lable at ScienceDirect

Fish & Shellfish Immunology 56 (2016) 459e466

Contents lists avai

Fish & Shellfish Immunology

journal homepage: www.elsevier .com/locate / fs i

Full length article

Pinocembrin attenuates lipopolysaccharide-induced inflammatoryresponses in Labeo rohita macrophages via the suppression of theNF-kB signalling pathway

Sib Sankar Giri a, c, 1, Shib Sankar Sen b, 1, Venkatachalam Sukumaran c, *, Se Chang Park a, **

a Laboratory of Aquatic Biomedicine, College of Veterinary Medicine and Research Institute for Veterinary Science, Seoul National University, Seoul, SouthKoreab School of Life Sciences, Jawaharlal Nehru University, New Delhi, Indiac Dept. of Zoology, Kundavai Nachiyar Government Arts College for Women (Autonomous), Thanjavur, Tamil Nadu, India

a r t i c l e i n f o

Article history:Received 5 April 2016Received in revised form13 July 2016Accepted 31 July 2016Available online 2 August 2016

Keywords:Labeo rohitamacrophagesLipopolysaccharidePinocembrinNF-kB signalling pathway

* Corresponding author.** Corresponding author.

E-mail addresses: drvsukumar@gmail.com (V. Su(S.C. Park).

1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.fsi.2016.07.0381050-4648/© 2016 Elsevier Ltd. All rights reserved.

a b s t r a c t

Pinocembrin is a flavonoid that has been reported to exhibit various pharmacological and biologicalactivities including antimicrobial, antioxidant, and anti-inflammatory. To explore the anti-inflammatoryactivity of pinocembrin in a fish cell line, we investigated its ability to regulate the inflammatory me-diators elevated by lipopolysaccharide (LPS) in Labeo rohita head-kidney (HK) macrophages. HK mac-rophages of L. rohita were treated with LPS (1 mg mL�1) in the presence or absence of pinocembrin. Weexamined the inhibitory effect of pinocembrin on LPS-induced nitric oxide (NO) and prostaglandin E2(PGE2) production. The inhibitory effect of pinocembrin on nitric oxide synthase (iNOS) andcyclooxygenase-2 (COX-2) was investigated by RT-PCR and western blot. The effect of pinocembrin onpro-inflammatory cytokines (tumour necrosis factor alpha (TNF-a) and interleukin-1b (IL-1b)) and anti-inflammatory cytokine IL-10 was investigated by ELISA and RT-PCR. The phosphorylation of threemitogen activated protein kinases (MAPKs) ERK, JNK, and p38 was analysed by western blot. Pinocem-brin inhibited LPS-induced productions of NO and PGE2, and also markedly inhibited TNF-a, IL-1b, iNOS,and COX-2 production in a concentration-dependent manner. In addition, TNF-a and IL-1b mRNAexpression levels decreased significantly, while IL-10 mRNA expression increased (P < 0.05) with pino-cembrin pre-treatment. RT-PCR and western blot analysis showed that pinocembrin decreased both themRNA and protein expression levels of LPS-induced iNOS and COX-2 in HK macrophages. Pinocembrinsuppressed the phosphorylation of MAPK in LPS-stimulated HK macrophages. Further, pinocembrinsignificantly inhibited LPS-induced NF-kB transcriptional activity via the attenuation of IkBa degradation.Taken together, pinocembrin reduced the levels of pro-inflammatory mediators, such as iNOS, COX-2,TNF-a, and IL-1b, by inhibiting NF-kB activation via the suppression of ERK and p38 phosphorylation,and by attenuating the degradation of IkBa. These results suggest that pinocembrin is a potential novelcandidate for the treatment of inflammatory conditions in L. rohita macrophages.

© 2016 Elsevier Ltd. All rights reserved.

1. Introduction

The three major carps of India (Labeo rohita, Catla catla, andCirrhinus mrigala) contribute to approximately 70% of the Indianaquaculture production [1]. Intensive rearing in aquaculture usually

kumaran), parksec@snu.ac.kr

generates environmental stress that increased the susceptibility offish to various pathogens (e.g. bacteria, fungi, viruses, and para-sites) and their respective inflammatory responses [2]. Inflamma-tion is the localised response of tissues to injury and is intended toeliminate the cause of damage and pave theway for healing [3]. Theacute phase response is a major pathophysiological occurrence thataccompanies inflammation, and it is concomitant with improveactivity of pro-inflammatory cytokines such as tumour necrosisfactor-a (TNF-a), interleukin-6 (IL-6), and IL-1b [4]. Lipopolysac-charide (LPS), a cell-wall component of gram-negative bacteria, caninduce disturbance in immune and inflammatory responses [5]. LPS

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466460

is a strong stimulator of macrophages, and it also activates severalsignal transduction pathways to produce various inflammatorycytokines in humans and animals, including fish [6]. Previousstudies demonstrated that the concentrations of inflammatory cy-tokines in the supernatant of LPS-challenged macrophages are areliable indicator of the extent of inflammation [5]. Further, theinhibition of inflammatory cytokines is considered to be an effec-tive method for treating inflammatory conditions.

Pinocembrin (5,7edihydroxyflavanone, C15H12O4) is an impor-tant flavonoid that has been isolated from several plants of thePiperaceae family, which compromises of 1950 species [7]. It is anatural product with a low molecular weight. Moreover it is abiologically active constituent of honey, thus highlighting the safetyof pinocembrin in long-term administration [7]. Pinocembrin dis-played linear plasma pharmacokinetics over a dose range of20e150 mg and was well tolerated up to 120 mg day�1 whenadministered intravenously to healthy adults [8]. It exhibits anti-microbial, anti-fungal, anti-inflammatory, antioxidant, anti-cancer,and neuroprotective activities [7,9]. Propolis-derived pinocembrinstimulated chemotactic activity and phagocytic activity in theneutrophil of healthy adult male [10]. Pinocembrin inhibited LPS-induced productions of IL-6, IL-1b, and TNF-a in RAW264.7 cellsin vitro [4]. In addition, it suppressed LPS-induced acute lungsinjury and inhibited LPS-induced endotoxic shock in mice [11]. In arecent study, Zhou et al. [12] demonstrated that pinocembrin couldinhibit LPS-induced productions of inflammatory mediators in BV2microglial cells via the suppression of the PI3K/Akt/NF-kB pathway[12]. Further, pinocembrin attenuated LPS-induced lungs injury bysuppressing the activation of IkBa, JNK, and MAPKp38 [4]. Pino-cembrin has been suggested as a potential neuroprotective agentagainst global cerebral ischemia/reperfusion injury owing to itsanti-inflammatory, antioxidant, and anti-excitotoxic properties[13]. Studies have indicated that pinocembrin may represent anovel candidate for the modulation of inflammatory responses.

To our knowledge, the anti-inflammatory effect of pinocembrinon fish immune cells has not been reported previously. Its biolog-ical activities on inflammation remain largely unknown in fishmacrophages. In the present study, we investigated the anti-inflammatory effects of pinocembrin in L. rohita head-kidney(HK) macrophages. We examined whether pinocembrin exertsprotective effects against LPS-induced inflammatory responses inL. rohita HK macrophages.

2. Materials and methods

2.1. Isolation of head-kidney macrophages from L. rohita

Twenty healthy L. rohita (mean bodyweight, 137.3 ± 1.26 g) wereobtained from a local fish farm (Thanjavur, Tamil Nadu) and wereacclimatised to laboratory conditions for 2 weeks in 500-L plastictanks at 25 ± 2 �C [14]. Isolation of HKmacrophages was performedaccording to the modified method of Li et al. [15]. Briefly, fish wereanaesthetised with MS-222, bled, and killed. The kidneys wereremoved aseptically, washed 4 times with ice-cold medium, andpressed through sterile stainless steel screens. The cells werewashed by centrifugation at 300g for 10 min at 4 �C and resus-pended in medium. For the purification of macrophages, the cellsuspension was layered onto a 34%e51% Percoll (Sigma ChemicalCo., St. Louis, MO) discontinuous gradient and subjected to centri-fugation at 350g for 24 min. The cells at the 34%e51% Percollinterface were transferred into clean tubes and washed 3 times bycentrifugation at 300g for 10 min at 4 �C. Purified macrophageswere enumerated using a haemocytometer and their viability wasassessed using the fluorescein diacetate-ethidium bromide (FDA/EB) staining. The number of cells was adjusted to 1 � 106 viable

cells per ml prior to assaying. Purified kidney macrophages wereused for the establishment of macrophage cell lines.

Macrophages were maintained in an atmosphere of 95% air and5% CO2 in Dulbecco's modified Eagle's medium (DMEM) (GibcoBRL,NY, USA) supplemented with 5% heat-inactivated fetal bovineserum (FBS) (Hyclone, UT, USA),100 mgmL�1 streptomycin, and 100U mL�1 penicillin (GibcoBRL, USA). Macrophage cells were main-tained by weekly passage, and cells were subjected to analysis at60e80% confluence.

2.2. Pinocembrin and cell treatment

Analytical grade pinocembrin was purchased from Sigma-Aldrich, USA. Pinocembrin at concentrations of 0 (control), 50,100, and 200 mg mL�1 were prepared in DMSO. A 1 mg mL�1 stocksolution of LPS was prepared in sterile PBS (pH 7.4), and was storedat �20 �C until further use. Pinocembrin was added to the culturemedium 1 h before LPS treatment (1 mg mL�1).

2.3. Measurements of nitric oxide

Nitric oxide (NO) production was determined by measuring thenitrite concentration using the Griess assay as described previously[16]. The absorbance was measured at 550 nm using a microplatereader. Nitrite concentrations were calculated from a sodium nitritestandard reference curve [17].

2.4. MTT assay

Cell viability was assessed in a 96 well microplate (5 � 104 cells/well) using the MTT assay method described by Verma et al. [18]with a slight modification [2]. Briefly, cells were washed andincubated with MTT (20 mL of 5 mg mL�1 per well) at 26 �C for 3 h.The formazan product was solubilised by adding 100 mL of DMSOand 100 mL of 10% SDS in 0.01 M HCl. Viability was estimated byrecording the absorbance at 570 nm using an ELISA plate reader.

2.5. Prostaglandin E2 (PGE2) assay

PGE2 synthesis was analysed using a commercially availablePGE2 enzyme immunometric assay (PGE2-EIA) kit (Cayman, MI,USA) [19]. After 24 h of LPS (1 mg mL�1) stimulation, PGE2 synthesisin the culture media was evaluated using a commercially availablePGE2-EIA kit (Cayman Co.) following the manufacturer's in-structions. The concentration of PGE2 was calculated according tothe equation obtained from the standard curve plot using the PGE2standard solution in the EIA kit.

2.6. Measurement of cytokine production

Levels of TNF-a, IL-1b, and IL-10 in the supernatant weremeasured by using a fish specific ELISA kit (MyBioSource, SanDiego, USA.). Macrophage cells (1 � 105 cells mL�1) were incubatedwith different concentrations of pinocembrin for 1 h, washed withfresh medium, and then stimulated with 1 mgmL�1 LPS. The culturesupernatants were collected after 24 h of LPS stimulation. Thelevels of TNF-a, IL-1b, and IL-10 in the culture media weremeasured according to the manufacturer's instructions. Quantiza-tion of the ELISA results was performed using a microplate spec-trophotometer (Shimadzu, Japan) at a wavelength of 450 nm andcorrected for absorbance at 540 nm, according to the manufac-turer's instruction. The concentrations of TNF-a, IL-1b, and IL-10were calculated according to the standard curve using each of thecytokines in the ELISA kits.

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466 461

2.7. Reverse transcription-polymerase chain reaction (RT-PCR)

RT-PCR was performed to evaluate the mRNA expressions ofiNOS and COX-2. Macrophages were stimulated with pinocembrinfor 1 h followed by LPS treatment for 24 h. After washing twicewithPBS, total cellular RNA was extracted with TRIZOL reagent (Invi-trogen, USA) according to the manufacturer's instructions. RT-PCRwas performed using 1 mg total RNA, 10 mM target gene-specificprimers, and the One Step- RT-PCR kit (Qiagen, Germany), ac-cording to the manufacturer's instructions. GAPDH (glyceralde-hyde-3-phosphate dehydrogenase) was used as an internalstandard. The primers and PCR conditions used in this experimentare indicated in Table 1.

2.8. Western blotting

Cells were lysed with M-PER™ Protein Extraction Reagent(Promega, USA) supplemented with a protease inhibitor cocktail.Protein concentrations were measured by using a BCA assay andwere made equal with extraction reagent. Equal amounts of ex-tracts were separated by 10% SDS-PAGE, transferred onto nitrocel-lulose membranes, and then blotted as described previously [21].The cellular levels of TNF-a, IL-1b, IL-10, iNOS, COX-2, p-IkBa, NF-kB, ERK, JNK, p38 MAPK, and GAPDH were determined by immu-noblotting using anti-TNF-a, IL-1b, IL-10, iNOS, COX-2, p-IkBa, NF-kB, ERK, JNK, MAPKp38, and GAPDH antibodies (Sigma-Aldrich,USA). The bandswere visualised by incubatingwith anti-rabbit HRPconjugated secondary antibody for 2 h followed by developing withHRP substrate (Sigma-Aldrich, USA). The macrophage cells withoutany treatment or treated only with pinocembrin (200 mg/mL) wereconsidered as negative controls. Further, cells treated only with LPS(1 mg/mL) served as positive control.

Fig. 1. Effects of pinocembrin on cell viability in L. rohita macrophages. Cells were pre-treated with pinocembrin for 1 h, and then stimulated with LPS (1 mg/mL) for 24 h. Cellviability was examined using the MTT assay. Data are presented as mean ± SEM

2.9. Transient transfection and dual-luciferase assay

Macrophages were transfected with NF-kB-luc reporter plasmidusing FuGENE-6 reagent (Roche Applied Science) according tomanufacturer's instruction [22]. Renilla luciferase control plasmidpGL4.32 [luc2P/NF-kB-RE/Hygro (reporter gene: luc2A

A, reportergene promoter: NF-kB-RE) was co-transfected as an internal con-trol to correct for transfection efficiency. Twenty-four hours aftertransfection, the cells were incubated with the indicated reagentsfor 1 h and then treated with LPS (1 mg mL�1) for 24 h. Luciferaseactivity was evaluated using the dual-luciferase assay kit (Promega,USA) according to the manufacturer's instruction. Luminescencewas measured by using a microplate luminometer (Promega, USA).

Table 1Real-time primer sequences and thermocycling conditions.

Target gene Primer sequence (50e30) Thermocycling

IL-1b ATCTTGGAGAATGTGATCGAAGAGGATACGTTTTTGATCCTCAAGTGTGAAG

95 �C 30 s, 40

iNOS GGAGGTACGTCTGCGAGGAGGCTCCAGCGCTGCAAACCTATCATCCA

95 �C 30 s, 40

TNFa CCAGGCTTTCACTTCACGGCCATAGGAATCGGAGTAG

95 �C 30 s, 40

COX-2 ATCCTTACTCACTACAAAGGGCTGGTCCTTTCATGAAGTC

95 �C 30 s, 40

IL-10 AAGGAGGCCAGTGGCTCTGTCCTGAAGAAGAGGCTCTGT

95 �C 30 s, 40

GAPDH AGGGGCTCAGTATGTTGTGGCTCTCTTGGCACCACCCTTA

95 �C 30 s, 40

2.10. Statistical analysis

Each experiment was repeated at least thrice. Data were pre-sented asmean ± SEM of three individual samples (n¼ 3). One-wayANOVA was used to analyse the data using the OriginPro software(version: 8.0). For comparison between two groups, t-test was used,and differences were considered significant at P < 0.05.

3. Results

3.1. Effect of pinocembrin on cell viability

The effect of pinocembrin on cell viability is shown in Fig. 1. Theresult of the MTT assay confirmed that the inhibitory effect ofpinocembrin was not associated with its cytotoxicity. It was foundthat pinocembrin at concentrations between 50 and 200 mg mL�1

did not affect cell viability (Fig. 1).

3.2. Pinocembrin inhibits NO production by attenuating iNOSexpression in LPS-stimulated carp macrophages

Pinocembrin attenuated LPS-induced NO production in aconcentration-dependent manner (Fig. 2A). The effect of pino-cembrin on iNOSmRNA and protein levels was determined to verifywhether the inhibition of NO production was caused by thedecreased levels of iNOS mRNA and protein. The mRNA (Fig. 2B)and protein levels (Fig. 2C) of iNOS were suppressed by pinocem-brin in a concentration-dependent manner. Pinocembrin at a

condition Reference/Accession no.

cycles of 95 �C 5 s, 61.5 �C 30 s and 72 �C 30 s [20]

cycles of 95 �C 5 s, 61.1 �C 30 s and 72 �C 30 s [20]

cycles of 95 �C 5 s, 61.1 �C 30 s and 72 �C 30 s [20]

cycles of 95 �C 5 s, 60.5 �C 30 s and 72 �C 30 s [20]

cycles of 95 �C 5 s, 61.1 �C 30 s and 72 �C 30 s [20]

cycles of 95 �C 5 s, 60.5 �C 30 s and 72 �C 30 s AJ870982.1

(n ¼ 3).

Fig. 2. Effects of pinocembrin on LPS-induced NO production and mRNA and proteinexpressions of iNOS in L. rohita macrophages. Cells were pre-treated with pinocembrinfor 1 h, followed by LPS (1 mg/mL) stimulation for 24 h. (A) NO was measured in termsof the accumulation of its stable metabolite, nitrite, in a culture medium using Griessreagent. Data are presented as mean ± SEM (n ¼ 3). (B) Total RNA was isolated, andmRNA level of iNOS was measured by RT-PCR. Figure shows representative results ofthree independent experiments. GAPDH expression was used as an internal control forRT-PCR. (C) Cell lysates were extracted and protein level of iNOS was analysed bywestern blot. GAPDH was used as an internal control for western blot.

Fig. 3. Effects of pinocembrin on LPS-induced PGE2 production and mRNA and proteinexpressions of COX-2 in L. rohitamacrophages. Macrophage cells were pre-treated withpinocembrin for 1 h, and then subjected to stimulation with LPS for 24 h. (A) PGE2concentration was measured in a culture medium using a commercial ELISA kit. (B)Total RNA was isolated, and mRNA level of COX-2 was measured by RT-PCR. The figureshows representative results of three independent experiments. GAPDH expressionwas used as an internal control for RT-PCR. (C) Cell lysates were extracted and proteinlevel of COX-2 was analysed by western blot. GAPDH was used as an internal controlfor western blot.

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466462

concentration of 200 mg mL�1 resulted in the maximum inhibitionof LPS-induced NO production. This implies that pinocembrin in-hibits NO production at the transcriptional level of the iNOS gene inLPS-stimulated macrophages.

3.3. Pinocembrin inhibits PGE2 production by attenuating COX-2expression in LPS-stimulated carp macrophages

To evaluate whether pinocembrin could attenuate the produc-tion of LPS-induced PGE2 production in macrophages, the cellswere pre-treated with pinocembrin for 1 h, followed by LPS stim-ulation for 24 h. It was observed that untreated macrophages andmacrophages treated with pinocembrin alone produced basallevels of PGE2, while LPS stimulation induced PGE2 production(Fig. 3A). We assessed the effect of pinocembrin on LPS-inducedCOX-2 mRNA (Fig. 3B) and protein levels (Fig. 3C) and PGE2 pro-duction (Fig. 3A). Pinocembrin suppressed LPS-induced PGE2 pro-duction (Fig. 3A) and COX-2 protein expression (Fig. 3B) in aconcentration-dependent manner. Further, RT-PCR analysisshowed that COX-2 mRNA expression positively correlated with

COX-2 protein expression (Fig. 3C). These results suggest thatpinocembrin suppresses the production of PGE2 by inhibiting theexpression of COX-2 in LPS-stimulated macrophages.

3.4. Effect of pinocembrin on the production of pro- and anti-inflammatory cytokines in LPS-stimulated carp macrophages

To further investigate the anti-inflammatory effect of pino-cembrin on LPS-stimulated macrophages, the productions of pro-and anti-inflammatory cytokines were evaluated. Pinocembrinalone had no effect on the production of TNF-a (Fig. 4A), IL-1 b(Fig. 4B), and IL-10 (Fig. 4C) in carp macrophages. TNF-a and IL-1blevels increased in the culture media of LPS-stimulated macro-phages; however, pinocembrin pre-treatment significantly inhibi-ted the increase in the levels of TNF-a and IL-1b in a concentration-dependent manner. However, IL-10 level, which increased in theculture media, was further enhanced with pinocembrin pre-treatment. Further, the effect of pinocembrin on the transcriptionof TNF-a, IL-1b, and IL-10 was analysed (Fig. 4D). Untreated mac-rophages expressed detectable mRNA levels of TNF-a and IL-1b,

Fig. 4. Effect of pinocembrin on the production of TNF-a, IL-1b, and IL-10 in LPS-stimulated L. rohita macrophage cells. Macrophage cells were pre-treated with the indicatedconcentration of pinocembrin for 1 h, followed by LPS stimulation (1 mg/mL). Culture media were collected at 24 h, and the levels of TNF-a (A), IL-1b (B), and IL-10 (C) weremeasured using ELISA. Three independent experiments were performed, and the data are presented as mean ± S.E.M (n ¼ 3). (D) The macrophage cells were incubated withpinocembrin in the presence or absence of LPS for 24 h. Total RNAs were isolated, and mRNA levels of each cytokine were measured by RT-PCR. The figures show representativeresults of three independent experiments. GAPDH expression was used as an internal control for RT-PCR.

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466 463

which increased following LPS stimulation. Pinocembrin pre-treatment inhibited the expression of pro-inflammatory cytokinesand increased the mRNA expression of anti-inflammatory cytokineIL-10 in LPS-stimulated macrophages. These results suggest thatpinocembrin attenuated the increase in pro-inflammatory cyto-kines production by enhancing the production of anti-inflammatory cytokines in LPS-stimulated macrophages.

Fig. 5. Effects of pinocembrin on LPS-induced activation of MAPKs in L. rohita mac-rophages. Cells were pre-treated with various concentrations of pinocembrin for 1 hbefore incubating with LPS for 24 h. Phosphorylation levels of ERK, JNK, and p38MAPKs were determined by western blot analysis. GAPDH was used as an internalcontrol for western blot.

3.5. Effect of pinocembrin on the phosphorylation of MAPKs in LPS-stimulated carp macrophages

The phosphorylation of three MAPKs ERK, JNK, and p38 wasanalysed by western blot (Fig. 5). LPS stimulation rapidly (within30 min) induced the phosphorylation of ERK and JNK in macro-phages (Fig. 5). However, pinocembrin pre-treatment suppressedthe phosphorylation of ERK and JNK in a dose-dependent manner;while MAPKp38 activation was inhibited by pinocembrin at con-centrations of 100 and 200 mg mL�1. These results indicate thatpinocembrin blocks ERK and JNK signal transduction in activatedcarp macrophages.

3.6. Pinocembrin attenuates the degradation of IkBa and NF-kBactivation in LPS-stimulated carp macrophages

To investigate the molecular mechanism of pinocembrin-mediated iNOS and COX-2 protein inhibition, NF-kB transcrip-tional activity was investigated by using the luciferase assay. LPStreatment (24 h) caused a rapid increase (12-fold) in NF-kB

transcriptional activity (Fig. 6A). In cells co-treated with pinocem-brin, LPS-induced NF-kB transcriptional activity was significantlysuppressed in a concentration-dependent manner (Fig. 6A). How-ever, pinocembrin alone had no effect on NF-kB transcriptionalactivity. The transfected cells were 34.6 ± 1.9% and the percentageof cell survival after transfection using FuGENE was 60.84.

Since NF-kB regulates pro-inflammatory mediators in activatedmacrophages, we investigated whether pinocembrin inhibits the

Fig. 6. Pinocembrin suppressed LPS-induced IkB degradation and NF-kB activation inL. rohita macrophage cells. (A) Effects of pinocembrin on LPS-induced NF-kB tran-scriptional activity in HK macrophage cells. Cells were pre-treated with pinocembrinfor 1 h, and then subjected to LPS (1 mg/mL) stimulation for 24 h. Data are presented asmean ± SEM (n ¼ 3). (B) Macrophage cells were pre-treated with the indicated con-centration of FGLE for 1 h, followed by LPS treatment (1 mg/mL). The cells were har-vested at 1 h, and the cytosolic extract and nuclear extracts were prepared andsubjected to western blot for the detection of the phosphorylated or total forms of IkBaand the detection of the NF-kB p65 subunit, respectively.

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466464

NF-kB signalling pathway, which is implicated in the transcrip-tional regulation of inflammatory mediators in LPS-stimulatedmacrophages. The cytosolic IkBa and nuclear NF-kB p65 subunitlevels were analysed by western blot (Fig. 6B). LPS stimulationinduced IkBa degradation in the cytosol and NF-kBp65 trans-location into the nucleus of macrophages (Fig. 6B); however,pinocembrin treatment attenuated cytosolic IkBa degradation andnuclear NF-kB p65 levels in LPS-stimulated macrophages.

4. Discussion

Lipopolysaccharide is the major constituent of the external layerof the outer membrane of gram-negative bacteria. It consists ofthree components: lipid A, a core oligosaccharide, and an O-specificpolysaccharide (O-antigen) [23]. Lipid “A” is responsible for theinnate immune responses in mammals and confers the endotoxicproperties of LPS [24]. Mammalian cells are highly sensitive to theeffects of LPS, partially because of the facilitatory action of a serumprotein, known as LPS binding protein [25]. LPS is one of the moststudied PAMPs in mammals, which are recognised by toll-like re-ceptor 4 (TLR-4). In vertebrates, the immune response to LPStypically involves the release of pro-inflammatory cytokines, suchas TNF-a, IL-1b, and IL-6, which act at local sites of inflammationand modulate further host response [26].

However, fish and amphibians are immune to the toxic effects ofLPS. Fish lacks several co-stimulatory molecules and intra-cellularmediators that are involved in the action of LPS in mammals. Fishdo not possess CD14, Ly96, and TICAM2 molecules or a LPS bindingprotein-like factor in serum [23,27]. Interestingly, Danio rerio

appears to possess a TLR4 ortholog, while Takifugu rubripes andTetradon nigroviridis do not have a TLR4 ortholog [28]. At low doses,LPS induced immunomodulatory activities in fish and enhanced theprotection against diseases [29]. Dietary supplementationwith lowlevels of LPS from Escherichia coli 0111:B4 endotoxin enhanced theprotection of Oncorhynchus mykiss (Walbaum) against Aeromonashydrophila infection [29]. However, LPS at high doses (mg/mL) in-duces strong inflammatory responses in fish [30]. Further, LPS is astrong stimulator of macrophages and activates several signaltransduction pathways producing various inflammatory cytokinesin humans and animals, including fish [31]. LPS-stimulated cyto-kine expression has been reported in D. rerio, Paralichthys olivaceus,and Cyprinus carpio [26,32]. Currently, limited studies haveexplored the association of MAPKs in the innate immune responseto PAMPs in lower vertebrates.

Macrophages play a central role in acute and chronic inflam-matory responses [33]. LPS-stimulated macrophages induce theprotein expression of iNOS to produce NO [34]. NO assists theactivation of macrophages through signal transduction, therebyenhancing the ability of macrophages to kill microorganisms [33].However, excessive levels of NO generated by iNOS, have beenshown to exert cytotoxic effects in several inflammatory diseases,including atherosclerosis, rheumatoid arthritis, diabetes, septicshock, transplant rejection, and multiple sclerosis, leading to celldeath [35]. Hence, NO inhibitors can prevent several inflammatorydiseases. In the present study, pinocembrin effectively decreasedNO production by suppressing the mRNA and protein expression ofiNOS in LPS-stimulated L. rohita HK macrophages (Fig. 2B and C).Similarly, Panax notoginseng flower extract effectively decreased NOproduction by suppressing the mRNA and protein expressions ofiNOS in LPS-stimulated RAW264.7 cells [35]. Further, pinocembrininhibited LPS-induced NO production in microglial cells [12].

PGE2 is an inflammatory mediator generated at inflammatorysites by COX-2, and it contributes to the development of chronicinflammatory diseases, such as cardiovascular disease, cancer, andrheumatoid arthritis [36]. The overproduction of NO and PGE2 isassociated with the upregulation of iNOS and COX-2 [37]. In thepresent study, pinocembrin inhibited PGE2 production in LPS-stimulated HK macrophages by attenuating the mRNA and pro-tein levels of COX-2 (Fig. 3B and C). The current results areconsistent with previous findings in that pinocembrin dose-dependently inhibited LPS-induced production of inflammatorymediators, such as TNF-a, IL-1b, and PGE2. In addition, pinocembrininhibited LPS-induced COX-2 expression [12]. Alkaloid pseudo-coptisine isolated from the tubers of Corydalis turtschaninoviinhibited LPS-induced productions of iNOS and PGE2 at the mRNAand protein levels, and concomitantly decreased PGE2 and NOproduction in RAW 264.7 macrophage cells [38]. Our results werein agreement with previous studies, indicating that pinocembrincould be a potential inhibitor of iNOS and COX-2.

Several inflammatory cytokines, particularly TNF-a, IL-1b, andIL-6, play key roles in the induction and perpetuation of inflam-mation in macrophages. High levels of TNF-a could lead to tissueinjury, and even result in sepsis and death [39]. In the presentstudy, pinocembrin suppressed the release of TNF-a and IL-1b atthe mRNA and protein levels (Fig. 4A, B, and D). These resultsdemonstrated that pinocembrin could effectively inhibit the gen-eration of pro-inflammatory cytokines that are crucial in initiatingan inflammatory response in activated macrophages. Further,pinocembrin potentially upregulated IL-10 expression at the mRNAand protein levels in LPS-stimulated macrophages (Fig. 4C and D).IL-10 is considered to exhibit anti-inflammatory properties, owingto its potential to inhibit the capacity of monocyte/macrophagecells to secrete inflammatory mediators such as TNF-a, IL-1b, andIL-6 [40]. Soromou et al., [2012] reported that pinocembrin

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466 465

increased the protein and mRNA levels of IL-10 in vitro in RAWmacrophages. The anti-inflammatory action of IL-10 can interferewith the production of pro-inflammatory cytokines via the inhibi-tion of NF-kB activation by preserving the expression of IkB protein[4].

The MAPKs are a group of serine/threonine kinases that mediatesignal transduction from the cell surface to the nucleus [41]. TheMAPK family is composed of three members: extracellular signal-regulated kinase 1/2 (ERK1/2), p38, and c-jun NH2-terminal ki-nase (JNK). The activation of NF-kB is implicated in the MAPK sig-nalling pathway [4]. Furthermore, MAPKs have been implicated inthe transcriptional regulations of pro-inflammatory mediators,such as iNOS, COX-2, and TNF-a, in response to LPS [38]. In a recentstudy, we showed that LPS increases the phosphorylation andactivation of MAPKs in fish HK macrophages. Similarly, FGLE sup-pressed the phosphorylation of ERK, JNK, and p38 in LPS-stimulated fish HK macrophages [2]. It has been reported that theJNK pathway directly affects the expression of iNOS and COX-2 inthe cell nucleus [19]. As iNOS and COX-2 are modulated by NF-kBactivation, the present results suggest that pinocembrin inhibitedthe pro-inflammatory mediators by blocking NF-kB activation andsignalling via the JNK pathway (Fig. 5).

The binding of LPS tomacrophages induced TLR4 expression andresulted in the activation of inflammation-associated signallingpathways, including the NF-kB and MAPK pathways [34,42]. Inunstimulated cells, NF-kB is present in the cytosol as a homodimeror heterodimer, and in particular, it is linked to the inhibitoryprotein IkB. NF-kB activation results from the phosphorylation,ubiquitination, and proteasome-mediated degradation of inhibi-tory IkB proteins, followed by the nuclear translocation and DNAbinding of NF-kB [43,44]. Further, IkB kinase (IKK) complex con-tains two catalytic subunits, namely, IKK-a and IKK-b, which con-trols the activation of NF-kB via the phosphorylation of IkB-a andIkB-b [45]. Thus, in the present study, we investigated whetherpinocembrin could inhibit the degradation of IkB-a. Pinocembrinstrongly suppressed LPS-induced degradation of IkB-a anddecreased the nuclear levels of the NF-kB p65 subunit in LPS-stimulated HK macrophages (Fig. 6B). Our result suggests thatpinocembrin might inhibit NF-kB activation by suppressing LPS-induced degradation of IkB-a. The current result is consistentwith a previous study that reported pinocembrin inhibits LPS-induced NF-kB activation in BV2 microglial cells [12]. Addition-ally, pinocembrin significantly suppressed LPS-induced activationof JNK, p38/MAPK, and NF-kB in RAW macrophages cells as well asin male BALB/c mice [4]. Recently, we have shown that FLGE in-hibits LPS-induced NF-kB transcriptional activity in L. rohita HKmacrophages [2]. The flower extract of P. notoginseng has been re-ported to attenuate LPS-induced inflammatory response by sup-pressing the NF-kB signalling pathway in murine macrophages[19]. Furthermore, pseudocoptisine isolated from tubers of Coryd-alis turtschaninovi inhibits LPS-induced DNA binding activity andNF-kB transcription activity [44]. These results indicate that pino-cembrin blocks the MAPKs signal transduction pathways in acti-vated L. rohita HK macrophages.

Natural products that act on NF-kB transcription factor couldrepresent potential therapeutic drugs for cancer chemoprevention[46]. This study provided the evidence that pinocembrin signifi-cantly regulates the production of TNF-a, IL-1b, and IL-10 via theinhibition of MAPK and NF-kB activation in fish HK macrophages.Further, pinocembrin pre-treatment attenuated LPS-induced in-flammatory response in HK macrophages via the downregulationof the NF-kB pathway, revealing the partial molecular basis ofpinocembrin for anti-inflammatory response. The results suggestthat pinocembrin is a promising therapeutic agent for the treat-ment of inflammatory diseases in aquaculture species.

Acknowledgements

Authors gratefully acknowledge the research grant receivedfrom the National Research Foundation of Korea, Ministry of Edu-cation (NRF-2014R1A2A1A11050093). First author is thankful to‘Korea Research Fellowship’ program funded byMinistry of Science,ICT and Future Planning through National Research Foundation ofKorea (2016H1D3A1909005). SS Sen is a recipient of D.S. KothariPost-Doctoral Fellowship, UGC, GoI.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.fsi.2016.07.038.

References

[1] FAO, The State of World Fisheries and Aquaculture, 2012. ISBN 978-92-5-107225-7. Rome.

[2] S.S. Sen, V. Sukumaran, S.S. Giri, S.C. Park, Flavonoid fraction of guava leafextract attenuates lipopolysaccharide-induced inflammatory response viablocking of NF-kB signaling pathway in rohu macrophage cells, Fish. ShellfishImmunol. 47 (2015) 85e92.

[3] M.B. Furie, An overview of inflammation, in: Mitchell R. McManus (Ed.),Pathobiology of Human Disease, Academic Press, San Diego, 2014, pp.226e230. ISBN 9780123864574.

[4] L.W. Soromou, X. Chu, L.X. Jiang, M.M. Wei, M.X. Huo, N. Chen, S. Guan,X.F. Yang, C.Z. Chen, H.H. Feng, X.M. Deng, In vitro and in vivo protectionprovided by pinocembrin against lipopolysaccharide-induced inflammatoryresponses, Int. Immunopharmacol. 14 (2012) 66e74.

[5] X. Niu, Y. Wang, W. Li, H. Zhang, X. Wang, Q. Mu, Z. He, H. Yao, Esculinexhibited anti-inflammatory activities in vivo and regulated TNF-a and IL-6production in LPS-stimulated mouse peritoneal macrophages in vitrothrough MAPK pathway, Int. Immunopharmacol. 29 (2015) 779e786.

[6] P. Swain, S.K. Nayak, P.K. Nanda, S. Dash, Biological effects of bacterial lipo-polysaccharide (endotoxin) in fish: a review, Fish. Shellfish Immunol. 25(2008) 191e201.

[7] A. Rasul, F.M. Millimouno, W.B. Eltayb, M. Ali, J. Li, X. Li, Pinocembrin: a novelnatural compound with versatile pharmacological and biological activities,Biomed. Res. Int. (2013), http://dx.doi.org/10.1155/2013/379850. Article ID379850.

[8] G. Cao, P. Ying, B. Yan, W. Xue, K. Li, A. Shi, T. Sun, J. Yan, X. Hu, Pharmaco-kinetics, safety, and tolerability of single and multiple-doses of pinocembrininjection administered intravenously in healthy subjects, J. Ethnopharmacol.168 (2015) 31e36.

[9] M.A. Saad, R.M. Aldel Salam, S.A. Kenawy, A.S. Attia, Pinocembrin attenuateshippocampal inflammation, oxidative perturbations and apoptosis in a ratmodel of global cerebral ischemia, Pharamacol. Rep. 67 (2015) 115e122.

[10] D.A. Sampietro, M.M. Sampietro Vattuone, M.A. Vattuone, Immunomodula-tory activity of Apis mellifera propolis from the North of Argentina, LWT e

Food Sci. Technol. 70 (2016) 9e15.[11] L.W. Soromou, L.X. Jiang, M.M. Wei, N. Chen, M.X. Huo, X. Chu, W.T. Zhong,

Q.C. Wu, A. Balde, X.M. Deng, H.H. Feng, Protection of mice againstlipopolysaccharide-induced endotoxic shock by pinocembrin is correlatedwith regulation of cytokine secretion, J. Immunotoxicol. 11 (2014) 56e61.

[12] L-t Zhou, K-j. Wang, L. Li, L. Hui, M. Geng, Pinocembrin inhibitslipopolysaccharide-induced inflammatory mediators production in BV2microglial cells through suppression of 13K/Akt/NF-kB pathway, Eur. J.Pharmacol. 761 (2015) 211e216.

[13] L.L. Shi, B.N. Chen, M. Gao, H.A. Zhang, Y.J. Li, L. Wang, et al., The characteristicsof therapeutic effect of pinocembrin in transient global brain ischemia/reperfusion rats, Life Sci. 88 (2011) 521e528.

[14] S.S. Giri, S.S. Sen, V. Sukumaran, Effects dietary supplementation of potentialprobiotic Pseudomonas aeruginosa VSG2 on the innate immunity and diseaseresistance of tropical freshwater fish, Labeo rohita, Fish. Shellfish Immunol. 32(2012) 1135e1140.

[15] Q. Li, Q. Ai, K. Mai, W. Xu, Y. Zheng, A comparative study: In vitro effects of EPAand DHA on immune functions of head-kidney macrophages isolated fromlarge yellow croaker (Larmichthys crocea), Fish. Shellfish Immunol. 35 (2013)933e940.

[16] N.F. Neumann, D. Barreda, M. Belosevic, Production of a macrophage growthfactor(s) by a goldfish macrophage cell line and macrophages derived fromgoldfish kidney leukocytes, Dev. Comp. Immunol. 22 (1998) 417e432.

[17] C. Han, J. Jin, S. Xu, H. Liu, N. Li, X. Coa, Integrin CD11b negatively regulates TLRtriggered inflammatory responses by activating Syk and promoting degra-dation of MyD88 and TRIF via Cbl-b, Nat. Immunol. 11 (2010) 734e742.

[18] N. Verma, R. Chakrabarti, R.H. Das, H.K. Gautam, Anti-inflammatory effects ofshea butter through inhibition of iNOS, COX-2, and cytokines via the NF-kBpathway in Lps- activated J774 macrophage cells, J. Comp. Integr. Med. 9(2012). Article 4.

S.S. Giri et al. / Fish & Shellfish Immunology 56 (2016) 459e466466

[19] C.H. Jung, J.H. Kim, M.H. Hong, H.M. Seog, S.H. Oh, P.J. Lee, Phenolic-richfraction from Rhus verniciflua Stokes (RVS) suppress inflammatory responsevia NF-kB and JNK pathway in lipopolysaccharide-induced RAW264.7 mac-rophages, J. Ethnopharmacol. 110 (2007) 490e497.

[20] S.S. Giri, S.S. Sen, C. Chi, H.J. Kim, S. Yun, S.C. Park, V. Sukumaran, Effect ofguava leaves on the growth performance and cytokine gene expression ofLabeo rohita and its susceptibility to Aeromonas hydrophila infection, Fish.Shellfish Immunol. 46 (2015) 217e224.

[21] Y. Zheng, H. An, M. Yao, et al., Scaffolding adaptor protein Gab1 is required forTLR3/4- and RIG-I-mediated production of pro-inflammatory cytokines andtype I IFN in macrophages, J. Immunol. 184 (2010) 6447e6456.

[22] S.Y. Choi, J.H. Hwang, S.Y. Park, Y.J. Jin, H.C. Ko, S.W. Moon, S.J. Kim, Fermentedguava leaf extract inhibits LPS induced COX-2 and i-NOS expression in mousemacrophage cells by inhibition of transcription factor NF-kB, Phytother. Res.22 (2008) 1030e1034.

[23] S.A. MacKenzie, N. Roher, S. Boltana, F.W. Goetz, Peptidoglycan, not endo-toxin, is the key mediator of cytokine gene expression induced in rainbowtrout macrophages by crude LPS, Mol. Immunol. 47 (2010) 1450e1457.

[24] R.E. Bishop, Fundamentals of endotoxin structure and function, Contrib.Microbiol. 12 (2005) 1e27.

[25] P. Gallay, D. Heumann, R.D. Le, C. Barras, M.P. Glauser, Lipopolysaccharide-binding protein as a major plasma protein responsible for endotoxemic shock,Proc. Natl. Acad. Sci. U. S. A. 90 (1993) 9935e9938.

[26] S. Boltana, N. Roher, F.W. Goetz, S.A. MacKenzie, PAMPs, PRRs and the ge-nomics of gram negative bacterial recognition in fish, Dev. Comp. Immunol. 35(2011) 1195e1203.

[27] D.B. Iliev, J.C. Roach, S. Mackenzie, J.V. Planas, F.W. Goetz, Endotoxin recog-nition: in fish or not in fish? FEBS Lett. 579 (2005) 6519e6528.

[28] F. Leulier, B. Lemaitre, Toll-like receptorsdtaking an evolutionary approach,Nat. Rev. Genet. 9 (2008) 165e178.

[29] E.J. Nya, B. Austin, Use of bacterial lipopolysaccharide (LPS) as an immunos-timulant for the control of Aeromonas hydrophila infections in rainbow troutOncorhynchus mykiss (Walbaum), J. Appl. Microbiol. 108 (2010) 686e694.

[30] D.B. Iliev, C.Q. Liarte, S. MacKenzie, F.W. Goetz, Activation of rainbow trout(Oncorhynchus mykiss) mononuclear phagocytes by different pathogen asso-ciated molecular pattern (PAMP) bearing agents, Mol. Immunol. 42 (2005)1215e1223.

[31] I. Hirono, B.H. Nam, T. Kurobe, T. Aoki, Molecular cloning, characterization,and expression of TNF cDNA and gene from Japanese flounder Paralychthysolivaceus, J. Immunol. 165 (2000) 4423e4427.

[32] S.S. Giri, S.S. Sen, J.W. Jun, S.C. Park, V. Sukumaran, Heat-killed whole cellproducts of probiotic Pseudomonas aeruginosa VSG2 affect the cytokineexpression in vitro in the head-kidney macrophages of Labeo rohita, Fish.Shellfish Immunol. 50 (2016) 310e316.

[33] J.M. Olefsky, C.K. Glass, Macrophages, inflammation, and insulin resistance,

Annu. Rev. Physiol. 72 (2010) 219e246.[34] Y. Kobayashi, The regulatory role of nitric oxide in proinflammatory cytokine

expression during the induction and resolution of inflammation, J. Leukoc.Biol. 88 (2010) 1157e1162.

[35] H.-W. Jung, U.-K. Seob, J.-H. Kimic, K.-H. Leemd, Y.-K. Park, Flower extract ofPanax notoginseng attenuates lipopolysaccharide-induced inflammatoryresponse via blocking of NF-kB signaling pathway in murine macrophages,J. Ethnopharmacol. 122 (2009) 313e319.

[36] M.E. Rurini, R.N. Dubois, Cyclooxygenase-2: a therapeutic target, Annu. Rev.Med. 53 (2002) 35e57.

[37] Z. Liu, Y. Fan, Y. Wang, C. Han, Y. Pan, H. Huaang, Y. Ye, L. Luo, Z. Yin,Dipyrithione inhibits lipopolysaccharide-induced iNOS and COX-2 upregula-tion in macrophages and protects against endotoxic shock in mice, FEBS Lett.582 (2008) 1643e1650.

[38] K.-J. Yun, J.-S. Shin, J.-H. Choi, N.-I. Back, H.-J. Chung, K.-T. Lee, Quaternaryalkaloid, pseudocoptisine isolated from tubers of Corydalis turtschaninovi in-hibits LPS-induced nitric oxide, PGE2, and pro-inflammatory cytokines pro-duction via the down-regulation of NF-kB in RAW 264.7 murine macrophagecells, Int. Immunopharmacol. 9 (2009) 1323e1331.

[39] D.L. Chong, S. Sriskandan, Pro-inflammatory mechanisms in sepsis, Contrib.Microbiol. 17 (2011) 86e107.

[40] A.D. Foey, S.L. Parry, L.M. Williams, M. Feldmann, B.M. Foxwell, F.M. Brennan,Regulation of monocyte IL-10 synthesis by endogenous IL-1 and TNF-a: role ofthe p38 and p42/44 mitogen-activated protein kinases, J. Immunol. 160(1998) 920e928.

[41] M.H. Cobb, E.J. Goldsmith, How MAP kinases are regulated, J. Biol. Chem. 270(1995) 14843e14846.

[42] W.-T. Chang, W.-C. Huang, C.-J. Liou, Evaluation of the anti-inflammatory ef-fects of phloretin and phlorizin in lipopolysaccharide-stimulated mousemacrophages, Food Chem. 34 (2012) 972e979.

[43] M.S. Rodriguez, J. Thompson, R.T. Hay, C. Dargemont, Nuclear retention ofIkappaB alpha protects it from signal-induced degradation and inhibits nu-clear factor kappaB transcriptional activation, J. Biol. Chem. 274 (1999)9108e9115.

[44] K.-J. Yun, J.-Y. Kim, J.-B. Kim, K.-W. Lee, Inhibition of LPS-induced NO andPGE2 production by asiatic acid via NF-kB inactivation in RAW 264.7 mac-rophages: possible involvement of the IKK and MAPK pathways, Int. Immu-nopharmacol. 8 (2008) 431e441.

[45] H. Nakano, M. Shindo, S. Sakon, S. Nishinaka, M. Mihara, H. Yagita, et al.,Differential regulation of IkappaB kinase alpha and beta by two upstreamkinases, NF-kappaB-inducing kinase and mitogen-activated protein kinase/ERK kinase kinase-1, Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 3537e3542.

[46] S. Luqman, J.M. Pezzuto, NFkB: a promising target for natural products incancer chemoprevention, Phytother. Res. 24 (2010) 949e963.

本文献由“学霸图书馆-文献云下载”收集自网络，仅供学习交流使用。

学霸图书馆（www.xuebalib.com）是一个“整合众多图书馆数据库资源，

提供一站式文献检索和下载服务”的24 小时在线不限IP

图书馆。

图书馆致力于便利、促进学习与科研，提供最强文献下载服务。

图书馆导航：

图书馆首页 文献云下载 图书馆入口 外文数据库大全 疑难文献辅助工具