Genomic characterization and physical mapping oftwo fucosyltransferase genes in Medicagotruncatula1

Alexandra Castilho, Margarida Cunha, Ana Rita Afonso, Leonor Morais-Cecílio,Pedro S. Fevereiro, and Wanda Viegas

Abstract: Fucosyltransferases catalyse fucose transfer onto oligosaccharides. Two fucosylated structures have beenidentified in plants: the α1,4-fucosylated Lewis-a epitope and the α1,3-fucosylated core. Here we report the cloning,genomic characterization, and physical mapping of two genes encoding proteins similar to α1,4-fucosyltransferase (EC2.4.1.65, MtFUT1) and α1,3-fucosyltransferase (EC 2.4.1.214, MtFUT2) in Medicago truncatula. Analysis of thegenomic organization of the fucosyltransferase genes in M. truncatula, revealed the presence of two genomic variantsof the MtFUT1 gene coding sequence, one containing a single intron and the other intronless, whereas in MtFUT2, thegene coding region is interrupted by four introns. Using for the first time fluorescence in situ hybridization (FISH) tophysically map fucosyltransferase genes in plants, this study reveals a high genomic dispersion of these genes inMedicago. The MtFUT1 genes are mapped on chromosomes 4, 7, and 8, colocalizing on three of the five MtFUT2 loci.Chromosomes 1 and 5 carry the additional MtFUT2 loci. Moreover, the intensity of the FISH signals reveals markeddifferences in the number of gene copies per locus for both genes. Simultaneous mapping of rRNA genes on chromo-some 5 shows that several MTFUT2 gene loci are inserted within the rDNA array. Insertions of coding DNA sequencesinto the rDNA repeats were never reported to date.

Key words: core α1,3-fucosyltransferase gene, α1,4-fucosyltransferase gene, genomic organization, in situ hybridization,Medicago truncatula.

Résumé : Les fucosyltransférases catalysent l’ajout de fucose sur des oligosaccharides. Deux structures fucosylées ontété identifiées chez les plantes : l’épitope Lewis-a α1,4-fucosylé et le noyau α1,3-fucosylé. Les auteurs rapportent ici leclonage, la caractérisation et la cartographie physique de deux gènes codant pour des protéines semblables à l’α1,4-fucosyltransférase (EC 2.4.1.65, MtFUT1) et à l’α1,3-fucosyltransférase (EC 2.4.1.214, MtFUT2) chez le Medicagotruncatula. L’examen de l’organisation génomique des gènes codant pour ces fucosyltransférases chez le M. truncatulaa révélé la présence de deux variants génomiques de MtFUT1, l’un avec un intron et l’autre sans, tandis que le gèneMtFUT2 contient quatre introns. En faisant appel à l’hybridation in situ en fluorescence (FISH) pour déterminerl’emplacement physique de ces gènes codant pour des fucosyltransférases, une première chez les plantes, les auteursont observé une grande dispersion génomique de ces gènes chez le genre Medicago. Les gènes MtFUT1 sont situés surles chromosomes 4, 7 et 8 et colocalisent avec trois des cinq locus MtFUT2. Les chromosomes 1 et 5 portent les deuxautres locus MtFUT2. De plus, l’intensité des signaux FISH indique des différences marquées quant au nombre de co-pies géniques à chaque locus pour ces deux gènes. La cartographie simultanée des gènes codant pour les ARNr sur lechromosome 5 a révélé que plusieurs locus MtFUT2 sont insérés au sein de la suite d’ADNr. Des insertions d’ADNcodant au sein de répétitions d’ADNr n’a jamais été rapportée.

Mots clés : gène de l’α1,3-fucosyltransférase centrale, gène de l’α1,4-fucosyltransférase, organisation génomique, hybri-dation in situ. Medicago truncatula.

[Traduit par la Rédaction] Castilho et al. 176

Genome 48: 168–176 (2005) doi: 10.1139/G04-094 © 2005 NRC Canada

168

Received 31 May 2004. Accepted 10 September 2004. Published on the NRC Research Press Web site at http://genome.nrc.ca on11 February 2005.

Corresponding Editor: G. Jenkins.

A. Castilho,2 M. Cunha, L. Morais-Cecílio, and W. Viegas. Centro de Botânica Aplicada à Agricultura, Instituto Superior deAgronomia, Tapada da Ajuda 1349–017 Lisboa, Portugal.A.R. Afonso and P.S. Fevereiro. Laboratório de Biotecnologia de Células Vegetais, Instituto de Tecnologia Química e Biológica,Apartado 127, 2781–901 Oeiras, Portugal.

1The nucleotide sequences reported in this paper have been submitted to the GenBank with accession numbers AY553062(MtFUT1) and AY557602 (MtFUT2).

2Corresponding author (e-mail: castilho@isa.utl.pt).

Introduction

N-glycosylation is the major modification of plant pro-teins. Plant N-glycans strongly influence the glycoproteinconformation, stability, and biological activity (reviewed inLerouge et al. 1998). Also, protein glycosylation seems es-sential in cellular processes such as cell differentiation andembryo development (Lerouge et al. 1998; Boisson et al.2001; Elbers et al. 2001). The extensive search for a func-tion of protein glycosylation in plants has not yet demon-strated a role for specific complex glycan structures, whichis well documented for mammals (Staudacher et al. 1999).

Another important aspect of plant N-glycans is their po-tential involvement in immune responses in mammals owingto the presence of plant-specific N-glycan immunogenicepitopes (van Ree 2002; Foetisch et al. 2003). Fuco-syltransferases are a specific group of glycosyltransferasesinvolved in the maturation of complex N-glycans. In plants,fucosyltransferases catalyse the transfer of fucose either inan α1,3-linkage to the core N-acetylglucosamine (GlcNAc)or in an α1,4-linkage to GlcNAc residues on the terminalbranches (Staudacher et al. 1999). In recent years, plantfucosyltransferases have been the focus of investigation bymany research groups. The Lewis-a (Le-a) motifs on termi-nal branches of plant N-glycans are widespread amongplants (Melo et al. 1997; Wilson et al. 2001a) and resultfrom the activity of an α1,4-fucosyltransferase ((EC2.4.1.65, α1,4-FucT) different from its mammalian counter-parts (Melo et al. 1997; Crawley et al. 1998; Palma et al.2001).

The fact that plant N-glycans containing Le-a are onlyfound at the cell surface suggests a putative function in cell–cell communication (Fitchette-Laine et al. 1997). Recently,Joly et al. (2002) showed that α1,4-FucT is regulated duringtobacco flower development, suggesting a potential role ofα1,4-fucosylation during pollen maturation and pollen tubeelongation. Changes in α1,4-FucT activity and expression ofLewis-a in two lines of Medicago truncatula that differ intheir ability to produce somatic embryos, indicate moreovera possible involvement of an α1,4-FucT gene and the Le-aepitope in somatic embryogenesis (Vila-Verde et al. 2001).

The high amount of complex N-glycans with Le-a epi-topes, present in M. truncatula, contrasts with the minimalamounts observed in Arabidopsis (Fichette-Laine et al.1997; Leonard et al. 2002), and therefore Arabidopsis is notthe ideal species for this type of study, although it serves asthe model system for most plant processes.

Medicago truncatula is widely recognized as an excellentmodel for legume genomics, possessing a number of inter-esting characteristics for both molecular and classical genet-ics (Cook 1999; Cook and Dénarié 2000; Thoquet et al.2002). Medicago truncatula is a diploid and self-fertile spe-cies, with a relatively small genome (2 × 8 chromosomes,500–550 Mb, Blondon et al. 1994) and rapid generationtime, enhancing its importance as a model legume speciesfor studies of comparative genomics with other importantcrop legumes such as pea, faba bean, chickpea, lentil, andclover (Doyle et al. 1996).

Here, we report the cloning and genomic organization ofthe Le-a type α1,4-FucT and the core α1,3-FucT genes inMedicago truncatula. In addition, we used for the first time

in situ hybridization of the open reading frames to physi-cally map these genes onto the chromosomes. We observe ahigh copy number and genome dispersion of fucosyl-transferase genes in M. truncatula.

Materials and methods

Plant materialEight young leaves from the same Medicago truncatula

‘Jemalong A17’ plant were used to isolate total RNA and to-tal genomic DNA. We have used the Qiagen RNeasy PlantMini Kit and Qiagen DNeasy Plant Mini kit according to themanufacturer’s instructions (Qiagen, Valencia, Calif.).

PCR amplification of the α1,4-FucT and α1,3-FucTgene open reading frames

First-strand cDNA was synthesized from 3 µg of totalRNA by RT-PCR using an oligo d(T)18 as the annealingprimer. Two microlitres of cDNA was used for PCR amplifi-cation of α1,4-FucT and α1,3-FucT gene fragments. Theprimers sequences used are listed in Tables 1 and 2.

Amplification of a target cDNA fragment from the α1,4-FucT gene was performed by standard PCR with the primers4F1 and 4R1. The missing 5′-end region of the cDNA wasobtained by means of 5′ rapid amplification of cDNA ends(RACE). Briefly, first strand DNA was synthesized using thegene-specific primer 4R2. cDNA was subjected to hemi-nested PCR using the AAP primer (5′-GGCCACGCGTCG-ACTAGTACGGGIIGGGGIIGGGIIG-3′) and 4R2 and thenwith the AUAP primer (5′-GGCCACGCGTCGACTAGTAC-3′) and a nested 4R3.

The 3F1 and 3R1 primers were used to amplify a frag-ment of the core α1,3-FucT cDNA. As before, RACE wasused in the amplification of the gene’s 5′-end fragment: 3R2primer was used in the cDNA synthesis, followed by a hemi-nested PCR (AAP+3R2), and a subsequent PCR withAUAP+3R3. PCR conditions were as described above. PCRproducts were separated by electrophoresis.

Cloning and sequencing proceduresThe target DNA fragments were cloned into pCR2.1 vec-

tor from the TOPO cloning Kit (Invitrogen, Carlsbad, Ca-lif.), according to instructions. Recombinant plasmids weresequenced using the Thermo Sequenase™ Primer Cycle se-quencing Kit (Amersham Pharmacia Biotech, Foster City,Calif.) with the fluorescent dye-labelled M13 forward andreverse primers. Sequence analysis was performed at leasttwice in an ALFexpress automated DNA sequencer with aLong Read Tower gel (Amersham Pharmacia Biotech). Thesingle DNA fragment obtained by 5′-RACE for both geneswas also cloned and sequenced as described above. Theanalysis of the overlapping DNA sequences allowed the de-sign of new primers for the amplification of the completegene coding regions.

Analysis of the genomic organization of α1,4-FucT andα1,3-FucT genes

To study genomic organization, the full open readingframe (ORF) of both genes was PCR amplified from cDNAand from 150 ng of total genomic DNA, and the sizes of thefragments compared. The coding region of the α1,4-FucT

© 2005 NRC Canada

Castilho et al. 169

gene was amplified with the primer pair 4F2–4R1. Also, re-gions covering the ORF as overlapping fragments were PCRamplified with three primer pairs: 4F2–4R4, 4F3–4R5, and4F4–4R1.

For the α1,3-FucT gene, the primers 3F2–3R4 were usedto amplify the full coding region and overlapping fragmentswere amplified with the primer pairs 3F2–3R2, 3F3–3R5,and 3F4–3R4.

Southern blotting hybridizationFor estimation of the number of loci, total genomic DNA

from young M. truncatula leaves was digested with excessof restriction enzymes according to manufacturers instruc-tions. Only endonucleases that had no restriction site or justone at the end of the ORF were used. DNA digests werefractionated by gel electrophoresis and the DNA transferredto membranes. ECL was used for probe labelling, hybridiza-tion, and detection of hybridization sites following the man-ufacturer’s instructions and methods described byAnamthawat-Jónsson et al. (1990). The blots were hybrid-ized with the cDNA gene coding sequences isolated by PCRfrom recombinant plasmid DNA. Hybridization was carriedout under a stringency of 78% with post-hybridizationwashes of 91% stringency.

Fluorescence in situ hybridization (FISH)Seeds from M. truncatula ‘Jemalong A17’ were first

placed on moist filter paper in Petri dishes for 48 h at 4 °Cto start germination. Then the Petri dishes were transferredto 24 °C until root tips reached about 1 cm long. A pretreat-ment of the excised root tips in ice-cold water for 24 h be-fore fixation was used to induce c-mitosis. Root tips werefixed in fresh ethanol – glacial acetic acid (3:1 v/v) for atleast 10 h at room temperature and then stored at –20 °C.Preparation of chromosome spreads and DNA–DNA in situhybridization followed the procedures described in Castilhoand Heslop-Harrison (1995). Hybridization was performedunder a stringency of 75% and post-hybridization washeswith a stringency of 84%.

In the in situ experiments, the following probes wereused: (i) cloned cDNA sequence corresponding to the openreading frame of the α1,4-FucT gene; (ii) cloned cDNA se-quence corresponding to the open reading frame of the α1,3-FucT gene; (iii) pTa71, a highly repeated sequence contain-

ing a 9-kb EcoRI fragment of the ribosomal DNA isolatedfrom Triticum aestivum (Gerlach and Bedbrook 1979).

DNA was labelled with biotin-11-dUTP and digoxigenin-11-dUTP, either by PCR or by nick translation.

The morphology and banding of the DAPI-stained chro-mosomes, together with the M. truncatula pachytene chro-mosome karyotype (Kulikova et al. 2001), were used for theidentification of different chromosome pairs.

Results

Isolation and cloning of the α1,4-fucosyltransferasegene (MtFUT1)

The DNA sequence of the Arabidopsis α1,4-FucT gene(Wilson et al. 2001b) and the Medicago truncatula EST(BG454284), with high homology to α1,4-FucT, were usedto design primers that allowed the amplification of an 862-bp gene target by RT-PCR. The DNA sequence of the frag-ment obtained shows about 75% homology to other plantα1,4-FucTs (Arabidopsis FUT13, GenBank accession No.AJ404862; beetroot, GenBank acc. No. AJ315848; and to-mato, GenBank acc. No. AJ313193), 39% to the humanLewis-a enzyme (FucT3, GenBank acc. No. P21217), and46% to the fucosyltransferase present in Drosophila melan-ogaster (FucTC, GenBank acc. No. AJ302047). Using 5′-RACE, we obtained an overlapping 700-bp PCR product andused its nucleotide sequence to design new primers for isola-tion of a DNA fragment spanning the distance between thestart and stop codons. The new primers allowed the amplifi-cation of a 1230-bp cDNA fragment that corresponds to theα1,4-FucT open reading frame (Fig. 1, lane 1; MtFUT1).The gene codes for a predicted 409 amino acid protein with atheoretical molecular mass of 46 kDa and a pI of 8.7. Analysisof the protein sequence by “TMpred” (provided by EMBnet,http://www.ch.embnet.org/software/TMPRED_form.html) sug-gests a trans-membrane region from residues 10 to 28. Theprogram also predicts a type II transmembrane protein,like all hitherto analysed glycosyltransferases. By search-ing the Prosite and ProDom computer programs we wereable to identify two potential Asn-glycosylation sites.SMART (a simple modular architecture research tool) atEMBL predicts a pfam domain for glycosyltransferase fam-ily 10 (fucosyltransferases) spanning from residues 73 to408. The BLASTP program shows high homology of thisprotein to other plant α1,4-FucTs, especially towards the C

© 2005 NRC Canada

170 Genome Vol. 48, 2005

Primer name Primer sequence (5′→3′)3F1 TGTTGCTGACTTGTTCTACC3F2 ATTTCCAATTGTGGTGCTCGAA3F3 CTGGAACTATCCCTGTGGTT3F4 AGTGCACTCGAGGGTCAGA3R1 CAAAAAYRACTTCRAAYTTGG3R2 TTCGAGCACCACAATTGGAAAT3R3 GACCGGTAGAACAAGTCAGC3R4 CAAAAACGACTTCGAACTTGG3R5 TTCTGACCCTCGAGTGCACT

Table 2. Codes and sequences of primers used inMtFUT2 PCR experiments.

Primer name Primer sequence (5′→3′)4F1 AAGGGTGGACTTGGATTC4F2 CATGCTTGTAATGCCACA4F3 GTGGATTCCTGATAATTT4F4 AGTGATGTTCTTGTTTATTG4R1 TAGCTTCTTGCATTTCTTCC4R2 TTCTTGGCAAGTTCATTTCT4R3 ATCCTCTCGACCTGATCTTT4R4 ACCCACAACGACAAGAATAC4R5 ACATCGCACAATGTAAATGA

Table 1. Codes and sequences of primers used inMtFUT1 PCR experiments.

terminus. These plant proteins share some homology tomammalian, insect, and bacterial Lewis-a type fucosyl-transferases, revealing the presence of conserved regions(Oriol et al. 1999).

Genomic organization and physical mapping ofMtFUT1

To get information on gene arrangement, existence ofintrons, and clustering of genes on the chromosomes, theopen reading frame was amplified from total genomic DNA(gDNA) and compared with cDNA amplifications.

Genomic amplification revealed a fragment of about2.8 kb compared with the 1.2-kb fragment from cDNA am-plification (Fig. 1, lanes 1 and 2), thus indicating the pres-ence of one or more introns. A second PCR was used toconfirm the presence and to roughly allocate the intron(s) tospecific region(s) of the gene. Three sets of primers coveringthe entire ORF as overlapping fragments showed that initialand terminal regions had no introns (Fig. 1, lanes 3, 4, 7,and 8). Furthermore, the same DNA sequence was obtainedfrom both cDNA and genomic fragments. Genomic amplifi-cation in the middle region of the ORF with the 4F3–4R5primers revealed the presence of two fragments: one ofabout 500 bp, similar to amplification of cDNA, as well as a2.1-kb fragment (Fig 1, lanes 5 and 6). Both the 2.1-kb and500-bp genomic PCR fragments were separately isolatedfrom the agarose gel and sequenced, revealing that thesmaller fragment corresponds to the cDNA region (spanningfrom 4F3 to 4R5) and that the 2.1-kb fragment has an intronof 1616 bp. Although we were able to amplify two genomicfragments using the primers 4F3/4R5, this was not observedwhen using primers for the full ORF genomic amplification(Fig. 1, lane 2), which can be attributed to limiting PCRconditions. To investigate this, we used the PCR product ob-tained in lane 2 and performed a nested PCR with primers4F3 and 4R5. The results confirmed the presence of twoforms of MtFUT1 genomic organization, with and withoutintrons (Fig. 1, lane 9). The intron donor and acceptor splicesite was located at residue 490, following the :GU…AG:rule (Fig. 2). This exon–intron boundary in MtFUT1 is con-

served with regard to the first splice site of ArabidopsisFUT13, which has two introns.

The mono-exonic probe (1230 bp) was used in Southernhybridization studies to estimate MtFUT1gene loci number,with the number of hybridizing bands roughly representingthe minimum number of gene loci. To that end, the gDNAwas digested with BamHI restriction enzyme, which doesnot cut inside the gene sequence (Fig. 3a). Three bands ofabout 1.2, 2.6, and 5.5 kb were detected, which suggests thepresence of three different loci for the MtFUT1 gene(Fig. 3b, lane 1). The same blot was rehybridized with theintron DNA sequence and the results showed that only the5.5-kb band was detectable (Fig. 3b, lane 2). This seems toindicate that the MtFUT1 gene carrying the intron is clus-tered in a single locus and the other two loci only carrygenes organized as monoexons.

To physically map the α1,4-FucT genes on theM. truncatula chromosome complement, we used FISH withthe MtFUT1 ORF as a probe. Through the analysis of theDAPI-stained pro-metaphase and metaphase cells we clearlyconfirmed the normal chromosome number as 2n = 16.FISH with MtFUT1 mono-exonic probe reveals the presenceof 6 hybridization signals (Fig. 4), thus confirming the exis-tence of three gene loci. Hybridization with the wheat probepTa71 confirmed the presence of a single 18S–25S rDNA lo-cus in M. truncatula chromosome 5 (Kulikova et al. 2001;Falistocco and Falcinelli 2003) and showed that the nucleo-lar chromosomes do not carry MtFUT1 genes (Fig. 4).

Isolation and cloning of the core α1,3-fucosyltransferasegene (MtFUT2)

Alignments of the core α1,3-FucT sequences in plants andMedicago truncatula EST (AW695306) were used to designprimers that allowed the amplification of a 1330-bp cDNAfragment. The fragment showed more than 80% similarity toother plant core α1,3-FucTs (Arabidopsis FUT11,AJ404860; mung bean FucTC3, Y18529) and about 34%homology to Drosophila melanogaster (FucTA, AJ302045).No similarities were found between plant core α1,3-FucTand mammalian core α1,6-FucT (FucT8, Y17977). 5′ RACEenabled the amplification of a 600-bp fragment with an ap-proximately 200-bp overlap, and that includes the putativestart codon ATG. These two overlapping sequences allowedthe reconstruction of the α1,3-FucT coding region and thedesign of new primers that amplify a 1515-bp fragment cor-responding to the full gene ORF (Fig. 5, lane 1, MtFUT2).Computer analysis predicts that the gene codes for a protein504 amino acids long, with a theoretical molecular mass of56.6 kDa and a calculated pI of 6.7. The analysis also sug-gests a transmembrane region ranging from residues 32 to48, a pfam domain for glycosyltransferase family 10 (fuco-syltransferases) ranging from residues 40 to 388, and fourpossible Asn-glycosylation sites.

Protein alignment shows high homology of the deducedprotein to other plant core α1,3-FucTs, although the N-terminal region shows poor alignment. The core FucT pro-tein alignments in plants, mammals, and insects shows theconserved motifs (Oriol et al. 1999), as well as other charac-teristic core protein motifs. Despite having similar substrate

© 2005 NRC Canada

Castilho et al. 171

Fig. 1. Ethidium bromide stained agarose gel showing MtFUT1PCR amplifications from cDNA and gDNA corresponding to fullcoding sequence, 4F2–4R1 (lanes 1 and 2), and overlapping frag-ments, 4F2–4R4 (lanes 3 and 4), 4F3–4R5 (lanes 5 and 6), 4F4–4R1 (lanes 7 and 8), and nested PCR of the product obtained inlane 2 using 4F3–4R5 primers (lane 9).

specificity, the human core α1,6-FucT (FucT8) does not showany significant homology to plant or insect core α1,3-FucT.

Genomic organization and physical mapping of theMtFUT2 gene

We have used the same set of primers to amplify theMtFUT2 gene ORF from gDNA to investigate the presenceof introns. The results showed that, using standard condi-tions, it was not possible to isolate the entire ORF fromgDNA within a single PCR. Instead, amplification of threeDNA fragments with primers pairs 3F2–3R2 (Fig. 5, lanes 2and 3), 3F3–3R5 (Fig. 5, lanes 4 and 5), and 3F4–3R4(Fig. 5, lanes 6 and 7) showed that all genomic PCR prod-

ucts are bigger than the correspondent cDNA fragment andthus indicate the presence of several introns. These genomicPCR fragments were sequenced and analysed for the identi-fication of donor and acceptor splice sites. α1,3-FucT ORFis interrupted by four introns of 520, 379, 252, and 454 bp

© 2005 NRC Canada

172 Genome Vol. 48, 2005

Fig. 2. (a) Diagrammatic represention of the primer annealing sites on the MtFUT1 cDNA sequence. The introns splice sites aremarked by black triangles. (b) Diagrammatic representation of the two variants of MtFUT1 genomic organization. Gray boxes representexonic sequences connected by straight lines representing the introns. (c) Donor and acceptor splice sites of the MtFUT1 gene.

Fig. 3. (a) Ethidium bromide-stained agarose gel M. truncatulagenomic DNA digested with BamHI restriction enzyme (lane 1).(b) Southern blot of M. truncatula genomic DNA digested withBamHI hybridized to the mono-exonic MtFUT1 (lane 1) andwith the MtFUT1 intronic sequence (lane 2). Molecular sizemarker is on the left hand side.

Fig. 4. Metaphase cell showing 16 chromosomes stained withDAPI (blue). FISH of digoxigenin-labelled MtFUT1 (green sig-nal, arrow) and rRNA genes labelled with biotin (pTa71 probe,red signal) show that α1,4-FucT genes are mapped on threechromosome pairs other than the nucleolar chromosome 5. Bar =5 µm.

Fig. 5. Ethidium bromide-stained agarose gel showing MtFUT2PCR amplifications corresponding to cDNA coding sequence,3F2–3R4 (lane 1), and to overlapping fragments in cDNA andgDNA, 3F2–3R2 (lanes 2 and 3), 3F3–3R5 (lanes 4 and 5), and3F4–3R4 (lanes 6 and 7).

(Fig. 6b). The respective splice sites are located at the ORFresidues 367, 528, 1031, and 1259 (Fig. 6c). These foursplice sites in M. truncatula are conserved with regard to1st, 2nd, 5th, and 6th exon–intron junctions in ArabidopsisFUT11, and with the 1st, 2nd, and 3rd in mung beanFucTC3.

As for MtFUT1 gene, we have used Southern hybridiza-tion to determine the number of gene loci. Genomic DNAwas digested with restriction enzymes that do not cut insidethe gene sequence (EcoRI and HindIII, Fig. 7, lanes 1 and2). The blot hybridization with the MtFUT2 gene ORF am-plified from the cDNA revealed at least 16 well-discriminated bands for the EcoRI digest and 11 bands inthe HindIII digest, although other weak bands seems to bepresent. The Southern blot is similar to a DNA-ladder pat-tern, although the bands detected are not multiples of a re-petitive unit, which is normally observed for repetitive DNAsequences. In both digests, the majority of the visible bandsare smaller than 3124 bp, which is the genomic size of theMtFUT2 sequence, indicating the presence of gene truncatedforms or polymorphic copies carrying new restriction sites.Using an enzyme that cuts only once the MtFUT2 gene se-quence (BstBI, Fig. 7, lane 3), and hybridizing the genomicdigests with the gene cDNA ORF, 15 or more bands wereobserved, confirming the existence of several loci and differ-ent copies of the gene.

The physical mapping of the MtFUT2 gene on metaphase(Fig. 8a) and prometaphase (Fig. 8b) cells revealed that 10out of 16 chromosomes hybridized to the probe. Metaphasechromosomes are highly condensed, thereby limiting the op-tical resolution of the FISH signals. Gene mapping was per-formed on prometaphase cells presenting less condensed andlonger chromosomes and also displaying a DAPI-stainingdifferentiated pattern of heterochromatic and euchromatic re-gions. Comparing the morphology and banding of the DAPI-stained chromosomes with the FISH pachytene karyotype ofM. truncatula described by Kulikova et al. (2001), we were

able to discriminate the different chromosome pairs(Fig. 8b). FISH with the MtFUT2 probe shows that thegenes are mapped on chromosomes 1, 4, 5, 7, and 8. The in-tensity of the hybridization signals is not the same in all loci,indicating that the number of gene copies per locus is vari-able: chromosomes 4 and 7 show the strongest signal, chro-

© 2005 NRC Canada

Castilho et al. 173

Fig. 6. (a) Diagrammatic represention of the primer annealing sites on the MtFUT2 cDNA sequence. The splice intron sites aremarked by black triangles. (b) Diagrammatic representation of the MtFUT2 genomic organization. Gray boxes represent exonic se-quences connected by straight lines representing the introns. (c) Donor and acceptor splice sites of MtFUT2 gene.

Fig. 7. Southern blot of M. truncatula genomic DNA digestedwith restriction enzymes that do not cut inside the MtFUT2genomic sequence: EcoRI (lane 1), HindIII (lane 2) and withBstBI enzyme that cuts only once within the sequence (lane 3).The blot hybridized with the MtFUT2 open reading frame. Mo-lecular size marker is on the left hand side.

mosomes 5 and 8 have an intermediate intensity, andchromosome 1 has a very weak signal that is not detected inall cells observed. In chromosome 5, the MtFUT2 gene ap-pears as several insertions within the rDNA sequence re-peats (Fig. 8b and inset).

We also mapped the MtFUT1 and MtFUT2 loci simulta-neously on M. truncatula chromosomes (Fig. 9). We couldonly detect 8 out of 10 hybridization signals for the MtFUT2gene, indicating that the weak signal on chromosome 1 wasnot detectable here. The results also show that all MtFUT1loci colocalize with MtFUT2 loci in chromosomes 4, 7, and 8.

Discussion

We report here the molecular and cytogenetic character-ization of two genes encoding proteins similar to the Lewis-a type α1,4- FucT (MtFUT1) and the core α1,3-FucT(MtFUT2) in Medicago truncatula ‘Jemalong’. The analysisof the deduced amino acid sequence coded by MtFUT1 andMtFUT2 predicts that both proteins have a pfam domain forglycosyltransferase family 10 (fucosyltransferases). Theseproteins are similar to other plant fucosyltransferases andshare some homology to mammalian, insect, and bacterialfucosyltransferases. Although the α1,4-FucT and α1,3-FucTgenes have already been cloned in other plant species suchas Arabidopsis, mung beans, beetroot, and tomato (Leiter etal. 1999; Wilson 2001; Wilson et al. 2001b; Bakker et al.2001; Leonard et al. 2002), the cloning and sequencing ofthese genes in M. truncatula, allows for the first time a de-tailed analysis of their genomic organization and physicalmapping.

Analysis of the MtFUT1 gene revealed it has two differentgenomic organizations: either intronless or interrupted by asingle intron sequence. Buchli et al. (2002) already de-scribed, in humans, the genomic organization of an intron-containing sperm protein 17 gene (Sp17-1) and an intronless

gene with ORF interrupted by stop codons, giving rise to apseudogene (Sp17-2). As far as we know, this is the firsttime that genomic variants of the same gene ORF are re-ported in plants. One possible explanation for the presenceof these two genomic variants could be that the intronlessMtFUT1 gene arose by reverse transcription (RT) of aspliced MtFUT1 mRNA with subsequent integration into thegenome.

We also show that Medicago carries higher copy numberand genome dispersion of fucosyltransferase genes com-pared with Arabidopsis which, based on the TAIR database,carries only one α1,4-FucT locus on chromosome 1 (FUT13,At1g71990) and two α1,3-FucT loci on chromosomes 1(FUT12, At1g49710) and 3 (FUT11, At3g19280). Here weused for the first time in situ hybridization to physically mapthe fucosyltransferase genes and, in contrast to Arabidopsis,we mapped MtFUT1 genes on three chromosome pairs andMtFUT2 genes on five chromosome pairs. Our results inM. truncatula show that MtFUT1 and MtFUT2 loci colocal-ize on chromosomes 4, 7, and 8, and additional MtFUT2 lociwere also detected on chromosomes 1 and 5. Moreover, theintensity of the FISH signal is not the same in all chromo-somes and reflects the differences in the number of genecopies per locus for both genes.

The simultaneous mapping of the rRNA genes on chromo-some 5 reveals that they are interrupted by insertions ofMtFUT2 loci. This is a striking result since the rDNA locusis known to undergo concerted evolution, the recombina-tional process that preserves the sequence homogeneity ofall repeats. Although insertions of retrotransposable ele-ments have already been reported in rDNA locus of Dro-sophila (Malik and Eickbush 1999) and Saccharomyces (Zhuet al. 1999), the natural occurrence of gene-coding sequen-ces within the rDNA repeats has never been reported. Wecan only speculate that copies of MtFUT2 gene sequences

© 2005 NRC Canada

174 Genome Vol. 48, 2005

Fig. 8. (a) Metaphase cell showing 16 chromosomes stained withDAPI (blue). The physical mapping of MtFUT2 genes (greensignal) shows 5 chromosome pairs carrying α1,3-FucT gene loci.Two of them are the nucleolar chromosomes carrying the rRNAgenes (pTa71, red signal). (b) Prometaphase cell showing 16chromosomes stained with DAPI (blue), homologous chromo-some pairs are identified and numbered. Chromosome 1 has aweak MtFUT2 signal (arrowheads). Arrows indicate the nucleolarchromosome 5 where MtFUT2 loci (green signal) are insertedwithin the rRNA gene repeats (inset). Bar = 5 µm.

Fig. 9. Early prometaphase cell showing the simultaneous physi-cal mapping of MtFUT1 genes labelled with digoxigenin (greensignal), and MtFUT2 genes labelled with biotin (red signal). Thesix yellowish signals result from the colocalization of bothfucosylytransferase genes. Arrows indicate chromosome 5 carry-ing only MtFUT2 genes. The two MtFUT2 weak signals onchromosome 1 shown in Fig. 8 are not detected here. Bar = 5 µm.

inserted into the rDNA resulted from the introduction oftransposable DNA element carrying them.

α4-Fucosylated structures seem to be involved in funda-mental aspects of plant development, such as in somaticembryogenesis of M. truncatula (Vila-Verde et al. 2001) andin tobacco male reproductive processes (Joly et al. 2002).However, A. thaliana mutants lacking complex N-glycansdevelop normally, suggesting that fucosylated structures aredispensable in this species (von Schaewen et al. 1993).

We now have the know-how and tools required to manipu-late gene expression to induce loss of function and correlatethat to a particular biological function. In this regard, theisolation of those specific genes and their full genomic char-acterization, as reported here, is crucial.

Acknowledgements

This research was funded by Fundação para a Ciência eTecnologia (POCTI/35679/99; SFRH/BPD/3548/2000-FEDER). We also thank Augusta Barão for the technicalsupport, and the CNRS-INRA, France, for the Medicagotruncatula seeds.

References

Anamthawat-Jónsson, K., Schwarzacher, T., Leitch, A.R., Bennett,M.D., and Heslop-Harrison, J.S. 1990. Discrimination betweenclosely related Triticeae species using genomic DNA as a probe.Theor. Appl. Genet. 79: 721–728.

Bakker, H., Schijlen, E., de Vries, T., Schiphorst, W.E.C.M., Jordi,W., Lommen, A., Bosh, D., and van Die, I. 2000. Plant membersof the α(1,3/1,4) fucosyltransferase gene family encode andα(1,4) fucosyltransferase, potentially involved in Lewis abiosynthesis, and two core α(1,3) fucosyltransferases. FEBSLett. 507: 307–312.

Blondon, F., Marie, D., Brown, S., and Kondorosi, A. 1994. Ge-nome size and base composition in Medicago sativa andM. truncatula species. Genome, 37: 264–270.

Boisson, M., Gomord, V., Audran, C., Berger, N., Dubreucq, B.,Granier, F., Lerouge, P., Faye, L., Caboche, M., and Lepiniec, L.2001. Arabidopsis glucosidase I mutants reveal a critical role ofN-glycan trimming in seed development. EMBO J. 20: 1010–1019.

Buchli, R., De Jong, A., and Robbins, D.L. 2002. Genomic organi-zation of an intron-containing sperm protein 17 gene (Sp17-1)and an intronless pseudogene (Sp17-2) in humans: a new model.Biochim. Biophys. Acta, 1578: 29–42.

Castilho, A., and Heslop-Harrison, J.S. 1995. Physical mapping of5S and 18S-25S rDNA and repetitive DNA sequences inAegilops umbellulata. Genome, 38: 91–96.

Cook, D. 1999. Medicago truncatula: A model in the making!Curr. Opin. Plant Biol. 2: 301–304.

Cook, D., and Dénarié, J. 2000. Progress in the genomics ofMedicago truncatula and the promise of its application to grainlegume crops. Grain Legumes, 28: 12–13.

Crawley, S.C., Hindsgaul, O., Ratcliffe, R.M., Lamontagna, L.R.,and Palcic, M.M. 1998. A plant fucosyltransferase with a humanLewis blood-group specificity. Carbohydr. Res. 193: 249–256.

Doyle, J.J., Doyle, J.L., Ballenger, J.A., and Palmer, J.D. 1996.The distribution and phylogenetic significance of a 50 kbchloroplast DNA inversion in the flowering plant familyLeguminosae. Mol. Phylogenet. Evol. 5: 429–438.

Elbers, I.J.W., Stoopen, G.M., Bakker, H., Stevens, L.H., Bardor,M., Molthoff, J.W., Jordi, W.J.R.M., Bosh, D., and Lommen, A.2001. Influence of growth conditions and developmental stageon N-glycan heterogeneity of transgenic immunoglobulin G andendogenous proteins in tobacco leaves. Plant Physiol. 126:1314–1322.

Falistocco, E., and Falcinelli, M. 2003. Genomic organization ofrDNA loci in natural populations of Medicago truncatulaGaertn. Hereditas, 138: 1–5.

Fitchette-Laine, A.C., Gomord, V., Cabanes, M., Mitchalski, J.C.,Saint Macary, M., Foucher, B., Cavelier, B., Hawes, C.,Lerouge, P., and Faye, L. 1997. N-glycans harboring the Lewis aepitope are expressed at the surface of plant cells. Plant J. 12:1411–1417.

Foetisch, K., Westphal, S., Lauer, I., Retzek, M., Altmann, F.,Kolarich, D., Scheurer, S., and Vieths, S. 2003. Biological activ-ity of IgE specific for cross-reactive carbohydrate determinants.J. Allergy Clin. Immunol. 111: 889–896.

Gerlach, W.L., and Bedbrook, J.R. 1979. Cloning and characteriza-tion of ribosomal RNA genes from wheat and barley. NucleicAcid Res. 7: 1869–1885.

Joly, C., Leonard, R., Matah, A., and Riou-Khamlichi, C. 2002.α4-fucosyltransferase is regulated during flower development:increases in activity are targeted to pollen maturation and pollentube elongation. J. Exp. Bot. 53: 1429–1436.

Kulikova, O., Gualtieri, G., Geurts, R., Kim, D.J., Cook, D.,Huguet, T., de Jong, J.H., Fransz, P.F., and Bisseling, T. 2001.Integration of the FISH pachytene and genetic maps ofMedicago truncatula. Plant J. 27: 49–58.

Leiter, H., Mucha, J., Staudacher, E., Grimm, R., Glossl, J., andAltmann, F. 1999. Purification, cDNA cloning, and expressionof GDP-L-Fuc:Asn-linked GlcNAc alpha1,3-fucosyltransferasefrom mung beans. J. Biol. Chem. 274: 21 830 – 21 839.

Leonard, R., Costa, G., Darrambide, E., Lhernould, S., Fleurat-Lessard, P., Carlue, M., Gomond, V., Faye, L., and Maftah, A.2002. The presence of Lewis a epitopes in Arabidopsis thalianaglycoconjugates depends on an active α4 fucosyltransferasegene. Glycobiology, 12: 299–306.

Lerouge, P., Cabanes-Macheteau, M., Rayton, C., Fichette-Laine,A.C., Gomond, V., and Faye, L. 1998. N-glycoproteinsbiosynthesis in plants: recent developments and future trends.Plant Mol. Biol. 38: 31–48.

Malik, H.S., and Eickbush, T.H. 1999. Retrotransposable elementsR1 and R2 in the rDNA units of Drosophila mercatorum: abnor-mal abdomen revisited. Genetics, 151: 653–665.

Melo, N.S., Nimtz, M., Conradt, H.S., Fevereiro, P.S., and Costa, J.1997. Identification of the human Lewisa carbohydrate motif ina secretory peroxidase from a plant cell suspension culture(Vaccinium myrtillus L.). FEBS Lett. 415: 186–191.

Oriol, R., Mollicone, R., Cailleau, A., Balanzino, L., and Breton,C. 1999. Divergent evolution of fucosyltransferase genes fromvertebrates, invertebrates, and bacteria. Glycobiology, 9: 323–334.

Palma, A.S., Vila-Verde, C., Pires, A.S., Fevereiro, P.S., and Costa,J. 2001. A novel plant α4-fucosyltransferase (Vacciniummyrtillus L.) synthesises the Lewis-a adhesion determinant.FEBS Lett. 499: 235–238.

Staudacher, E., Altmann, F., Wilson, I.B.H., and März, L. 1999.Fucose in N-glycans: from plant to man. Biochim. Biophys.Acta, 1473: 216–236.

Thoquet, P., Gherardi, M., Journet, E.P., Kereszt, A., Ane, J.M.,Prosperi, J.M., and Huguet, T. 2002. The molecular genetic link-age map of the model legume Medicago truncatula: an essential

© 2005 NRC Canada

Castilho et al. 175

tool for comparative legume genomics and the isolation ofagronomically important genes. Plant Biol. 2: 1.

van Ree, R. 2002. Carbohydrate epitopes and their relevance forthe diagnosis and treatment of allergic diseases. Int. Arch. Al-lergy Immunol. 129: 189–197.

Vila-Verde, C., Santos, D., Fevereiro, P.S., and Costa, J. 2001.Changes in fucosyltransferase activity and expression of Lewis-a,during somatic embryogenesis, in Medicago truncatula Gaertn.FEBS Ann. Abstr. pp. 219.

von Schaewen, A., Sturm, A., O’Neill, J., and Chrispeels, M.J.1993. Isolation of a mutant Arabidopsis plant that lacks N-acetylglucosaminyl transferase I and is unable to synthesize Golgi-modified complex N-linked glycans. Plant Physiol. 102: 1109–18.

Wilson, I.B. 2001. Identification of a cDNA encoding a plantLewis-type alpha 1,4-fucosyltransferase. Glycoconj. J. 18: 439–447.

Wilson, I.B.H., Zeleny, R., Kolarich, D., Staudacher, E., Stroop,C.J.M., Kamerling, J.P., and Altmann, F. 2001a. Analysis ofAsn-linked glycans from vegetable foodstuffs: widespread oc-currence of Lewis a, core α1,3-linked fucose and xylose substi-tutions. Glycobiology, 11: 261–274.

Wilson, I.B.H., Rendic, D., Freilinger, A., Dumic, J., Friedrich, A.,Mucha, J., Muller, S., and Hauser, M.T. 2001b. Cloning and ex-pression of cDNAs encoding α1,3-fucosyltransferase homo-logues from Arabidopsis thaliana. Biochem. Biophys. Acta,25196: 1–9.

Zhu, Y., Zou, S., Wright, D.A., and Voytas, D.F. 1999. Taggingchromatin with retrotransposons: target specificity of theSaccharomyces Ty5 retrotransposon changes with the chromo-somal localization of Sir3p and Sir4p. Genes Dev. 13: 2738–2749.

© 2005 NRC Canada

176 Genome Vol. 48, 2005