Immunity

Article

Nuclear Factor-kB Modulates Regulatory T CellDevelopment by Directly RegulatingExpression of Foxp3 Transcription FactorMeixiao Long,1,2 Sung-Gyoo Park,1,2 Ian Strickland,1,3 Matthew S. Hayden,1 and Sankar Ghosh1,2,*1Department of Immunobiology and Molecular Biophysics & Biochemistry, Yale University School of Medicine, New Haven, CT 06520, USA2Department of Microbiology & Immunology, Columbia University, College of Physicians & Surgeons, New York, NY 10032, USA3Present address: Medimmune, Cambridge CB21 6GH, UK*Correspondence: sg2715@columbia.edu

DOI 10.1016/j.immuni.2009.09.022

SUMMARY

Naturally derived regulatory T (Treg) cells arecharacterized by stable expression of the transcrip-tion factor Foxp3 and characteristic epigeneticimprinting at the Foxp3 gene locus. Here, we foundthat enhancing nuclear factor (NF)-kB activity viaa constitutive active inhibitor of kB kinase b (IKKb)transgene in T cells led to increased number ofFoxp3+ cells in the thymus and can rescue Foxp3expression in thymocytes deficient in other pleio-tropic signaling molecules. Enhancing the signalstrength of the NF-kB pathway also induced Foxp3expression in otherwise conventionally selectedT cells. NF-kB directly promoted the transcriptionof Foxp3, and upon T cell receptor (TCR) stimulation,c-Rel, a NF-kB family member, bound to Foxp3enhancer region, which is specifically demethylatedin natural Treg cells. Hence, NF-kB signalingpathway is a key regulator of Foxp3 expressionduring natural Treg cell development.

INTRODUCTION

Regulatory T (Treg) cells play a crucial role in maintaining self-

tolerance by suppressing autoreactive T cells (Liston and

Rudensky, 2007; Sakaguchi et al., 2007). Treg cells were first

identified as CD4+CD25+ T cells, because depletion of these

cells resulted in widespread autoimmune and/or inflammatory

diseases (Sakaguchi et al., 1995). Foxp3, a forkhead transcrip-

tion factor family member, has been identified as the master

regulator for the development and function of CD4+CD25+ Treg

cells. Deficiency of Foxp3 results in the deficiency of

CD4+CD25+ Treg cells and leads to severe multiorgan autoim-

mune diseases in mice and humans (Fontenot et al., 2003; Hori

et al., 2003). Ectopic expression of Foxp3 enables both conven-

tional CD4+CD25� T cells and CD8+ T cells to exhibit similar

anergic phenotypes and acquire immunosuppressive functions

(Hori et al., 2003; Yagi et al., 2004; Zheng and Rudensky, 2007).

Naturally derived Treg cells are generated in the thymus and

are considered a unique T cell lineage characterized by their

ability to stably express Foxp3 in vivo (Sakaguchi, 2004).

I

Antigenic stimulation of conventional CD4+ T cells in vitro in

the presence of the cytokine TGF-b can also lead to Foxp3

expression and the acquisition of suppressor function in periph-

eral conventional T cells. However, these induced Treg cells

(iTreg cells) exhibited unstable phenotypes, as indicated by the

fact that most lose Foxp3 expression after restimulation with

antigen in the absence of exogenous TGF-b (Floess et al., 2007).

How Foxp3 expression is induced and regulated during

natural Treg cell development remains poorly understood. So

far, it has been established that T cell receptor (TCR) stimulation

and signals from common gamma cytokine receptors are

required for the induction of Foxp3 (Huehn et al., 2009). A

stepwise model of Treg cell development and Foxp3 expression

suggests that Treg cell precursors first undergo TCR stimulation

with a signaling intensity above a cut-off threshold that primes

these precursors to gain the ability to respond to second-step

signals, such as stimulation by cytokines or costimulatory

molecules (Liston and Rudensky, 2007). TCR activation has

been found to induce binding of transcription factors such as

NFAT, AP1, CREB, and ATF to either the Foxp3 promoter or

the intronic enhancer element in T cells (Kim and Leonard,

2007; Tone et al., 2007). Recently, three highly conserved

noncoding sequences (CNS) in the Foxp3 locus have been

identified and named CNS1 to 3 (Kim and Leonard, 2007; Tone

et al., 2007). CNS1 is in the promoter region and shows extensive

chromatin remodeling in both natural Treg cells and iTreg cells.

CNS2 and CNS3 are located in the intronic region of Foxp3.

CNS2, the TGF-b-specific enhancer, contains binding sites for

NFAT and SMADs and is involved in TGF-b-induced Foxp3

expression in iTreg cells. CNS3 contains a highly conserved

CpG-rich island that is fully demethylated only in natural Treg

cells but not in iTreg cells. The CNS3 region exhibits enhancer

activity in response to TCR stimulation alone, and transcription

factors such as CREB or ATF bind to it only when the CpG island

is demethylated. Artificially induced DNA demethylation of this

region by chemical reagents in conventional T cells or T cell lines

leads to stable FOXP3 expression and a Treg cell phenotype.

Therefore, demethylation of the CpG island in the CNS3 region

is considered a hallmark of natural Treg cells that confers the

ability to stably express Foxp3 in vivo.

The TCR signals required for Treg cell development and Foxp3

expression are different from those required for positive

selection of conventional T cells. Deficiency of several signaling

molecules downstream of TCR stimulation leads to selective

mmunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc. 921

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

impairment in Foxp3+ Treg cells whereas the development of

conventional T cells is seemingly normal or less affected. These

signaling molecules include TAK1, Bcl10, CARMA1, PKCq, and

IKK-b (Medoff et al., 2009; Gupta et al., 2008; Schmidt-Supprian

et al., 2003, 2004; Wan et al., 2006). Additionally, a mutation of

linker for activation of T cells (LAT), which selectively affects

PLC-g-binding activity, also nearly eliminated the Foxp3+

population in both the thymus and the periphery, whereas

conventional T cells still developed normally (Koonpaew et al.,

2006). Interestingly, all of these molecules are pleiotropic

signaling intermediates in TCR-induced NF-kB activation

pathways (Schmidt-Supprian et al., 2004). Therefore, we

wondered whether the NF-kB signaling pathway might have

a role in regulating Foxp3 expression and influencing natural

Treg cell development. In this paper, we report that increased

NF-kB activity led to an increased percentage and absolute

numbers of Foxp3+ cells in the thymus. These Foxp3+ cells

exhibited a demethylation pattern of the CpG island in the

CNS3 enhancer region that was characteristic of natural Treg

cells. In contrast, inhibiting NF-kB activity led to a striking

reduction in the number of thymic Treg cells. Restoring NF-kB

activity rescued Foxp3 expression in thymocytes deficient in

TAK1 and CARMA1. Selectively enhancing NF-kB pathway

signaling strength induced Foxp3 expression in otherwise

conventionally selected T cells. We also found that NF-kB

directly promoted transcription of Foxp3. c-Rel, an NF-kB family

member, bound to the CpG island in the CNS3 enhancer when it

was still methylated, whereas other generic transcription factors,

such as ATF and CREB, could occupy the binding sites within the

CpG island only when it is demethylated. Thus, our results

suggest that NF-kB signaling pathway plays an important role

in Foxp3 expression and natural Treg cell development.

RESULTS

NF-kB Activity in Thymocytes Correlates with ThymicFoxp3 ExpressionTo investigate the role of the NF-kB pathway in regulatory T cell

development and Foxp3 expression, we utilized two transgenic

mouse models in which NF-kB activity can be either enhanced

or reduced (Jimi et al., 2008; Voll et al., 2000). The IKKEE

transgenic (IKKEE-Tg) mice express a constitutively active

mutant of IKK-b kinase under the control of a proximal Lck

promoter. A second transgenic line, IkBa-SR, expresses

a mutated nondegradable IkBa by a similar strategy. We had

observed thymic atrophy and a severe decrease in the CD4

single-positive (SP) thymocytes in IKKEE-Tg mice. The pheno-

type was much more dramatic in the homozygous IKKEE-Tg

mice (which contain two copies of the transgene, as previously

described [Jimi et al., 2008]), in which the CD4 SP thymocyte

number was reduced to less than 20% of wild-type mice and

peripheral mature CD4 cells were nearly completely absent.

The heterozygous IKKEE-Tg mice showed approximately 50%

reduction in the number of both thymic and splenic CD4 SP

cell populations (Jimi et al., 2008).

We examined the thymic development of Treg cells in both

IKKEE and IkBa-SR transgenic mice by intracellular staining of

Foxp3+ cells. In both homozygous and heterozygous IKKEE-Tg

mice, the Foxp3+ population in the CD4 SP thymocytes was

922 Immunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc.

approximately 20% compared to approximately 4% in wild-type

mice (Figures 1A and 1B). Considering the reduction of CD4 SP

thymocyte numbers in heterozygous IKKEE-Tg mice, there was

still a more than 2-fold increase in absolute numbers of Foxp3+

CD4 SP thymocytes (Figure 1B; Jimi et al., 2008). In contrast,

IkBa-SR mice showed an approximately 50% reduction in

both percentage and absolute numbers of Foxp3+ CD4 SP

thymocytes (Figures 1A and 1B). We also found that in IKKEE

transgenic mice, approximately 8% of CD8 SP thymocytes ex-

pressed Foxp3 (Figure 1A). Overnight in vitro stimulation with

IL-7 induced Foxp3 expression in wild-type CD8 SP thymocytes,

but not in IkBa-SR transgenic CD8 SP thymocytes (Figure 1A;

Figure S8 available online). In the spleen of IKKEE-Tg mice, the

percentage of Foxp3+ CD4 cells was increased to approximately

30%–50% (Figures 1C and 1D). Most thymic Foxp3+ cells in

IKKEE-Tg mice did not express CD25, although CD25 expres-

sion in Foxp3+ cells increased in the periphery (Figures 1A and

1C). Thus, although the NF-kB pathway positively regulates

Foxp3 expression, it does not appear to control the development

of other features of natural Treg cells such as CD25 expression.

Enhancing NF-kB Signal Rescues Thymic Foxp3Expression in TAK1- or CARMA1-Deficient MiceGenetic deficiencies of several pleiotropic signaling molecules

were found to severely impair the development of Foxp3+ Treg

cells, whereas the development of conventional T cells was

relatively unaffected or less affected. Among them, PKCq,

CARMA1, Bcl10, and TAK1 are closely related signaling mole-

cules and contribute to antigen receptor-mediated activation

of NF-kB (Rawlings et al., 2006; Schulze-Luehrmann and Ghosh,

2006). A LAT mutation that selectively impairs PLC-g-binding

activity also impairs NF-kB activation via PLC-g1-PKC pathway

(Koonpaew et al., 2006). However, in addition to the NF-kB

pathway, these molecules also contribute to the activation of

other signaling pathways, such as the JNK and NFAT pathway.

To test whether impaired Treg cell development caused by

deficiency in these pleiotropic molecules is indeed mediated

by defective NF-kB activity, we crossed IKKEE-Tg mice to

CARMA1-deicient (Card11�/�) mice or T cell-specific TAK1

conditional-deficient (Lck-Cre-Map3k7fl/fl and Cd4-Cre-

Map3k7fl/fl) mice. As previously reported, we found that the

TAK1 conditional deficiency, generated by expressing Cre

through Lck or Cd4 promoter, led to the complete absence of

Foxp3 expression in thymocytes (Figure 2A). However, constitu-

tive NF-kB activity delivered by the IKKEE transgene completely

rescued Foxp3 expression in TAK1-deficient thymocytes to

an amount similar to that of IKKEE transgenic thymocytes

expressing wild-type TAK1 (Figure 2A). Similar to TAK1 wild-type

IKKEE-Tg mice, there were also a substantial proportion of

Foxp3+ cells in CD8 SP thymocytes from TAK1-deficient

IKKEE-Tg mice (Figure 2A). Restoring the NF-kB pathway,

however, did not rescue the survival and/or proliferation

deficiency of thymocytes (as shown by the fact that peripheral

T cell numbers remained dramatically reduced in IKKEE-Tg

Cd4-Cre-Map3k7fl/fl mice) to an amount similar to that of Cd4-

Cre-Map3k7fl/fl mice without the IKKEE transgene (Figure 2B).

In Card11�/� mice, the IKKEE transgene again rescued Foxp3

expression in single-positive thymocytes (Figure 2C). Foxp3

expression was also restored in the splenocytes from IKKEE-Tg

9.02 1.68

15.67

0.081 6.27e-3

7.529

1.75 0.6

13.79

WT IkB-SR TgIKKEE-Tg (HET)

Foxp3

CD25

CD4 SPthymocyte

WT+IL7

IkB-SR Tg+ IL7

IKKEE-Tg (HET)no stimulation

CD8 SPthymocyte

18.2 2.66

3.45

0.61 1.72

1.42

1.77 3.25

IKKEE-HOMO

IKKEE-HET

WT

IkB-SRTg

Spleen

Foxp3+cellsinCD4SP

thymocytes(%)

IKKEE-HOMO

IKKEE- HET

WTIkB-SR

Tg

Thymus

WT

IKKEE-HOMO

IKKEE-HET

IkB-SRTg

CD4+Foxp3+cells(X106 )

IKKEE-HOMO

IKKEE-HET

WTIkB-SR

Tg

AA BB

CC DD

Foxp3+cellsinCD4SP

thymocytes(%)

CD4+Foxp3+cells(X106 ) Thymus

Spleen

WT IkB-SR TgIKKEE-Tg (HET)

Foxp3

CD25

CD4+splenocyte

15.2 14.4

9.67

7.82 0.16

0.85

1.65 11.1

2.44

0.031 0.037

2.2

6.19 14.2

1.79

0 0

0.26

CD8+splenocyte

0

4

8

12

16

20

24

28

0.0

0.2

0.4

0.6

0.8

1.0

0

20

40

60

0

1

2

3

4

Figure 1. Activity of NF-kB Pathway Is

Correlated with Foxp3 Expression in

Thymus

(A) Foxp3 expression of thymocytes from wild-

type (WT), IKKEE, and IkBa-SR transgenic mice

were analyzed by flow cytometry. The WT and

IkBa-SR CD8 SP thymocytes were stimulated

in vitro with IL-7 overnight before analysis, and

other cells were analyzed directly after isolation

from mice. Numbers in quadrant indicate

percentage.

(B) The average percentage and absolute number

of Foxp3-expressing cells of CD4 SP thymocytes

are shown in the histogram. Graphs show

mean ± SD; n = 3 (IKKEE HET), 4 (WT), or 2 (IKB-SR

and IKKEE HOMO).

(C) Splenocytes from WT, IKKEE, and IkBa-SR

transgenic mice were analyzed by flow cytometry.

Numbers in quadrant indicate percentage.

(D) The average percentage and absolute number

of Foxp3-expressing cells of CD4+ splenocytes

are shown in the histogram. Graphs show

mean ± SD; n = 3 (IKKEE-HET), 4 (WT), or 2

(IKB-SR and IKKEE-HOMO). IKKEE-homo,

homozygous IKKEE-Tg mice; IKKEE-HET, hetero-

zygous IKKEE-Tg mice; IKB-SR, IkBa-SR

transgenic mice.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

Card11�/�mice (Figure 2C). Our data therefore strongly suggest

that NF-kB deficiency is responsible for impaired thymic Foxp3

expression and Treg cell development caused by a deficiency

of pleiotropic signaling molecules such as CARMA1 or TAK1.

Increasing NF-kB Signal Induced Foxp3 Expressionin Otherwise Conventionally Selected ThymocytesIt has been proposed earlier that a unique TCR signaling pattern,

different from that required for positive selection of conventional

T cells, was required for Treg cell development and Foxp3

expression. In TCR (non-self-reactive) transgenic mice deficient

in RAG1 or RAG2, which express the transgenic TCR only

because of defective recombination of endogenous TCR chains,

only conventional T cells were selected and there were no

CD4+CD25+ Treg cells in the thymus and periphery because

there were no high-affinity ligands available in the thymus for

the transgenic TCR to provide the signal needed for selection

of Treg cells (Thorstenson and Khoruts, 2001). We crossed

Immunity 31, 921–931, D

IKKEE-Tg mice to MHC class II-restricted

TCR (OT-II) and MHC class I-restricted

TCR (P14) transgenic mice that were

also deficient in RAG1 to investigate

whether selectively enhancing the NF-kB

pathway is enough to induce Foxp3

expression in otherwise conventionally

selected thymocytes. We found that in

Rag1�/� OT-II TCR transgenic mice,

there were no Foxp3+ cells in the thymo-

cytes (Figure 3A, top). The IKKEE

transgene, however, induced Foxp3

expression in the CD4 SP thymocyte

compartment of Rag1�/� OT-II TCR

transgenic mice (Figure 3A, top). Foxp3-

expressing cells were also detectable in the spleen and lymph

nodes of Rag1�/� OT-II TCR Tg mice (Figure 3A, bottom and

data not shown). We think that these Foxp3+ cells were gener-

ated by peripheral conversion, because it has been reported

that CD4+CD25+ Treg cells can be induced from peripheral

CD25�CD4+ T cells in RAG-deficient TCR transgenic mice

(Thorstenson and Khoruts, 2001). The IKKEE transgene cannot

bypass the requirement for basal TCR signals to induce Foxp3

expression because no Foxp3 expression was detected in the

thymus of Rag1�/� mice bearing the IKKEE transgene but not

OT-II TCR transgene (Figure S6).

In the P14-TCR Tg Rag1�/� mice, we detected no Foxp3-ex-

pressing cells in either thymus or spleen (Figure 3B, right top

and bottom). However, enhancing NF-kB activity with the IKKEE

transgene led to Foxp3 expression in a fraction of CD8 SP

thymocytes and peripheral mature CD8+ T cells (Figure 3B, left

top and bottom). After ex vivo stimulation with IL2 and IL-7,

no CD8 SP thymocytes expressing Foxp3 was detected in

ecember 18, 2009 ª2009 Elsevier Inc. 923

0.21 0

4.87

4.73 0.13

4.3

0.097 0.055

3.53

17.2 1.02

1.968

14.4 2.48

3.48

0.23 0.054

3.55

6.2 0.75

7.14

0 0

5.65

CD25

Foxp3

Map3k7fl/fl

CD4-Cre

Map3k7fl/fl

Lck-Cre

IKKEE-Tg WTCD8 SP thymocytesCD4 SP thymocytes

IKKEE-Tg WT

0.27 0

0.95

0.51 0.055

1.89

4.02 0.15

1.85

11.8 0.73

2.22

0 0

0.14

0.88 0.16

0.46

1.72 0.015

0.21

12.2 2.8

6.73

CD25

Foxp3

CD4+splenocytes

CD8+splenocytes

CD8 SPthymocytes

C4 SPthymocytes

IKKEE-Tg WT

CD25CD8

Foxp3

CD4

A

B

C Card11-/-

Map3k7fl/fl / CD4-Cre

Total splenocytes CD4+ splenocytes

IKKEE-Tg

WT

28.9 11.4

11.2

1.07 0.11

0.84

0.94 3.23

9.47

2.32 0.082

1.71

Figure 2. Restoring NF-kB Activity Rescues Foxp3 Expression in Thymocytes Deficient of TAK1 and CARMA1

(A and B) Thymocytes (A) or splenocytes (B) from Cd4-Cre-Map3k7fl/fl or Lck-Cre-Map3k7fl/fl mice with or without IKKEE transgene were analyzed for Foxp3

expression by flow cytometry. Numbers in quadrant indicate percentage. Data shown are representative of three independent experiments.

(C) Thymocytes or splenocytes from CARMA1-deficient (Card11�/�) mice with or without IKKEE transgene were analyzed by flow cytometry for Foxp3

expression. Numbers in quadrant indicate percentage. Data shown are representative of two independent experiments.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

P14-TCR Tg Rag1�/� mice. In contrast, in the presence of the

IKKEE transgene, approximately 10% of P14-TCR Tg Rag1�/�

CD8 SP thymocytes were induced to express Foxp3

(Figure 3B, middle). These results suggested that elevated

NF-kB activity could be the crucial difference in TCR

signaling events that determine conventional versus Treg cell

development.

Foxp3+ T Cells from IKKEE Transgenic Mice Are NotGenerated by Peripheral ConversionAn alternative explanation for the increased Foxp3+ cell

percentage in the thymus of IKKEE transgenic mice could be

that these Foxp3+ cells were actually generated from peripheral

expansion or conversion of conventional T cells, which later

migrated back to the thymus.

To test this possibility, we crossed IKKEE-Tg mice to

Foxp3-RFP knockin mice in which Foxp3-expressing cells

were marked with RFP expression. We sorted the peripheral

CD4+Foxp3+ versus CD4+Foxp3� cells by the criteria of RFP

expression and adoptively transferred each group of cells into

Rag1�/� recipient mice. The spleens of recipient mice were

harvested 1 month later. We found that IKKEE-Tg CD4+Foxp3�

T cells did not spontaneously convert to Foxp3+ cells in the

recipient (Figure 4A), nor did they selectively accumulate in the

thymus and convert to Foxp3+ cells (Figure S7). Additionally,

the CD4+Foxp3� T cells bearing an IKKEE transgene expanded

924 Immunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc.

to a much lesser extent in the Rag1�/� recipient compared to

wild-type counterparts (Figure 4A; Figure S3). We also did not

observe excessive proliferation of IKKEE-Tg CD4+Foxp3+

T cells. Instead, they were almost undetectable 1 month after

transfer, although they maintained Foxp3 expression to a similar-

extent as did wild-type counterparts (Figure 4A). Transferred

peripheral IKKEE-Tg Foxp3� did not migrate back to thymus,

either (Figure S7). Therefore, increased Foxp3+ cell percentage

in IKKEE-Tg thymocytes was most probably due to increased

thymic output, rather than peripheral conversion or expansion.

Furthermore, to exclude the possibility that the NF-kB

pathway selectively promotes the expansion or survival of

Foxp3+ thymocytes, we performed a BrdU incorporation assay

and annexin V staining on Foxp3+ and Foxp3� thymocyte

populations from IKKEE-Tg mice and wild-type mice. We did

not observe excessive proliferation or reduced apoptosis of

IKKEE Tg CD4+Foxp3+ cell thymocytes or of CD4+CD25+Foxp3�

cells (which contains the putative immediate thymic Treg cell

precursors) in the IKKEE-Tg mice (Figures S4 and S5). Thus,

the increase of thymic Foxp3+ cells observed in IKKEE-Tg

mice was not caused by increased proliferation or survival.

IKKEE Transgene Induces Characteristic EpigeneticImprinting Pattern of Natural Treg Cells in Foxp3 LocusNatural Treg cells are considered to be a separate T cell lineage

and maintain Foxp3 expression throughout their lifespan in vivo

0 0.088

2.37

2.38 0.15

12.6

0 0

42.7

11.9 0.78

9.87

4.21 0.033

24.6

0 0.12

9.39

Foxp3

Rag1-/-

P14 TgCD8+ thymocytes

Rag1-/ -

P14 TgCD8+ thymocytes+IL7, IL2

CD25

B

Rag1-/-

P14 TgCD8+ splenocytes

IKKEE-Tg

CD25

WT

Rag1-/ -

OTII TgCD4+ thymocytes

Foxp3

A

Rag1-/ -

OTII TgCD4+ splenocytes

3.12 3.69

5.65

8.46 4.26

14.3

23.3 0.33

5.76

0.16 0.078

21.2

IKKEE-Tg WT

Figure 3. Enhancing NF-kB Activity Leads to Foxp3 Expression in

Otherwise Positively Selected Conventional T Cells

(A) Thymocytes or splenocytes from Rag1�/� OTII-TCR transgenic mice with

or without IKKEE transgene were analyzed by flow cytometry for Foxp3

expression. Numbers in quadrant indicate percentage. Data shown are

representative of four independent experiments.

(B) Thymocytes or splenocytes from Rag1�/�P14-TCR transgenic mice with or

without IKKEE transgene were analyzed by flow cytometry for Foxp3 expres-

sion. In the middle panel, thymocytes were treated with IL-7 and IL-2 overnight

before analysis. Numbers in quadrant indicate percentage. Data shown are

representative of two independent experiments.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

in an IL-2- and TGF-b-dependent (low-level) manner. A highly

conserved CpG-rich region has been found in the CNS3 intronic

enhancer region of Foxp3 locus. In natural Treg cells, this CpG

island was found to be fully demethylated, whereas in conven-

tional T cells and even TGF-b-induced Treg cells, it remained

fully methylated (Kim and Leonard, 2007). Several lines of

evidence suggested that demethylation of this CpG island in

the CNS3 enhancer region corresponds with the stability of

Foxp3 expression in natural Treg cells. To test the methylation

status of the CNS3 region in Treg cells induced in IKKEE mice,

we again sorted Foxp3+ cells from both IKKEE-Tg mice and

wild-type mice and performed bisulfite sequencing analysis as

described previously (Kim and Leonard, 2007). We found that

I

in IKKEE-Tg Foxp3+ CD4 cells, the CNS3 enhancer CpG island

was fully demethylated, similar to wild-type Treg cells, whereas

the CNS3 enhancer CpG island in Foxp3� CD4+ T cells from

IKKEE-Tg mice remained fully methylated (Figure 4B). Therefore,

increased NF-kB activity in IKKEE-Tg mice increased Foxp3

expression in thymocytes by promoting the characteristic

demethylation of the CpG-rich region within the CNS3 enhancer

that is a hallmark of natural Treg cells. These IKK-Tg Foxp3+

cells, however, were not as suppressive when measured by

in vitro suppression assay (Figure S2), which indicated that

excessive NF-kB activity might be detrimental to the suppressive

function of Treg cells.

Increased NF-kB Activity Did Not Enhance Common-g

Cytokine SensitivityCommon gamma cytokines, primarily IL-2 and IL-7, also play

an indispensable role in natural Treg cell development as evi-

denced by the fact that common cytokine receptor g chain (gc)

deficiency leads to the complete disappearance of Treg cells

in mice. JAK and STAT5 signaling pathways, which are acti-

vated by common gamma cytokines, have also been found to

be essential for Foxp3 expression and Treg cell development.

The NF-kB pathway has been found to be involved in the

induction of components of common gamma receptors in

lymphocytes (Bellavia et al., 2000; Vallabhapurapu et al.,

2008). Therefore, increased NF-kB pathway signals may

promote Foxp3 expression in developing thymocytes via

increasing the gc receptor expression and sensitivity. Both IL-2

and IL-7 have been reported to induce Foxp3 expression in

thymic CD4+CD25hiFoxp3� Treg cell precursors (Burchill et al.,

2008). Therefore, we checked the expression of IL-2Ra,

IL-2Rb, and IL-7Ra by flow cytometry in thymocytes. In

IKKEE-Tg mice, these receptors were not increased in DN, DP,

CD4 SP, or CD8 SP thymocyte compartments (Figure 5A). We

further fractionated the CD4+ and CD8+ SP thymocytes from

IKKEE-Tg mice into Foxp3+ and Foxp3� subpopulations but

did not note increased expression of gc receptors in either of

these groups. In fact, there was a substantial reduction in the

CD25 (IL-2Ra)+ CD122 (IL-2Rb)+ double-positive population in

IKKEE-Tg mice.

Recently, it has been reported that Treg cells not only express

high amount of IL-2 receptors, but also have a lower threshold for

IL-2 signaling (Yu et al., 2009). It has also been found that TCR

signaling can modulate STAT5 phosphorylation and common

gamma cytokine signaling (Welte et al., 1999). Therefore,

although enhanced NF-kB signaling did not increase the expres-

sion of a gc receptor, it could directly lower the threshold for

common cytokine signaling. To test this possibility, we examined

the STAT5 phosphorylation status in thymocytes in response

to IL-2 or IL-7 stimulation. We found that thymocytes from

IKKEE-Tg mice did not show spontaneous STAT5 phosphoryla-

tion in vivo (Figure 5B). Within the CD4 SP thymocyte compart-

ment, the CD25+CD122+, CD25�CD122+, and CD25�CD122�

subpopulations also showed a similar response to IL-2 in

IKKEE-Tg mice compared to wild-type mice (Figure 5C).

Therefore, our data suggest that enhanced NF-kB signaling

intensity does not promote Foxp3 expression through increasing

common gamma chain cytokine signaling.

mmunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc. 925

33.9 6.14

5.65

0.43 0.13

4.93

24.8 12.8

1.71

0.66 0.96

10.6

Foxp3

0.013 0.74 0.19 2.14

TCRb

IKKEE Foxp3+ IKKEE Foxp3-A

B

IKKEE-Tg WT

Foxp3+

Foxp3-

WT Foxp3+ WT Foxp3-

CD4

CD25

Figure 4. IKKEE-Tg Foxp3+ Cells Are Not Generated from

Peripheral Conversion and Mimic Natural Treg Cell

Epigenetically

(A) IKKEE-Tg versus wild-type (WT) mice were crossed to Foxp3-RFP

knockin mice. CD4+Foxp3+ RFP+ versus CD4+Foxp3� T cells were

sorted from IKKEE-Tg or WT mice and were then adoptively transferred

into Rag1�/� mice. Splenocytes were harvested 4 weeks later from

recipient mice. Representative flow cytometry plots showed frequency

of TCRb+CD4+ donor population of total splenocytes and percentage

of Foxp3 expression of TCRb+CD4+ donor cells. Numbers in quadrant

indicate percentage. Data shown are representative of two indepen-

dent experiments (totally at least four recipient mice in each group).

(B) CD4+Foxp3+ RFP+ versus CD4+Foxp3� T cells were sorted from

IKKEE-Tg or WT mice and then were subjected to bisulfite mutation

analysis. Methylation status of nine CpG sites (indicated by the

number at the top of the plot, as described in Kim and Leonard

[2007]) on the CpG island in Foxp3 CNS3 enhancer region were

analyzed. Open circle, demethylated CpG site; filled circle, methyl-

ated CpG site. Data shown are from two independent experiments.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

The NF-kB Pathway Directly Regulates Foxp3TranscriptionWe next investigated whether the NF-kB signaling pathway

could directly regulate Foxp3 gene transcription. Sequence

analysis has revealed three CNSs in the Foxp3 locus

(Figure 6A). CNS1 corresponds to the promoter region, CNS2

is the intronic enhancer that contains the TGF-b-responsive

element, and CNS3 is the TCR-responsive enhancer that

contains a highly conserved CpG-rich region and binding sites

for multiple transcription factors, such as CREB and ATF (Kim

and Leonard, 2007; Tone et al., 2007). In T cells, a reporter

construct with the promoter alone showed only minimal activity

upon TCR stimulation. A reporter construct with the promoter

region plus CNS3 responded strongly to TCR stimulation

in a demethylation-dependent manner, whereas a reporter

construct containing the promoter region plus CNS2

responded to TCR stimulation only in the presence of TGF-b.

To investigate the effect of the NF-kB pathway on Foxp3

expression, we utilized the reporter construct containing the

CNS3 and promoter region, which responds to TCR stimula-

tion. We cotransfected Jurkat T cells with the reporter

construct and either an IkBa-SR expression construct to

suppress the NF-kB pathway or an IKKEE expression construct

to enhance the NF-kB signal. The transfected Jurkat cells were

then stimulated with PMA and ionomycin for 17 hr. Cotransfec-

tion with IkBa-SR markedly reduced reporter activity after PMA

and ionomycin stimulation whereas cotransfection with IKKEE

constructs markedly induced the reporter activity even without

PMA and ionomycin stimulation (Figure 6B). We also found that

PMA and ionomycin and cotransfection of IKKEE can activate

the reporter construct by acting on the Foxp3 promoter

alone (Figure S1), indicating that the NF-kB-responsive element

for acute transcription of the Foxp3 gene is located in the

promoter region.

926 Immunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc.

f

l

,

l

,

l

,

r

Next we examined whether NF-kB family transcription

factors can directly bind to the regulatory regions of the

Foxp3 gene by chromatin immunoprecipitation (ChIP).

Analysis of the sequence revealed several potential

NF-kB sites in the Foxp3 locus. Three of these sites

were in the CNS3 enhancer region, located within approximately

500 bp, and were named kb1, kb2, and kb3 (Figure 6A). Addi-

tionally, two adjacent NF-kB binding sites were also identified

in the promoter region. We stimulated the Jurkat T cells with

PMA and ionomycin for 3 hr and used an antibody against p65

or c-Rel for chromatin IP. We found that c-Rel binding to the

kb1 site within the CNS3 enhancer region was dramatically

induced after PMA and ionomycin stimulation; the binding o

promoter sites by c-Rel was also induced to approximately

7-fold after stimulation (Figure 6C). We also found that c-Re

can bind to the Foxp3 promoter and kb1 site in the CNS3

enhancer of primary mouse CD4+ T cells (Figure 6D). This

binding pattern was similar to what we observed in Jurkat cells

albeit less dramatic. However, we did not detect a substantia

increase in p65 binding in any of these sites, which indicates

that c-Rel might function as a c-Rel-p50, but not c-Rel-p65

dimer. Additionally, we assayed c-Rel binding of the Foxp3

enhancer in 293 cells, a non-T cell line, and DPK cells, a DP

thymocyte cell line, and found that c-Rel did not bind to the

kb1 site or Foxp3 promoter in these cells (Figure 6E and data

not shown). Thus, the ability of c-Rel to bind to the methylated

CpG island in the CNS3 enhancer in T cells developed beyond

DP stage makes it a candidate for being the pioneer transcrip-

tion factor that initiates chromatin remodeling that is character-

istic of natural Treg cells.

DISCUSSION

Here, we have provided evidence that the NF-kB signaling

pathway plays a crucial role in regulating Foxp3 expression

during thymic Treg cell development. Deficiency of severa

pleiotropic signaling molecules, including TAK1, Bcl10

CARMA1, PKCq, and LAT, has been found to cause severely

impaired Treg cell development, whereas it does not affect, o

CD4SP CD8 SP DN DP

IL7

IL2

Beforetreatment

Blue line: WTRed line: IKKEE-Tg

B

IKKEE-Tg

WT

CD122(IL-2Rb)

CD25(IL2Ra)

Red line:IKKEE-Tg thymocytesBlue line:Wild-type thymocytes

A

0.39

0.72

92.8

1.35

2.41

pSTAT5CD25

CD122

IKKEE-Tg

WT

Red line:CD122+CD25+Blue line:CD122+CD25-Green line:CD122-CD25-

C

79.9 0.34

0.23

82.3 10.6

1.42

12.9 0.41

0.56

21.9 46.8

4.71

0.68 0.021

0.28

9.45 0.94

34.2

11.6 15.8

2.77

2.64 0.21

0.51

44.7 0.4

0.4

35.6 0.22

0.29

0.1 7.39e-3

0.34

6.3 0.55

41.6

DN DP CD4+Foxp3+ CD4+Foxp3- CD8+Foxp3+ CD8+Foxp3-

CD4+CD25+Foxp3-

CD127 (IL-7Ra)

pSTAT5

Figure 5. NF-kB Pathway Does Not Induce Foxp3 Expression by Increasing Sensitivity to Common Gamma Cytokines

(A) Flow cytometry analysis of CD127 (IL-7Ra), CD122 (IL-2Rb), and CD25 (IL-2Ra) expression in different thymocyte populations from IKKEE-Tg and wild-type B6

mice. All mice were crossed to Foxp3-GFP knockin mice and Foxp3 expression was identified by GFP expression. Numbers in quadrant indicate percentage.

Data shown are representative of three independent experiments.

(B) STAT5 phosphorylation in different thymocyte populations from IKKEE-Tg versus wild-type B6 mice. Thymoyctes were analyzed either directly after isolation

or after 30 min of IL2 (5 ng/ml) or IL7 (2 ng/ml) treatment. Data shown are representative of two independent experiments.

(C) IL-2-stimulated STAT5 phosphorylation in CD4 SP thymocyte subpopulations expressing both of CD122 and CD25, CD122 only, or neither CD122 and CD25.

Numbers in the left panel indicate percentage. Data shown are representative of two independent experiments.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

affects to a lesser extent, conventional T cell development

(Medoff et al., 2009; Gupta et al., 2008; Koonpaew et al., 2006;

Schmidt-Supprian et al., 2004; Wan et al., 2006). Signaling

events mediated by these molecules, therefore, could be specif-

ically required for natural Treg cell development. Interestingly,

most of these signaling molecules are linked to TCR-induced

NF-kB activation. We found that restoring NF-kB activity with

the IKKEE transgene can rescue Foxp3 expression in TAK1- or

CARMA1-deficient thymocytes that otherwise showed the

most dramatic impairment in Treg cell development. It is

possible that deficiency of NF-kB signaling may be the common

mechanism underlying impaired Foxp3 expression caused by

I

deficiency of all of the aforementioned pleiotropic signaling

molecules. We previously reported that CD4 SP thymocytes,

most of which would mature into conventional T cells, exhibited

weaker NF-kB activity compared to other thymic subpopula-

tions. Therefore, a stronger NF-kB pathway signal could be the

unique signaling event that is specifically required for Foxp3

expression and thymic Treg cell development. To further test

this hypothesis, we studied Rag1�/� TCR transgenic mice. In

these mice, thymocytes express only one type of TCR and are

uniformly selected into conventional T cells, which indicates

that Foxp3 expression and Treg cell development require TCR

signaling that is different from positive selection of conventional

mmunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc. 927

A

B C D E

Figure 6. NF-kB Can Directly Regulate Foxp3 Gene Expression

(A) Schematic representation of Foxp3 promoter region (CNS1) and enhancer region (CNS3). Bottom: the CpG island within CNS3 region and three potential

NF-kB binding sites around that region.

(B) Luciferase assay with reporter plasmids containing Foxp3 promoter fragment (CNS1) and intronic enhancer fragment (CNS3) in Jurkat cells. Expression

plasmids of IKKEE or IkBa-SR were cotransfected as indicated. Cells were either unstimulated or stimulated with PMA and ionomycin (PI) for 17 hr before

analysis. Graphs show mean ± SD. n = 3, data are representative of two independent experiments.

(C) Chromatin IP analysis of c-Rel binding in the Foxp3 promoter and enhancer region in unstimulated or PMA and ionomycin-stimulated Jurkat cells. One poten-

tial NF-kB binding site in the promoter region and three potential binding sites in CNS3 enhancer region (kb1–3) were analyzed. Graphs show mean ± SD. n = 3,

data are representative of two independent experiments.

(D) Chromatin IP analysis of c-Rel binding in the Foxp3 promoter and enhancer region in unstimulated or PMA and ionomycin-stimulated primary mouse CD4+

T cells. Graphs show mean ± SD. n = 3, one independent experiment.

(E) Chromatin IP analysis of c-Rel binding in the Foxp3 promoter and enhancer region in unstimulated or PMA and ionomycin-stimulated HEK293 cells. The kb1

site specific primers were used for analysis. Graphs show mean ± SD. n = 3, data are representative of two independent experiments.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

T cells. We found that Foxp3 expression could be induced in

these ‘‘one-conventional TCR only’’ thymocytes by enhancing

NF-kB activity through introducing an IKKEE transgene. Again,

our data support the notion that a stronger NF-kB signal is the

difference in TCR signaling that is uniquely required for Foxp3

expression during thymic T cell development.

928 Immunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc.

How TCR-triggered signaling events affect the fate decision of

developing thymocytes is under intense investigation. In all of

the suggested models, TCR signaling strength plays a key role:

low-affinity TCR engagement leads to positive selection of

conventional T cells, whereas high-affinity engagement triggers

negative selection. Treg cell development, however, may require

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

an intermediate TCR signaling strength. Different TCR

downstream signaling pathways have also been found to play

distinct roles in positive and negative selection. Impaired

calcineurin and ERK activity specifically affect positive selection

(Fischer et al., 2005; Neilson et al., 2004), whereas the JNK and

p38 MAPK pathways are involved in negative selection (Gong

et al., 2001). Therefore, the preferential enhancement of certain

TCR signaling pathways may also play an important role in

thymocyte fate decision. Our findings suggest that the signal

strength of the NF-kB pathway (i.e., selectively enhanced by

the heterozygous IKKEE transgene) sets a threshold for thymo-

cyte fate decision. This signal, of proper intensity, in addition to

TCR signaling typical of positive selection, is required for

Foxp3 expression induction and natural Treg cell development.

Studies in IKKb- and c-Rel-p50-deficient mice all pointed to

the particular importance of the NF-kB pathway in Treg cell

development. However, the NF-kB pathway is also crucial for

IL-2 production (Lai et al., 1995; Schmidt-Supprian et al.,

2003). Therefore, the observed deficiency in Treg cell develop-

ment could be attributed to the impaired IL-2 production by

conventional T cells rather than a cell-intrinsic effect in differen-

tiating Treg precursor cells. We think that the former explanation

is unlikely. First, there is redundancy in the effect of common

gamma cytokines in thymic Treg cell development. IL-2

deficiency alone reduced, but did not completely ablate, thymic

Foxp3+ cells (Fontenot et al., 2005). Additionally, the complete

disappearance of thymic Treg cells in CARMA1 and TAK1

deficiencies, which could be rescued by restoring NF-kB

activity, cannot be explained by IL-2 deficiency. Second, the

IKKEE transgene rescued Foxp3 expression in TAK1 conditional

deficiency, but it did not rescue the impaired maturation of SP

thymocytes into peripheral T cells, which are a major source of

IL-2. Furthermore, Rag1�/� TCR transgenic mice have no thymic

Treg cells but the production of IL-2 by conventional T cells is

normal. Selectively increasing the NF-kB signal restored Foxp3

expression of thymocytes in these mice, which suggests that

the NF-kB pathway plays a crucial cell-intrinsic role in the induc-

tion of Foxp3 expression during thymic Treg cell development.

The Foxp3+ cells in our IKKEE-Tg mice did not express CD25

and exhibited poor peripheral homeostatic proliferation and

survival when compared to wild-type Treg cells. However, they

did gain the ability to stably express Foxp3 and showed the

unique DNA demethylation of the CpG island within the CNS3

enhancer, which is a hallmark of natural Treg cells (Kim and

Leonard, 2007). Therefore, our data suggest that although the

NF-kB pathway is crucial for induction of Foxp3 expression, it

does not account for other aspects of Treg cell development.

Other signals, such as stimulation from common gamma

cytokines, might be responsible for these Foxp3-independent

features of natural Treg cells, and limiting the availability of these

signals might explain why the majority of Foxp3+ thymocytes in

IKKEE-Tg mice did not express CD25. We also found that

IKKEE-Tg Foxp3+ cells were not as suppressive when measured

by in vitro suppression assay (Figure S2). It has been reported that

in vitro engagement of CD28, together with TCR stimulation,

abrogates the suppressor function of natural Treg cells in the clas-

sical in vitro suppression assay system that we used (Sakaguchi,

2004;Takahashi et al., 1998). Work from our laboratory and others

have established that CD28 is an important cofactor for

I

enhancing NF-kB signaling during TCR ligation. Therefore, we

speculate that increased NF-kB activity may have abrogated

in vitro suppression capacity in our IKK-Tg Foxp3 Treg cells.

We found that c-Rel bound to the Foxp3 promoter and CNS3

enhancer region after TCR stimulation. Interestingly, the c-Rel

binding site in the CNS3 enhancer was located within a CpG-rich

region that remains methylated in the Jurkat T cells that we

studied. Other generic transcription factors that have binding

sites in the same region, such as CREB and ATF, only bind after

the CpG island is demethylated (Kim and Leonard, 2007). c-Rel

has been found to play an essential role in initiating chromatin

remodeling in IL-2 promoter in primary CD4+ T cells (McKarns

and Schwartz, 2008; Rao et al., 2003). Interestingly, it has been

reported that rapid demethylation of the CpG sites in the

promoter region occurred after T cell activation both in vitro

and in vivo, which can, in turn, affect the transcriptional expres-

sion of IL-2 (Bruniquel and Schwartz, 2003; Thomas et al., 2005).

It is thus likely that in both the IL-2 promoter and the CNS3

enhancer of Foxp3, c-Rel plays a role in recruiting chromatin-

modifying complexes to the regulatory sequences and

stabilizing an open chromatin conformation, further facilitating

the recruitment of enzymes responsible for CpG demethylation.

Additionally, in the thymus, c-Rel expression was found to be

very low in the preselected CD4+CD8+ DP thymocytes but was

strongly induced after positive selection (Moore et al., 1995).

Consistent with this finding, we observed that c-Rel cannot

bind to the CNS3 enhancer region in DPK cells, a DP thymocyte

cell line. Therefore, we speculate that c-Rel could act as

a pioneer transcription factor that initiates chromatin remodeling,

thus facilitating DNA methylation of the Foxp3 locus. This

process likely takes place during the CD4+ SP thymocyte stage,

shortly before the appearance of Foxp3+ thymocytes in the CD4+

SP compartment.

In summary, our results suggest that the NF-kB pathway is

a key regulator of Foxp3 induction during thymic Treg cell

development, and preferential increase in NF-kB activity

promotes Foxp3 expression and Treg cell lineage differentiation.

Such preferential increase in NF-kB activity could be achieved

by complementing TCR stimulation by a combination of signals

from certain costimulatory molecules and cytokines, such as

CD28, CD27, and TNF-a (Watts, 2005). Thus, the NF-kB pathway

may also be a sensor of peripheral inflammatory events. An

excessive inflammatory response may enhance NF-kB

activation in thymocytes via production of cytokines such as

TNF-a. This, together with an increased production of IL-2,

which is an indicator of T cell response, could favor Treg cell

development over conventional T cell development as well as

promote negative selection of conventional T cells. Therefore,

the NF-kB pathway may play a crucial role in shifting thymic

output from conventional T cells to regulatory T cells during an

excessive inflammatory response.

EXPERIMENTAL PROCEDURES

Mice

The IKKEE-Tg, IkBaSR-Tg, Map3k7fl/fl, Card11�/�, and the Foxp3-RFP

reporter (FIR) mice have been described previously (Egawa et al., 2003; Jimi

et al., 2008; Voll et al., 2000; Wan et al., 2006; Wan and Flavell, 2005; Xie

et al., 2006). These mice were backcrossed to B6 strain for more than six

generations. Mice were housed at the Yale Animal Resource Center, and

mmunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc. 929

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

experiments were performed in accordance with the guidelines of the National

Institutes of Health (NIH) and protocols approved by the Institutional Animal

Care and Use Committee.

Flow Cytometry and Cell Sorting

FACS analysis was performed as previously described (Jimi et al., 2008).

Intracellular Foxp3 staining was done with the kit from eBioscience according

to the manufacturer’s protocols. Phospho-STAT5 staining was done as

previously described (Long and Adler, 2006). Stained cells were analyzed on

a FACSCalibur or an LSRII station (Becton Dickinson). The sortings were

done in a MoFlow cell sorter (Dako Cytomation) or a VantageSE station

(Becton Dickinson, customized and equipped with a 568 nm laser).

Adoptive Transfer

CD4+RFP+Foxp3+ or CD4+RFP�Foxp3� T cells were purified by flow cytome-

try from Foxp3-RFP reporter mice with or without the IKKEE transgene. 2 3105

cells were transferred into T cell-deficient recipient mice by i.v. injection. The

spleens of recipient mice were harvested 4 weeks later, and single-cell

suspensions were analyzed for frequency of TCRb+CD4+ cells and Foxp3

expression.

DNA Methylation Analysis

Cell populations were isolated from male mice and methylation analysis was

carried out via bisulphite sequencing protocol as described before (Clark

et al., 2006). The CpG-rich region of CNS3 intronic enhancer region of

FOXP3 gene was amplified by PCR with primers described before: DS-inner

FW, 50-TTTTGGGTTTTTTTGGTATTTAAGA-30; and DS-inner RV, 50- TTAACCA

AATTTTTCTACCATTAAC-30 (Kim and Leonard, 2007). The PCR product was

cloned with the ZeroBlunt PCR Cloning kit (Invitrogen) and was sequenced.

Chromatin Immunoprecipitation

Jurkat cells were stimulated with or without PMA (20 ng/ml) and ionomycin

(500 ng/ml) for 3 hr and were then fixed with 1% formaldehyde for 15 min at

room temperature, washed twice with ice-cold PBS, and resuspended in

ChIP lysis buffer. The lysates were subsequently sonicated to shear the

genomic DNA into around 200 bp fragments via a Bioruptor sonicator. To

ensure uniformly small fragment sizes, we sonicated for a total of 7.5 min (15

times for 30 s with a 30 s rest between each pulse) for all experiments. ChIP

analysis was performed on the supernatants with cRel and p65 antibodies

via methods as described before (Long et al., 2006). The primer sequences

for ChIP analysis were as follows: human promoter c-Rel site primer, FW: AT

TAGAAGAGAGAGGTCTGCGGCT, RV: GGCTTGTGGGAAACTGTCACGTAT;

human CNS kb1 site primer, FW: TCAGATGACTCGTAAAGGGCAAAG, RV:

TCTCTCTCTCTGTGTTTCTCCT; human CNS kb2 site primer, FW: CATA

ATCTGTGTCCCAGAAACATCCC, RV: GGCTTCCTGCACTGTCTGTT; human

CNS kb3 site primer, FW: AGCTGCCTGACTTTCAGATGGTTC, RV:

GTCCCAAAGTCTCAGTATGTGTAGGC.

Reporter Assay

The Foxp3 reporter constructs were kindly provided by W.J. Leonard at NIH

(Kim and Leonard, 2007) and were subcloned into PGL4 basic reporter

construct. We transfected 1.5 3 106 cells with 1.5 mg of luciferase reporter

plasmid and 0.4 mg of phRL-TK (Promega) as an internal control via the poly-

ethylenimine (PEI) method. 1.5 mg of IKKEE, IkBaSR, or control empty expres-

sion plasmid was cotransfected as indicated. The transfected cells were then

cultured in 24-well plates and were stimulated with PMA (10 ng/ml) and

ionomycin (500 ng/ml) for 17 hr before analysis as indicated.

SUPPLEMENTAL DATA

Supplemental Data include Supplemental Experimental Procedures and eight

figures and can be found with this article online at http://www.cell.com/

immunity/supplemental/S1074-7613(09)00500-7.

ACKNOWLEDGMENTS

The authors would like to thank R. Flavell and A. Rudensky for providing the

Foxp3 RFP and GFP reporter mice. The TAK1-floxed mice were obtained

930 Immunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc.

from the laboratory of M. Schneider. The CARMA1-deficient mice were ob-

tained from the laboratory of D. Littman. The Foxp3 reporter constructs were

kindly provided by W.J. Leonard. The work reported in this manuscript was

supported by NIH R37 AI33443 and RO1 AI068977. M.L. was supported by

NIH T32AI007019-33. M.S.H. was also supported by NIH/NIGMS MSTP grant

GM07205.

Received: April 21, 2009

Revised: July 22, 2009

Accepted: September 22, 2009

Published online: December 17, 2009

REFERENCES

Bellavia, D., Campese, A.F., Alesse, E., Vacca, A., Felli, M.P., Balestri, A.,

Stoppacciaro, A., Tiveron, C., Tatangelo, L., Giovarelli, M., et al. (2000).

Constitutive activation of NF-kappaB and T-cell leukemia/lymphoma in

Notch3 transgenic mice. EMBO J. 19, 3337–3348.

Bruniquel, D., and Schwartz, R.H. (2003). Selective, stable demethylation of

the interleukin-2 gene enhances transcription by an active process. Nat.

Immunol. 4, 235–240.

Burchill, M.A., Yang, J., Vang, K.B., Moon, J.J., Chu, H.H., Lio, C.-W.J., Vegoe,

A.L., Hsieh, C.-S., Jenkins, M.K., and Farrar, M.A. (2008). Linked T cell

receptor and cytokine signaling govern the development of the regulatory

T cell repertoire. Immunity 28, 112–121.

Clark, S.J., Statham, A., Stirzaker, C., Molloy, P.L., and Frommer, M. (2006).

DNA methylation: bisulphite modification and analysis. Nat. Protoc. 1,

2353–2364.

Egawa, T., Albrecht, B., Favier, B., Sunshine, M.-J., Mirchandani, K., O’Brien,

W., Thome, M., and Littman, D.R. (2003). Requirement for CARMA1 in antigen

receptor-induced NF-kappa B activation and lymphocyte proliferation. Curr.

Biol. 13, 1252–1258.

Fischer, A.M., Katayama, C.D., Pages, G., Pouyssegur, J., and Hedrick, S.M.

(2005). The role of erk1 and erk2 in multiple stages of T cell development.

Immunity 23, 431–443.

Floess, S., Freyer, J., Siewert, C., Baron, U., Olek, S., Polansky, J., Schlawe,

K., Chang, H.D., Bopp, T., Schmitt, E., et al. (2007). Epigenetic control of the

foxp3 locus in regulatory T cells. PLoS Biol. 5, e38.

Fontenot, J.D., Gavin, M.A., and Rudensky, A.Y. (2003). Foxp3 programs the

development and function of CD4+CD25+ regulatory T cells. Nat. Immunol.

4, 330–336.

Fontenot, J.D., Rasmussen, J.P., Gavin, M.A., and Rudensky, A.Y. (2005). A

function for interleukin 2 in Foxp3-expressing regulatory T cells. Nat. Immunol.

6, 1142–1151.

Gong, Q., Cheng, A.M., Akk, A.M., Alberola-Ila, J., Gong, G., Pawson, T., and

Chan, A.C. (2001). Disruption of T cell signaling networks and development by

Grb2 haploid insufficiency. Nat. Immunol. 2, 29–36.

Gupta, S., Manicassamy, S., Vasu, C., Kumar, A., Shang, W., and Sun, Z.

(2008). Differential requirement of PKC-theta in the development and function

of natural regulatory T cells. Mol. Immunol. 46, 213–224.

Hori, S., Nomura, T., and Sakaguchi, S. (2003). Control of regulatory T cell

development by the transcription factor Foxp3. Science 299, 1057–1061.

Huehn, J., Polansky, J.K., and Hamann, A. (2009). Epigenetic control of FOXP3

expression: The key to a stable regulatory T-cell lineage? Nat. Rev. Immunol. 9,

83–89.

Jimi, E., Strickland, I., Voll, R.E., Long, M., and Ghosh, S. (2008). Differential

role of the transcription factor NF-kappaB in selection and survival of CD4+

and CD8+ thymocytes. Immunity 29, 523–537.

Kim, H.P., and Leonard, W.J. (2007). CREB/ATF-dependent T cell receptor-

induced FoxP3 gene expression: A role for DNA methylation. J. Exp. Med.

204, 1543–1551.

Koonpaew, S., Shen, S., Flowers, L., and Zhang, W. (2006). LAT-mediated

signaling in CD4+CD25+ regulatory T cell development. J. Exp. Med. 203,

119–129.

Immunity

NF-kB Regulates Foxp3 Expression in Treg Cells

Lai, J.H., Horvath, G., Subleski, J., Bruder, J., Ghosh, P., and Tan, T.H. (1995).

RelA is a potent transcriptional activator of the CD28 response element within

the interleukin 2 promoter. Mol. Cell. Biol. 15, 4260–4271.

Liston, A., and Rudensky, A.Y. (2007). Thymic development and peripheral

homeostasis of regulatory T cells. Curr. Opin. Immunol. 19, 176–185.

Long, M., and Adler, A.J. (2006). Cutting edge: Paracrine, but not autocrine,

IL-2 signaling is sustained during early antiviral CD4 T cell response. J.

Immunol. 177, 4257–4261.

Long, M., Slaiby, A.M., Hagymasi, A.T., Mihalyo, M.A., Lichtler, A.C., Reiner,

S.L., and Adler, A.J. (2006). T-bet down-modulation in tolerized Th1 effector

CD4 cells confers a TCR-distal signaling defect that selectively impairs IFN-

gamma expression. J. Immunol. 176, 1036–1045.

McKarns, S.C., and Schwartz, R.H. (2008). Biphasic regulation of Il2

transcription in CD4+ T cells: roles for TNF-alpha receptor signaling and

chromatin structure. J. Immunol. 181, 1272–1281.

Medoff, B.D., Sandall, B.P., Landry, A., Nagahama, K., Mizoguchi, A., Luster,

A.D., and Xavier, R.J. (2009). Differential requirement for CARMA1 in agonist-

selected T-cell development. Eur. J. Immunol. 39, 78–84.

Moore, N.C., Girdlestone, J., Anderson, G., Owen, J.J., and Jenkinson, E.J.

(1995). Stimulation of thymocytes before and after positive selection results

in the induction of different NF-kappa B/Rel protein complexes. J. Immunol.

155, 4653–4660.

Neilson, J.R., Winslow, M.M., Hur, E.M., and Crabtree, G.R. (2004). Calcineurin

B1 is essential for positive but not negative selection during thymocyte

development. Immunity 20, 255–266.

Rao, S., Gerondakis, S., Woltring, D., and Shannon, M.F. (2003). c-Rel is

required for chromatin remodeling across the IL-2 gene promoter. J. Immunol.

170, 3724–3731.

Rawlings, D.J., Sommer, K., and Moreno-Garcıa, M.E. (2006). The CARMA1

signalosome links the signalling machinery of adaptive and innate immunity

in lymphocytes. Nat. Rev. Immunol. 6, 799–812.

Sakaguchi, S. (2004). Naturally arising CD4+ regulatory t cells for immunologic

self-tolerance and negative control of immune responses. Annu. Rev.

Immunol. 22, 531–562.

Sakaguchi, S., Sakaguchi, N., Asano, M., Itoh, M., and Toda, M. (1995).

Immunologic self-tolerance maintained by activated T cells expressing IL-2

receptor alpha-chains (CD25). Breakdown of a single mechanism of self-toler-

ance causes various autoimmune diseases. J. Immunol. 155, 1151–1164.

Sakaguchi, S., Wing, K., and Miyara, M. (2007). Regulatory T cells—A brief

history and perspective. Eur. J. Immunol. 37, S116–S123.

Schmidt-Supprian, M., Courtois, G., Tian, J., Coyle, A.J., Israel, A., Rajewsky,

K., and Pasparakis, M. (2003). Mature T cells depend on signaling through the

IKK complex. Immunity 19, 377–389.

Schmidt-Supprian, M., Tian, J., Grant, E.P., Pasparakis, M., Maehr, R., Ovaa,

H., Ploegh, H.L., Coyle, A.J., and Rajewsky, K. (2004). Differential dependence

of CD4+CD25+ regulatory and natural killer-like T cells on signals leading to

NF-kappaB activation. Proc. Natl. Acad. Sci. USA 101, 4566–4571.

Schulze-Luehrmann, J., and Ghosh, S. (2006). Antigen-receptor signaling to

nuclear factor kappa B. Immunity 25, 701–715.

I

Takahashi, T., Kuniyasu, Y., Toda, M., Sakaguchi, N., Itoh, M., Iwata, M.,

Shimizu, J., and Sakaguchi, S. (1998). Immunologic self-tolerance maintained

by CD25+CD4+ naturally anergic and suppressive T cells: induction of

autoimmune disease by breaking their anergic/suppressive state. Int.

Immunol. 10, 1969–1980.

Thomas, R.M., Gao, L., and Wells, A.D. (2005). Signals from CD28 induce

stable epigenetic modification of the IL-2 promoter. J. Immunol. 174,

4639–4646.

Thorstenson, K.M., and Khoruts, A. (2001). Generation of anergic and poten-

tially immunoregulatory CD25+CD4 T cells in vivo after induction of peripheral

tolerance with intravenous or oral antigen. J. Immunol. 167, 188–195.

Tone, Y., Furuuchi, K., Kojima, Y., Tykocinski, M.L., Greene, M.I., and Tone, M.

(2007). Smad3 and NFAT cooperate to induce Foxp3 expression through its

enhancer. Nat. Immunol. 9, 194–202.

Vallabhapurapu, S., Powolny-Budnicka, I., Riemann, M., Schmid, R.M.,

Paxian, S., Pfeffer, K., Korner, H., and Weih, F. (2008). Rel/NF-kappaB family

member RelA regulates NK1.1- to NK1.1+ transition as well as IL-15-induced

expansion of NKT cells. Eur. J. Immunol. 38, 3508–3519.

Voll, R.E., Jimi, E., Phillips, R.J., Barber, D.F., Rincon, M., Hayday, A.C.,

Flavell, R.A., and Ghosh, S. (2000). NF-kappa B activation by the pre-T cell

receptor serves as a selective survival signal in T lymphocyte development.

Immunity 13, 677–689.

Wan, Y.Y., and Flavell, R.A. (2005). Identifying Foxp3-expressing suppressor

T cells with a bicistronic reporter. Proc. Natl. Acad. Sci. USA 102, 5126–5131.

Wan, Y.Y., Chi, H., Xie, M., Schneider, M.D., and Flavell, R.A. (2006). The

kinase TAK1 integrates antigen and cytokine receptor signaling for T cell

development, survival and function. Nat. Immunol. 7, 851–858.

Watts, T.H. (2005). TNF/TNFR family members in costimulation of T cell

responses. Annu. Rev. Immunol. 23, 23–68.

Welte, T., Leitenberg, D., Dittel, B.N., al-Ramadi, B.K., Xie, B., Chin, Y.E.,

Janeway, C.A., Jr., Bothwell, A.L., Bottomly, K., and Fu, X.Y. (1999). STAT5

interaction with the T cell receptor complex and stimulation of T cell prolifera-

tion. Science 283, 222–225.

Xie, M., Zhang, D., Dyck, J.R.B., Li, Y., Zhang, H., Morishima, M., Mann, D.L.,

Taffet, G.E., Baldini, A., Khoury, D.S., and Schneider, M.D. (2006). A pivotal

role for endogenous TGF-beta-activated kinase-1 in the LKB1/AMP-activated

protein kinase energy-sensor pathway. Proc. Natl. Acad. Sci. USA 103,

17378–17383.

Yagi, H., Nomura, T., Nakamura, K., Yamazaki, S., Kitawaki, T., Hori, S.,

Maeda, M., Onodera, M., Uchiyama, T., Fujii, S., and Sakaguchi, S. (2004).

Crucial role of FOXP3 in the development and function of human

CD25+CD4+ regulatory T cells. Int. Immunol. 16, 1643–1656.

Yu, A., Zhu, L., Altman, N.H., and Malek, T.R. (2009). A low interleukin-2

receptor signaling threshold supports the development and homeostasis of

T regulatory cells. Immunity 30, 204–217.

Zheng, Y., and Rudensky, A.Y. (2007). Foxp3 in control of the regulatory T cell

lineage. Nat. Immunol. 8, 457–462.

mmunity 31, 921–931, December 18, 2009 ª2009 Elsevier Inc. 931