstream of TNF-a to InhibitVasodilator-Stimulated Phosphoprotein Expression

and Modulates the Adhesion and Proliferationof Breast Cancer Cells

Ke Su,1,* Yihao Tian,2,* Jing Wang,1 Wentao Shi,1 Daji Luo,3 Jian Liu,1 Zan Tong,4

Junzhu Wu,5 Jingwei Zhang,6 and Lei Wei1

Metastasis is the leading cause of death in breast cancer patients. Recent evidence suggests that inflammation-related cytokine tumor necrosis factor-alpha (TNF-a) is implicated in tumor invasion and metastasis, but themechanism of its involvement remains elusive. In this study, we employed MCF-7 breast cancer cells as anexperimental model to demonstrate that TNF-a inhibits breast cancer cell adhesion and cell proliferation throughhypoxia inducible factor-1alpha (HIF-1a) mediated suppression of vasodilator-stimulated phosphoprotein(VASP). We observed that TNF-a treatment attenuated the adhesion and proliferation of MCF-7 cells it alsodramatically increased HIF-1a expression and decreased VASP expression. Through a variety of approaches,including promoter assay, electrophoretic mobility shift assay (EMSA), and chromatin immunoprecipitation(ChIP), we identified VASP as a direct target gene of HIF-1a. In addition, we confirmed that HIF-1a mediated therepression of VASP expression by TNF-a in MCF-7 cells. We also demonstrated that exogenous VASP expressionor knockdown of HIF-1a relieved TNF-a induced inhibition of cell adhesion and proliferation. We identified anovel TNF-a/HIF-1a/VASP axis in which HIF-1a acts downstream of TNF-a to inhibit VASP expression andmodulate the adhesion and proliferation of breast cancer cells. These data provide new insight into the potentialanti-tumor effects of TNF-a.

Introduction

Breast carcinoma is the second leading cause of can-cer deaths in women. Notably, breast cancer is the most

common invasive cancer in women, and metastasis signifi-cantly contributes to the morbidity and mortality of breastcancer (Liang et al., 2004). Tumor metastasis is a multistep,complex process, which includes unregulated cell growthand survival, decreased cell–cell adhesion, increased abilityto degrade the extracellular matrix, increased cell motility,and the ability of invasion (Liotta et al., 1987). Although themolecular mechanism underlying metastasis is still notcompletely understood, molecules implicated in cell adhe-sion and cell migration are believed to play critical roles intumor invasion and metastasis.

Tumor necrosis factor-a (TNF-a) is a pleiotropic proin-flammatory cytokine that is produced by macrophages,neutrophils, fibroblasts, keratinocytes, natural killer, T-cells,B-cells, and even tumor cells to participate in variousphysiological and immune processes (Witte et al., 2007).TNF-a has been shown to have anti-tumor activity as evi-denced by its cytostatic/cytotoxic effects on human tumorcell lines (Wilt et al., 1995), but recent studies have dem-onstrated that TNF-a also modulates matrix degradationand mediates tumor metastasis (Han et al., 2002). Moreover,TNF-a regulates the expression of cell adhesion proteins andis thus implicated in the determination of the meta-static phenotype of tumor cells (Khatib et al., 1999; Prevost-Blondel et al., 2000; Barshishat et al., 2002; Zhu et al., 2004;Chen and Geng, 2006).

Departments of 1Pathology and Pathophysiology, 2Human Anatomy and Histology and Embryology, and 3Genetics, Laboratory ofAllergy and Clinical Immunology, Institute of Allergy and Immune-related Diseases, Centre for Medical Research, Wuhan University Schoolof Medicine, Wuhan University, Wuhan, People’s Republic of China.

4Laboratory of Allergy and Clinical Immunology, Institute of Allergy and Immune-related Diseases, Centre for Medical Research, WuhanUniversity School of Medicine, Wuhan University, Wuhan, People’s Republic of China.

5Department of Biochemistry and Molecular Biology, Medical College, Wuhan University, Wuhan, People’s Republic of China.6Department of Tumor Surgery, Zhongnan Hospital of Wuhan University, Wuhan, Hubei, People’s Republic of China.*These authors equally contributed to this work.

DNA AND CELL BIOLOGYVolume 31, Number 6, 2012ª Mary Ann Liebert, Inc.Pp. 1078–1087DOI: 10.1089/dna.2011.1563

1078

A hypoxic microenvironment is crucial for tumor meta-stasis. Hypoxia inducible factor-1a (HIF-1a) acts as animportant mediator of hypoxic response; significant associ-ations between HIF-1a overexpression and patient mortalityhave been shown in cancers of the oligodendroglioma,breast, cervix, oropharynx, ovary, and endometrium (Zhonget al., 1999; Talks et al., 2000; van Diest et al., 2005). Func-tionally, HIF-1a activates the transcription of vascular en-dothelial growth factor, which is required for tumorangiogenesis, and growth factors such as insulin-like growthfactor 2, to promote tumor survival. Loss of HIF-1a activityhas dramatic negative effects on tumor growth, vasculari-zation, and energy metabolism in xenograft assays, whereasthe opposite effects are observed for HIF-1a overexpression(Semenza, 2002). HIF-1a activity is upregulated by pro-inflammatory messengers such as nitric oxide and pro-inflammatory cytokines including TNF-a and interleukin 1b(IL-1b) (Hellwig-Burgel et al., 1999; Albina et al., 2001). HIF-1a may provide a link between inflammatory response andhypoxia response.

Vasodilator-stimulated phosphoprotein (VASP), a mem-ber of the Ena/VASP family, is associated with the microfil-ament system in a wide variety of cell types where itpromotes actin polymerization and assembly (Barzik et al.,2005; Schirenbeck et al., 2006). Given the crucial role of VASPin the regulation of the adherens junctions in epithelial cells(Krause et al., 2003), it is not surprising that VASP is impli-cated in tumorigenesis. VASP null NIH3T3 fibroblasts lostthe neoplastic capabilities when injected into nude mice (Liuet al., 1999). Clinical studies have also demonstrated thatVASP is overexpressed in lung adenocarcinoma (Dertsizet al., 2005). Further, we found that the expression level ofVASP increased in parallel to the pathological staging ofgastric cancer, suggesting that it may regulate the invasivebehavior of gastric carcinomas (Peng et al., 2009). Interest-ingly, by analyzing a VASP promoter in HMEC-1 cells,Rosenberger et al. (2007) revealed a transcription-mediatedrepression of VASP during hypoxia. Nevertheless, the func-tional interactions of TNF-a, HIF-1a, and VASP and theimplications in tumorigenesis remain largely unexplored. Inthis study, we used MCF-7 breast cancer cells as a model andprovided several lines of evidence to show that the TNF-a/HIF-1a/VASP axis plays a role in regulating the adhesionand the proliferation of MCF-7 breast cancer cells.

Materials and Methods

Plasmid constructs

Human VASP cDNA (I. M. A. G. E clone 824217, Prote-intech group, Wuhan, China) was cloned into the pEGFP-C1vector (Clontech, Palo Alto, CA). pCGN-HAM-HIF-1a ex-pression vector was kindly provided by Dr. Xiao Wuhan(Institute of Hydrobiology, Chinese Academy of Sciences).The 5¢ flanking region of the putative VASP promoter wasamplified from human genomic DNA by PCR and clonedinto pGL3-Basic vector (Promega, Madison, WI) to constructVASP reporter plasmids that spanned three different regionsof the VASP promoter: - 1921 - + 230, - 518 - + 230, - 132 -+ 230, respectively. The putative HIF-1a binding site (5¢-A/GCGTG-3¢) was mutated to A/GGCCA using the previouslydescribed site-directed mutagenesis method (Rosenbergeret al., 2007). All constructs were confirmed by sequencing.

Cell culture, transfection, and treatment

MCF-7 and HEK293 cells were grown in Dulbecco’smodified Eagle’s medium (DMEM; Invitrogen, Carlsbad,CA) supplemented with 10% fetal bovine serum (FBS; Hy-Clone, Logan, UT), 50 U/mL penicillin-G, 50mg streptomy-cin, and 1% glutamine, in a humidified atmosphere (95% air/5% CO2) at 37�C. Transient transfection was performed withLipofectamine 2000 (Invitrogen). Cells were cultured in se-rum-free DMEM for at least 8 h before being treated withTNF-a (Invitrogen) at a concentration of 1 to 200 ng/mL.

Luciferase assay

MCF-7 and HEK293 cells were seeded in 24-well plates,and the next day they were co-transfected with 100 ng lu-ciferase reporter construct, 20 ng renilla luciferase pRL-TKreporter, and 400 ng pCGN-HAM-HIF-1a. After 24 h, thecells were harvested and the luciferase activity was deter-mined using the Dual-Luciferase� reporter assay system(Promega). The relative light units were measured using aGlomax2020� luminometer (Promega). Data were normal-ized by Renilla luciferase. Each experiment was performed atleast three times in triplicate wells.

RNA interference

siRNA duplex oligonucleotides to HIF-1a (Genbank acces-sion no. NM_001530) designed as previously described (Chenet al., 2005) were synthesized by Shanghai GenePharma,(Shanghai, China). Sequences for HIF-1a-siRNA were: 5¢-CUGAUGACCAGCAACUUGAdTdT -3¢. A scrambled-siRNA(5¢- AGUUCAACGACCAGUAGUCdTdT-3¢) was used in allexperiments. The shRNA duplexes were designed against VASP(Genbank accession no. BC038224) with the following se-quences: 5¢-TGCTGTAAAGCATCACAGTGGCCCGGGTTTTGGCCACTGACTGACCCGGGCCAGTGATGCTTTA -3¢ andwere constructed into the pcDNA�6.2-GW/EmGFP vector(Invitrogen) to make pcDNA� 6.2-GW/EmGFP-miR-VASP.Scrambled shRNA was obtained from Invitrogen and used asnegative control in all experiments.

Semi-quantitative RT-PCR

Total RNA was extracted from cells with Trizol (Invitro-gen). Total RNA (2 mg) was used for first-strand cDNAsynthesis with RevertAid� First Strand cDNA Synthesis Kit(Fermentas, Vilnius, LTU). Semi-quantitative PCR was per-formed in the presence of SYBR green using a 7500 Fast Real-Time PCR System. All PCR reactions were run in triplicateand repeated at least three times. Differences were calculatedaccording to the DDCt relative quantization method usingthe b-actin gene to calibrate. The primers for human VASPwere 5¢- AAAGTCAGCAAGCAGGAGGA -3¢ and 5¢- ATTCATCCTTGGGGGTTTTC -3¢. The primers for human HIF-1a were 5¢- GAAAGCGCAAGTCCTCAAAG -3¢ and 5¢- TGGGTAGGAGATGGAGATGC -3¢. The primers for b-actinwere 5¢- CATTAAGGAGAAGCTGTGCT -3¢ and 5¢- GTTGAAGGTAGTTTCGTGGA -3¢.

Western blotting

After transfection or TNF-a treatment for 24 h, the cellswere washed with PBS and lysed in a modified RIPA buffer.

TNF-a INHIBIT VASP THROUGH HIF-1a 1079

Protein concentration was measured with the BCA� proteinassay kit (Pierce, Rockford, IL). Equal amounts of total pro-tein (10 mg) were loaded, run on 10% SDS-polyacrylamide geland transferred to PVDF membranes (Millpore, Billerica,MA). The membranes were blocked with Tris-buffered salinecontaining 5% nonfat milk for 2 h, then probed with VASPantibody (1:800 dilution, Alexis, San Diego, CA), HIF-1a an-tibody (1:1000 dilution, Abcam, Cambridge, United King-dom), or a-tubulin antibody (1/1000 dilution, Sigma-Aldrich,St. Louis, MO) at 4�C overnight, followed by incubation withhorseradish peroxidase (HRP)-linked secondary antibodies(1:5000, Santa Cruz Biotechnology, Santa Cruz, CA) for 1 h atroom temperature, and detected by ECL reagents (Pierce).Experiments were repeated 3 times with similar results.

Electrophoretic mobility gel shift assay

Nuclear extracts from 293T cells were prepared with Nu-clear Protein Extraction kit (Active Motif, Carlsbad, CA)following the manufacturer’s instructions. Two oligonucle-otides VASP promoter-wt (5¢- CCCGACTTCCACTCCCGTGCGGGTGGGGGTC-3¢) and VASP promoter -mut (5¢- CCCGACTTCCACTCCATCACGGGTGGGGGTC -3¢) were syn-thesized by Sangon Biotech (Shanghai, China) and thenamplified by PCR. 5¢ end of the sense strand was labeledwith g32P-ATP (NEN, Boston, MA) with T4-polynucleotidekinase (Promega). Nuclear extracts were incubated with500 mg poly (dI:dC), and electrophoretic mobility shift assay(EMSA) was performed according to the protocol providedby Gel Shift Assay System (Promega).

Chromatin immunoprecipitation assay

To demonstrate direct binding of HIF-1a to the VASPpromoter, SiHa cells were transfected with HIF-1a expres-sion vector for 48 h. Chromatin immunoprecipitation (ChIP)assays were performed using the ChIP assay kit (Millipore,Billerica, MA) according to the provided protocol. Theprimers used in this analysis spanned 160 bp around theputative HIF-1a binding site within the VASP promoter (5¢-AGGGGCGCGACCAAATCAGT -3¢ and 5¢- TCATCCCAGCCCTCAGGAGG -3¢). PCR products were analyzed by 2%agarose gel electrophoresis. b-actin was used as an internalcontrol. PCR was performed for 25 cycles with the followingcycling conditions: 94�C, 20 s; 68�C, 20 s; and 72�C, 20 s.

Cell proliferation assay

MTT [3-(4,5-dimethythiazoyl-2-yl)-2,5-diphenyltetrozolium-bromide] (Amresco, Solon, OH) colorimetric analysis wasused to measure cell proliferation. Cells were seeded in 96-well plates at a density of 1 · 105/mL (100 mL per well). After24 h the medium was removed and MTT was added to eachwell (20mL of 5 mg/mL in PBS solution). The plates wereincubated for 4 h at 37�C 5%CO2/95% air and then warmdimethylsulfoxide (DMSO; 200mL) was added. Absorbancewas measured at 570 nm with an ELISA plate reader (In-finite� 200 PRO, TECAN, Mannedorf, CH). Three indepen-dent experiments were performed in triplicate.

Adhesion assay

Treated cells were seeded at a density of 1 · 105/mL(100 mL per well) in 96-well plates previously coated with

fibronectin (Fn; 100 mg/mL) or laminin (Ln;7 200mg/mL;Becton Dickinson, Heidelberg, Germany). After a 2 h incu-bation at 37�C in a 5% CO2 incubator, the plates werewashed with PBS to remove any nonadherent cells. MTTwas added to each well (20 mL of 5 mg/mL) and cells wereincubated for 4 h at 37�C. DMSO (200 mL) was then addedto each well, and, after shaking the plates for 10 min,the OD570 was tested. The percentage of adhesion wascalculated according to the following formula: percentageof adhesion = (OD570 of cells treated/OD570 of cellsuntreated) · 100%.

Statistical analysis

Data were expressed as the mean – SD. Quantification ofband densities was performed using the Image J. Student’st-test was utilized to compare the difference between twogroups. p < 0.05 was considered to be statistically significant.

Results

TNF-a inhibits adhesion and proliferation of MCF-7 cellsvia suppression of VASP expression

To evaluate the effect of TNF-a on breast cancer cell ad-hesion and cell proliferation, we treated MCF-7 cells withvarious doses of TNF-a. We used Fn, a high-molecularweight glycoprotein of the extracellular matrix that binds tomembrane-spanning receptor proteins, and Ln, a majorstructural component of basement membranes, to observecell adhesion ability. We observed that TNF-a treatment ofthe MCF-7 cells led to the decreased adhesion and prolifer-ation abilities of the cells in a dose dependent manner (Fig.1A, B). VASP is a downstream target of TNF-a signaling andhas been reported to be involved in endothelial barrierfunction (Henes et al., 2009). We investigated the potentialrole of VASP in TNF-a mediated cell adhesion and prolifer-ation by modulating VASP expression in MCF-7 cells. Weobserved markedly reduced adhesion and proliferation ofthe MCF-7 cells (Fig. 1D, E) after the specific knockdown ofVASP by VASP shRNA, but not with the scrambled shRNA(Fig. 1C). In contrast, overexpression of VASP in MCF-7 cellsby transient transfection of pEGFP-C1-VASP increased celladhesion (Fig. 1D), but not cell proliferation (Fig. 1E). Theinhibitory effects on cell adhesion and cell proliferation re-sulting from VASP deficiency could be attenuated by exog-enous VASP expression (Fig. 1D, E).

We treated MCF-7 cells with TNF-a and observed thatexogenous overexpression of VASP in the MCF-7 cells offsetthe reduced cell adhesion and cell proliferation that occur inresponse to TNF-a (Fig. 1F, G). MCF-7 cells depleted ofVASP exhibited a lower rate of cell adhesion and cell pro-liferation when treated with TNF-a compared to the cellsthat were not treated with TNF-a (Fig. 1F, G). These data ledus to hypothesize that VASP may antagonize the inhibitoryeffects of TNF-a on cell adhesion and cell proliferation. Totest this hypothesis, we analyzed the mRNA and proteinexpression levels of VASP in response to TNF-a in MCF-7cells. As expected, the expression of VASP was severelysuppressed by TNF-a in a dose-dependent manner (Fig. 1H,I). Taken together, our results suggest that TNF-a attenuatesMCF-7 cell adhesion and cell proliferation by suppressingVASP expression.

1080 SU ET AL.

HIF-1a acts downstream of TNF-a to inhibit adhesionand proliferation of MCF-7 cells

TNF-a is known to regulate HIF-1a expression and toinitiate its activity in human hepatoma cells (Hellwig-Burgel

et al., 1999). To investigate the potential role of HIF-1a inTNF-a-induced inhibition of cell proliferation and cell ad-hesion, we examined mRNA and protein expression levels ofHIF-1a in MCF-7 cells treated by TNF-a. The results showedthat treatment of MCF-7 cells with TNF-a under normoxic

TNF-a INHIBIT VASP THROUGH HIF-1a 1081

conditions did not induce HIF-1a transcription (Fig. 2A), butdid increase HIF-1a protein level (Fig. 2B). The increase ofHIF-1 a could be due to either de novo protein synthesis orthe inhibition of protein degradation; we utilized MG132, aproteasome inhibitor, and cycloheximide (CHX), a proteintranslation inhibitor, to distinguish between the two possi-bilities. In the absence of MG132 and following TNF-astimulation, HIF-1a accumulated in the MCF-7 cells, but thisaccumulation decreased within 15 min after the removal ofTNF-a and declined to a barely detectable level by 30 minafter TNF-a removal (Fig. 2C). However, MG132 treatmentdid not affect TNF-a induced HIF-1a accumulation in theMCF-7 cells (Fig. 2C). These results suggest that TNF-a mayinhibit the degradation of HIF-1a by the proteasome and thatthe prevention of protein degradation is not a significantfactor that contributes to the accumulation of HIF-1a. HIF-1aprotein decreased to an undetectable level in the MCF-7 cellsafter they were treated with TNF-a within 30 min of CHXincubation; the level of HIF-1a protein remained constantover 60 min despite the lack of ongoing protein synthesis,when the MCF-7 cells were also exposed to hypoxia mimiccobalt chloride (CoCl2; Fig. 2D). Collectively, these datasuggest that HIF-1a is accumulated in MCF-7 cells uponTNF-a treatment.

We observed increased cell adhesion and cell proliferationof MCF-7 cells (Fig. 2G, H) when HIF-1a was specificallyknocked down by HIF-1a siRNA, but not when treated withthe scrambled siRNA (Fig. 2E, F). The induction of HIF-1a byCoCl2 could significantly inhibit the adhesion and the pro-liferation of MCF-7 cells (Fig. 2G, H). These complementaryexperiments show that HIF-1a could negatively regulate thecell adhesion and cell proliferation of MCF-7 cells. Next, weassessed the effects of HIF-1a on cell adhesion and cell pro-liferation in the context of TNF-a treatment. The induction ofHIF-1a by CoCl2 significantly augmented TNF-a-inducedinhibition of cell adhesion and cell proliferation, while theknockdown of HIF-1a by siRNA significantly antagonizedthe TNF-a-induced inhibition (Fig. 2G, H). Therefore, ourdata demonstrate that HIF-1a is positively regulated by TNF-

a and acts downstream of TNF-a to mediate the inhibition ofadhesion and proliferation of MCF-7 cells.

HIF-1a regulates VASP expression throughtranscriptional repression

Because HIF-1a and VASP are both implicated in the TNF-a induced inhibition of cell adhesion and cell proliferation,we investigated the interaction between HIF-1a and VASP.Our results showed that VASP expression of mRNA levelsand protein levels was repressed by HIF-1a and that VASPexpression was dramatically activated by HIF-1a knock-down in MCF-7 cells (Fig. 3A, B). To confirm the negativetranscriptional regulation of VASP expression by HIF-1a, weperformed promoter assays. A putative promoter fragmentspanning - 1921 - + 230 at the 5¢flanking sequence of theVASP gene was analyzed and the results revealed two pu-tative HIF-1a binding sites (HBS) 5¢-A/GCGTG-3¢, located at- 1,567 and - 435 (Fig. 3C). Transient transfection of the HIF-1a expression vector and with the full promoter vector sig-nificantly inhibited VASP expression in both HEK293 cellsand MCF-7 cells (Fig. 3D). However, the repressive effectdisappeared when the HBS on the promoter was mutated ordeleted (Fig. 3D). To further confirm that HIF-1a can regulateVASP expression directly, we performed an EMSA assay;HIF-1a bound directly to HBS consensus motif 5¢-CACGTGG-3¢ on the VASP promoter (Fig. 3E). ChIP analysisconfirmed that HIF-1a bound the VASP promoter (Fig. 3F).Collectively, these results provide strong evidence that HIF-1a negatively regulates VASP expression through directbinding to the VASP promoter.

HIF-1a mediates the repression of VASP expressionby TNF-a in MCF-7 cells

To further explore whether HIF-1a is involved in TNF-a-induced suppression of VASP expression, we examined thepotential role of HIF-1a in the regulation of VASP expressionby TNF-a. In the absence of TNF-a, the expression of bothHIF-1a and VASP was maintained at a moderate protein

FIG. 1. TNF-a inhibits adhesion and proliferation of MCF-7 cells via the suppression of VASP expression. (A) MCF-7 cellswere treated with serum-free DMEM medium or TNF-a (1, 10, 100, and 200 ng/mL) for 24 h, then seeded in fibronectin (Fn)or laminin (Ln) coated wells and incubated for 2 h, cell adhesion was examined by MTT assay. TNF-a induced a dose-dependent inhibition of cell adhesion in MCF-7 cells. ***p < 0.001. (B) MCF-7 cells were treated with serum-free DMEMmedium or TNF-a (1, 10, 100, and 200 ng/mL) for 24 h, and cell proliferation was examined by MTT assay. TNF-a induced adose-dependent inhibition of MCF-7 cell proliferation. ***p < 0.001. (C) Western blots showing VASP expression in MCF-7cells after transfection with control vectors, pEGFP-C1-VASP, scrambled shRNA vector, and VASP shRNA for 48 h. a-tubulinserved as a loading control. (D) MCF-7 cells were transfected with the indicated vectors and seeded in Fn or Ln coated wells,cell adhesion was examined by MTT assay. ***p < 0.001, VASP shRNA versus scrambled shRNA. **p < 0.01, VASP shRNAplus pEGFP-C1-VASP versus VASP shRNA. (E) MCF-7 cells were seeded in wells and transfected with the indicated vectors,and cell proliferation was examined by MTT assay. *p < 0.05, **p < 0.01 as indicated. (F) MCF-7 cells were transfected with theindicated vectors. After 48 h the cells were treated with TNF-a (100 ng/mL) for 24 h before cell adhesion, cells were seeded inLn coated wells, and cell adhesion was examined using MTT assay. ***p < 0.001. **p < 0.01, and *p < 0.05 as indicated. (G)MCF-7 cells were seeded in wells and transfected with the indicated vectors. After 48 h the cells were treated with TNF-a(100 ng/mL) for 24 h before cell proliferation was examined by MTT assay. **p < 0.01 and *p < 0.05 as indicated. The resultswere presented as the means – SD of three independent experiments. (H–I) TNF-a induced a dose-dependent inhibition ofVASP expression in MCF-7 cells. Serum-starved MCF-7 cells were treated with different concentrations of TNF-a (0, 1, 10,100, and 200 ng/mL) for 24 h and the expression of VASP in cell lysates was determined by Western blotting (H). a-tubulinserved as a loading control. Shown were representative blots from three independent experiments with similar results. ThemRNA level of VASP in cells was analyzed by semi-quantitative RT-PCR (I). b-actin served as an internal control. Shownwere mean and standard deviation based on three independent semi-quantitative RT-PCR reactions. **p < 0.01 versus controlgroup for 0 ng/mL TNF-a. VASP, vasodilator-stimulated phosphoprotein.

‰

1082 SU ET AL.

FIG. 2. HIF-1a mediates TNF-a induced inhibition of MCF-7 cells adhesion and cell proliferation. (A) MCF-7 cells weretreated with TNF-a (100 ng/mL) for 24 h, then cells were harvested for Real Time PCR analysis of HIF-1a mRNA level.b-actin served as an internal control. TNF-a had no obvious effect on HIF-1a mRNA expression level (TNF-a vs. controlp > 0.05). Shown were the mean – S.D. of three independent experiments performed in triplicate. (B) Western blotting showingthe upregulation of HIF-1a protein expression by TNF-a. a-tubulin served as a loading control. CoCl2 was used as a positivecontrol. (C) MCF-7 cells were treated with the proteasome inhibitor MG132 (10 mM) or untreated for 4 h and then stimulatedwith TNF-a (100 ng/mL). Whole cell lysates were prepared and analyzed by Western blotting using antibodies to HIF-1a ora-tubulin. (D) HIF-1a expression was induced by the exposure of MCF-7 cells to TNF-a (100 ng/mL) or CoCl2 (200 mM) undernormoxia for 4 h. Cycloheximide (CHX) was added to a final concentration of 10 ug/mL, and the cells were incubated for theindicated time in the presence of CHX and the inducer. Whole cell lysates were prepared and analyzed by Western blottingusing antibodies to HIF-1a or a-tubulin. (E–F) MCF-7 cells was transiently transfected with HIF-1a specific or scramblesiRNA, and then HIF-1a mRNA level was quantified by semi-quantitative RT-PCR and normalized to b-actin as a house-keeping gene *p < 0.05 (E); and HIF-1a protein level was analyzed by Western blot with a-tubulin as loading control (F). (G)MCF-7 cells were transfected with the indicated vectors. After 48 h the cells were treated with TNF-a (100 ng/mL) for 24 hbefore cell adhesion was examined by MTT assay. *p < 0.05, ***p < 0.001 versus scrambled siRNA. (H) MCF-7 cells weretransfected with the indicated vectors. After 48 h the cells were treated with TNF-a (100 ng/mL) for 24 h before cell prolif-eration was examined by MTT assay. ***p < 0.001. The results were presented as the means – SD of three independentexperiments. Exposure to CoCl2 was used as a positive control to induce the expression of HIF-1a. (B, C, D, and F), shownwere representative blots from three independent experiments with similar results. HIF-1a, hypoxia inducible factor-1alpha;TNF-a, tumor necrosis factor-alpha.

1083

FIG. 3. HIF-1a represses VASP expression via direct binding to its promoter. (A) Western blots showing that VASP proteinlevel was reduced in MCF-7 cells transfected with HIF-1a-siRNA but not in MCF-7 cells transfected with scrambled siRNA.a-tubulin served as a loading control. Exposure to CoCl2 was used as a positive control to induce HIF-1a expression. Shownwere representative blots from three independent experiments with similar results. (B) Semi-quantitative RT-PCR analysis ofVASP mRNA level in MCF-7 cells transfected with HIF-1a-siRNA or scrambled-siRNA. Fold regulation in treated sampleswas obtained by comparison with nontreated controls after normalization with b-actin. Data represented the mean – SD ofthe relative expression of VASP mRNA in MCF-7 cells isolated from three different samples. **p < 0.01, and ***p < 0.001 asindicated. (C) Schematic drawing of the putative VASP promoter. Potential binding sequences for HIF-1a were displayed(HBS). (D) Luciferase assay was performed by co-transfection with VASP promoter reporter and HA-tagged HIF-1a ex-pression plasmid. Overexpression of HIF-1a significantly inhibited VASP promoter activity but not a truncated form withHBS mutation or a shorted form with HBS deletion. *p < 0.05. (E) EMSA showing that HIF-1a directly binds to the HBS onVASP promoter. HIF-1a could specifically bind to wild-type oligonucleotides consensus with HBS (lane 2) but not to amutated form (lane 3) or a random sequence (lane 4). (F) ChIP analysis showing that HIF-1a specifically binds to proximalregion of HBS in VASP promoter region. EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation;HBS, HIF-1a binding sites.

1084

level and a knockdown of HIF-1a led to increased VASPexpression in MCF-7 cells (Fig. 4A, B). Upon stimulation byTNF-a, the level of HIF-1a was elevated accompanied by asuppression of VASP expression. However, the suppressionof VASP by TNF-a could be relieved through HIF-1aknockdown (Fig. 4A, B). These results indicate that HIF-1amediates the repression of VASP expression by TNF-a inMCF-7 cells.

Discussion

Numerous studies have shown that TNF-a, HIF-1a, andVASP are involved in the initiation, promotion, and pro-gression of cancer. However, the functional interaction ofthese three factors and the implications of these interactionsin tumor progression remain largely unexplored. For the firsttime, we showed that the TNF-a/HIF-1a/VASP axis plays arole in regulating the adhesion and proliferationof MCF-7breast cancer cells. We provided a series of evidence sup-porting the premise that TNF-a induces the expression ofHIF-1a, which in turn binds to VASP promoter and inhibitsVASP transcription, consequently leading to suppressedadhesion and proliferation of MCF-7 breast cancer cells.

TNF-a is known to be involved in malignant diseases andcan both inhibit and stimulate angiogenesis, depending onthe applied dose. Using a disc angiogenesis system in miceand a subcutaneous osmotic millipump, it has been shownthat high doses of TNF-a (1–5 mg) inhibited angiogenesis,while low doses (0.01–1 ng) stimulated angiogenesis (Fajardoet al., 1992). High doses of locally administered TNF-a evencaused vessel regression and hemorrhagic necrosis, sug-gesting that TNF-a could be used as an anti-cancer agent(Anderson et al., 2004). However, in vivo, the secretion ofendogenous TNF-a does not cause tumor regression, butrather mediates tumor progression by inducing cancer cellgrowth, proliferation, angiogenesis, invasion, and metastasis.These observations have been consistently shown both inanimal models and in clinical studies (Mochizuki et al., 2004;Yin et al., 2009).

Recently, it was reported that TNF-a increased the at-tachment of melanoma cells to the ECM substrate Fn andpromoted melanoma cell invasion (Katerinaki et al., 2003).

Mechanistically, TNF-a stimulated cell migration and cellinvasion through the activation of the transcription factornuclear factor-kappaB and upregulation of intercellular ad-hesion molecule-1 (Katerinaki et al., 2006). TNF-a also pro-motes tumor progression in different cancer cells, in part, bystimulating MMP expression and activities at low concen-trations ranging from 1–10 ng/mL (Wielockx et al., 2001). Inthe present study, we found that 100 ng/mL TNF-a not onlyinhibited MCF-7 cell proliferation but also inhibited the at-tachment of MCF-7 cells to Fn and Ln, suggesting that a highdose of TNF-a might inhibit tumor progression and invasion.

It has been suggested that the adhesive interaction of tu-mor cells with ECM components plays a critical role in theestablishment of metastasis (Kato et al., 2002; Mareel andLeroy, 2003). Decreased cell-cell adhesion and increased cell-matrix adhesion are important for the detachment of meta-static cells from the primary tumor. Cell migration is adynamic process involving polarized formation and disas-sembly of focal adhesions at opposite ends of the cell (Hut-tenlocher et al., 1995; Huttenlocher et al., 1997). In addition,adhesion dynamics must be coordinated with the assemblyof new F-actin containing protrusions, which are in turnunder the control of several actin nucleating and elongatingmolecules (Le and Carlier, 2008). Ena/VASP proteins inmammalian cells are located in focal adhesions, lamellipodia,and microspikes, and play an important role in regulatingmicrofilament assembly (actin nucleation) and cytoskeletalorganization (Sechi and Wehland, 2004). VASP binds to theproline-rich domain of the focal-adhesion proteins vinculinand zyxin (Reinhard et al., 1995; Brindle et al., 1996). Vinculinis known to contain binding sites for talin, paxillin, and F-actin, and also binds a-actinin (Brindle et al., 1996). Giventheir ability to interact with several cytoskeletal proteins andtheir localization to focal adhesions, vinculin and zyxin mayact to recruit VASP and thereby initiate microfilament as-sembly leading to ruffling and lamellipodial extension.Consistent with these possibilities, we observed that siRNAmediated knockdown of VASP or TNF-a mediated inhibitionof VASP could inhibit the proliferation ability of MCF-7 cellsand inhibit MCF-7 cell adhesion to Fn and Ln, suggestingthat loss of VASP function disrupts F-actin assembly andcontributes to decreased cell migration ability.

FIG. 4. HIF-1a mediates the repression of VASP expression by TNF-a in MCF-7 cells. MCF-7 cells were transfected withHIF-1a-siRNA or scrambled siRNA for 48 h and then treated with 100 ng/mL TNF-a or untreated for 24 h as indicated. (A)Western blotting showing that TNF-a inhibited VASP expression but HIF-1a-siRNA recovered VASP expression in MCF-7cells. a-tubulin served as a loading control. Shown were representative blots from three independent experiments withsimilar results. (B) Semi-quantitative RT-PCR analysis showing that HIF-1a knockdown increased VASP mRNA level afterTNF-a treatment in MCF-7 cells. *p < 0.05. Data represent is the means – SD of three independent experiments performed intriplicate.

TNF-a INHIBIT VASP THROUGH HIF-1a 1085

Other studies also found that VASP plays an importantrole in the regulation of cell adhesion. A study employingVASP null mouse cardiac fibroblasts demonstrated that theadhesion of VASP-deficient cells to surfaces coated with alow concentration of Fn was delayed (Galler et al., 2006). Bearet al. (2000) reported that VASP negatively regulated cellmotility. Moreover, VASP is localized to both cell-matrixadhesions and lamellipodia. Lamellipodia are the primarysites where VASP suppresses fibroblast motility (Bear et al.,2000). Theoretical and experimental analyses have shownthat the effect of the cell-matrix adhesion strength on cellmigration is biphasic (Huttenlocher et al., 1995). Whileabundant VASP is present at cell-matrix adhesions, thefunction of VASP in these sites has been puzzling (Zhanget al., 2006). Taken together, these studies provide moresupport for our findings that VASP is essential for cell ad-hesion. We hypothesize that VASP plays an important role inmediating the inhibitory effects of TNF-a on cell adhesion.

The focus of the current study is the characterization ofsignaling cascades through which TNF-a modulates the ad-hesion and proliferation of MCF-7 cells. We first found thatTNF-a inhibited the expression of VASP in MCF-7 cells. Thisfinding is consistent with previous studies which showedthat endothelial HMEC-1 cells demonstrated a significantlyreduced VASP expression level in response to TNF-a (Heneset al., 2009), and that alveolar A549 cells exhibited the re-pression of VASP mRNA and protein expression after stim-ulation with TNF-a (Henes et al., 2009). Next, we revealedthat HIF-1a was positively regulated by TNF-a and that HIF-1a mediated the downstream biological effects. Rosenbergeret al. (2007) described VASP as a repression target of HIF-1a,and identified one HIF-1a binding site in the VASP promoterwhich is coincident with our finding of one HBS site in VASPpromoter as shown in Figure 3. We employed a variety ofapproaches including promoter assay, EMSA and ChIP toidentify VASP as a direct target gene of HIF-1a. Finally, weconfirmed that HIF-1a mediated the repression of VASPexpression by TNF-a in MCF-7 cells.

In conclusion, our data suggest that a novel TNF-a/HIF-1a/VASP axis is crucially involved in modulating the ad-hesion and proliferation of breast cancer cells and providenew insight into the potential anti-tumor effects of TNF-a.

Acknowledgments

We thank Yihao Tian and Wuhan Xiao for advice andstimulating discussion; Guoge Han and Chen Wang forcritical reading of thearticle; and Xiaoyang Wan and Daji Luofor excellent technical assistance. This study was supportedby the National Natural Science Foundation of China (No.30971132 and 81172043).

Disclosure Statement

No competing financial interests exist.

References

Albina, J.E., Mastrofrancesco, B., Vessella, J.A., Louis, C.A.,Henry, W.L., Jr., and Reichner, J.S. (2001). HIF-1 expression inhealing wounds: HIF-1alpha induction in primary inflamma-tory cells by TNF-alpha. Am J Physiol Cell Physiol 281, 1971–1977.

Anderson, G.M., Nakada, M.T., and DeWitte, M. (2004). Tumornecrosis factor-alpha in the pathogenesis and treatment ofcancer. Curr Opin Pharmacol 4, 314–320.

Barshishat, M., Ariel, A., Cahalon, L., Chowers, Y., Lider, O., andSchwartz, B. (2002). TNF-alpha and IL-8 regulate the expres-sion and function of CD44 variant proteins in human coloncarcinoma cells. Clin Exp Metastasis 19, 327–337.

Barzik, M., Kotova, T.I., Higgs, H.N., Hazelwood, L., Hanein, D.,Gertler, F.B., and Schafer, D.A. (2005). Ena/VASP proteinsenhance actin polymerization in the presence of barbed endcapping proteins. J Biol Chem 280, 28653–28662.

Bear, J.E., Loureiro, J.J., Libova, I., Fassler, R., Wehland, J., andGertler, F.B. (2000). Negative regulation of fibroblast motilityby Ena/VASP proteins. Cell 101, 717–728.

Brindle, N.P., Holt, M.R., Davies, J.E., Price, C.J., and Critchley,D. R. (1996). The focal-adhesion vasodilator-stimulated phos-phoprotein (VASP) binds to the proline-rich domain in vin-culin. Biochem J 318, 753–757.

Chen, K.F., Lai, Y.Y., Sun, H.S., and Tsai, S.J. (2005). Transcrip-tional repression of human cad gene by hypoxia induciblefactor-1alpha. Nucleic Acids Res 33, 5190–5198.

Chen, M., and Geng, J.G. (2006). P-selectin mediates adhesion ofleukocytes, platelets, and cancer cells in inflammation,thrombosis, and cancer growth and metastasis. Arch ImmunolTher Exp (Warsz) 54, 75–84.

Dertsiz, L., Ozbilim, G., Kayisli, Y., Gokhan, G.A., Demircan, A.,and Kayisli, U.A. (2005). Differential expression of VASP innormal lung tissue and lung adenocarcinomas. Thorax 60,

576–581.Fajardo, L.F., Kwan, H.H., Kowalski, J., Prionas, S.D., and Alli-

son, A.C. (1992). Dual role of tumor necrosis factor-alpha inangiogenesis. Am J Pathol 140, 539–544.

Galler, A.B., Garcia Arguinzonis, M.I., Baumgartner, W., Kuhn,M., Smolenski, A., Simm, A., and Reinhard, M. (2006). VASP-dependent regulation of actin cytoskeleton rigidity, cell ad-hesion, and detachment. Histochem Cell Biol 125, 457–474.

Han, Y.P., Nien, Y.D., and Garner, W.L. (2002). Tumor necrosisfactor-alpha-induced proteolytic activation of pro-matrixmetalloproteinase-9 by human skin is controlled by down-regulating tissue inhibitor of metalloproteinase-1 and medi-ated by tissue-associated chymotrypsin-like proteinase. J BiolChem 277, 27319–27327.

Hellwig-Burgel, T., Rutkowski, K., Metzen, E., Fandrey, J., andJelkmann, W. (1999). Interleukin-1beta and tumor necrosisfactor-alpha stimulate DNA binding of hypoxia-induciblefactor-1. Blood 94, 1561–1567.

Huttenlocher, A., Palecek, S.P., Lu, Q., Zhang, W., Mellgren,R.L., Lauffenburger, D.A., Ginsberg, M.H., and Horwitz, A.F.(1997). Regulation of cell migration by the calcium-dependentprotease calpain. J Biol Chem 272, 32719–32722.

Huttenlocher, A., Sandborg, R.R., and Horwitz, A.F. (1995).Adhesion in cell migration. Curr Opin Cell Biol 7, 697–706.

Henes, J., Schmit, M.A., Morote-Garcia, J.C., Mirakaj, V., Kohler,D., Glover, L., Eldh, T., Walter, U., Karhausen, J., Colgan, S.P.,and Rosenberger, P. (2009). Inflammation-associated repres-sion of vasodilator-stimulated phosphoprotein (VASP) re-duces alveolar-capillary barrier function during acute lunginjury. FASEB J 23, 4244–4255.

Katerinaki, E., Evans, G.S., Lorigan, P.C., and MacNeil, S. (2003).TNF-alpha increases human melanoma cell invasion and mi-gration in vitro: the role of proteolytic enzymes. Br J Cancer 89,

1123–1129.Katerinaki, E., Haycock, J.W., Lalla, R., Carlson, K.E., Yang, Y.,

Hill, R.P., Lorigan, P.C., and MacNeil, S. (2006). Sodium

1086 SU ET AL.

salicylate inhibits TNF-alpha-induced NF-kappaB activation,cell migration, invasion and ICAM-1 expression in humanmelanoma cells. Melanoma Res 16, 11–22.

Kato, R., Ishikawa, T., Kamiya, S., Oguma, F., Ueki, M., Goto, S.,Nakamura, H., Katayama, T., and Fukai, F. (2002). A new typeof antimetastatic peptide derived from fibronectin. Clin Can-cer Res 8, 2455–2462.

Khatib, A.M., Kontogiannea, M., Fallavollita, L., Jamison, B.,Meterissian, S., and Brodt, P. (1999). Rapid induction of cy-tokine and E-selectin expression in the liver in response tometastatic tumor cells. Cancer Res 59, 1356–1361.

Krause, M., Dent, E.W., Bear, J.E., Loureiro, J.J., and Gertler, F.B.(2003). Ena/VASP proteins: regulators of the actin cytoskele-ton and cell migration. Annu Rev Cell Dev Biol 19, 541–564.

Le, C.C., and Carlier, M.F. (2008). Regulation of actin assemblyassociated with protrusion and adhesion in cell migration.Physiol Rev 88, 489–513.

Liang, Z., Wu, T., Lou, H., Yu, X., Taichman, R.S., Lau, S.K., Nie,S., Umbreit, J., and Shim, H. (2004). Inhibition of breast cancermetastasis by selective synthetic polypeptide against CXCR4.Cancer Res 64, 4302–4308.

Liotta, L.A., Wewer, U., Rao, N.C., Schiffmann, E., Stracke, M.,Guirguis, R., Thorgeirsson, U., Muschel, R., and Sobel, M.(1987). Biochemical mechanisms of tumor invasion and me-tastasis. Anticancer Drug Des 2, 195–202.

Liu, K., Li, L., Nisson, P.E., Gruber, C., Jessee, J., and Cohen, S.N.1999. Reversible tumorigenesis induced by deficiency ofvasodilator-stimulated phosphoprotein. Mol Cell Biol 19,

3696–3703.Mareel, M., and Leroy, A. (2003). Clinical, cellular, and molec-

ular aspects of cancer invasion. Physiol Rev 83, 337–376.Mochizuki, Y., Nakanishi, H., Kodera, Y., Ito, S., Yamamura, Y.,

Kato, T., Hibi, K., Akiyama, S., Nakao, A., and Tatematsu, M.(2004). TNF-alpha promotes progression of peritoneal metas-tasis as demonstrated using a green fluorescence protein(GFP)-tagged human gastric cancer cell line. Clin Exp Metas-tasis 21, 39–47.

Peng, X.C., Zhang, J.W., and Wei, L. (2009). Study of expressionof VASP in gastric Carcinoma. J Yangtze University (NaturalScience Edition) 6, 20–22.

Prevost-Blondel, A., Roth, E., Rosenthal, F.M., and Pircher, H.(2000). Crucial role of TNF-alpha in CD8 T cell-mediatedelimination of 3LL-A9 Lewis lung carcinoma cells in vivo. JImmunol 164, 3645–3651.

Reinhard, M., Jouvenal, K., Tripier, D., and Walter, U. (1995).Identification, purification, and characterization of a zyxin-related protein that binds the focal adhesion and microfila-ment protein VASP (vasodilator-stimulated phosphoprotein).Proc Natl Acad Sci 92, 7956–7960.

Rosenberger, P., Khoury, J., Kong, T., Weissmuller, T., Robinson,A.M., and Colgan, S.P. (2007). Identification of vasodilator-stimulated phosphoprotein (VASP) as an HIF-regulated tissuepermeability factor during hypoxia. FASEB J 21, 2613–2621.

Schirenbeck, A., Arasada, R., Bretschneider, T., Stradal, T.E.,Schleicher, M., and Faix, J. (2006). The bundling activity ofvasodilator-stimulated phosphoprotein is required for filopo-dium formation. Proc Natl Acad Sci 103, 7694–7699.

Sechi, A.S., and Wehland, J. (2004). ENA/VASP proteins: mul-tifunctional regulators of actin cytoskeleton dynamics. FrontBiosci 9, 1294–1310.

Semenza, G.L. (2002). HIF-1 and tumor progression: patho-physiology and therapeutics. Trends Mol Med 8, 62–67.

Talks, K.L., Turley, H., Gatter, K.C., Maxwell, P.H., Pugh, C.W.,Ratcliffe, P.J., and Harris, A.L. (2000). The expression and

distribution of the hypoxia-inducible factors HIF-1alpha andHIF-2alpha in normal human tissues, cancers, and tumor-associated macrophages. Am J Pathol 157, 411–421.

van Diest, P.J., Vleugel, M.M., and van der Wall, E. (2005). Ex-pression of HIF-1 alpha in human tumours. J Clin Pathol 58,

335–336.Wielockx, B., Lannoy, K., Shapiro, S.D., Itoh, T., Itohara, S.,

Vandekerckhove, J., and Libert, C. (2001). Inhibition of matrixmetalloproteinases blocks lethal hepatitis and apoptosis in-duced by tumor necrosis factor and allows safe antitumortherapy. Nat Med 7, 1202–1208.

Wilt, S.G., Milward, E., Zhou, J.M., Nagasato, K., Patton, H.,Rusten, R., Griffin, D.E., O’Connor, M., and Dubois-Dalcq, M.(1995). In vitro evidence for a dual role of tumor necrosisfactor-alpha in human immunodeficiency virus type 1 en-cephalopathy. Ann Neurol 37, 381–394.

Witte, M., Shealy, D., Nakada, M., and Anderson, G. (2007).Tumor necrosis factor and cancer. In Cytokines in the Genesisand Treatment of Cancer. M.A. Caligiuri, and M.T Lotze, eds.(Humana Press Inc, NJ), pp. 71–89.

Yin, Y., Chen, X., and Shu, Y. (2009). Gene expression of theinvasive phenotype of TNF-alpha-treated MCF-7 cells. BiomedPharmacother 63, 421–428.

Zhang, Y., Tu, Y., Gkretsi, V., and Wu, C. (2006). Migfilin in-teracts with vasodilator-stimulated phosphoprotein (VASP)and regulates VASP localization to cell-matrix adhesions andmigration. J Biol Chem 281, 12397–12407.

Zhong, H., De Marzo, A.M., Laughner, E., Lim, M., Hilton, D.A.,Zagzag, D., Buechler, P., Isaacs, W.B., Semenza, G.L., andSimons, J.W. (1999). Overexpression of hypoxia-induciblefactor 1alpha in common human cancers and their metastases.Cancer Res 59, 5830–5835.

Zhu, N., Lalla, R., Eves, P., Brown, T.L., King, A., Kemp, E.H.,Haycock, J.W., and MacNeil, S. (2004). Melanoma cell migra-tion is upregulated by tumour necrosis factor-alpha and sup-pressed by alpha-melanocyte-stimulating hormone. Br JCancer 90, 1457–1463.

Address correspondence to:Jingwei Zhang, M.D.

Department of Tumor SurgeryZhongnan Hospital of Wuhan University

WuhanHubei 430071

P. R. China

E-mail: zhang_jingwei@yahoo.com.cn

Lei Wei, Ph.D.Department of Pathology and Pathophysiology

Laboratory of Allergy and Clinical ImmunologyInstitute of Allergy and Immune-related Diseases

Centre for Medical ResearchWuhan University School of Medicine

Wuhan UniversityWuhan

Hubei 430071P. R. China

E-mail: leiwei@whu.edu.cn

Received for publication December 5, 2011; received in re-vised form January 1, 2012; accepted January 1, 2012.

TNF-a INHIBIT VASP THROUGH HIF-1a 1087