DNAVolume 5, Number 2, 1986Mary Ann Lieber!, Inc., PublishersPp. 129-136

Expression of Cloned Human Haptoglobin and-Antitrypsin Complementary DNAs

in Saccharomyces cerevisiaea^

ARIANE VAN DER STRATEN,* JEAN-CLAUDE FALQUE.t ROSETTE LORIAU,*ALEX BOLLEN,* and TERESA CABEZÓNt

ABSTRACT

Nucleotide sequences coding either for human preprohaptoglobin or for prohaptoglobin have been placedunder the control of yeast ARG3 expression signals. Recombinant plasmids pRIT12598 and pRIT12597 ex-

press the prepro- and the pro-form of a2ß haptoglobin respectively, but at very low levels. Comparison withthe expression of human pre- and mature «.-antitrypsin cDNAs, cloned in the same expression vector, re-

veals large differences in the levels of specific proteins produced in yeast, although specific mRNA levels are

similar. It is shown that presence or absence of the signal sequence in the cDNA constructions results in a 20-to 30-fold difference in the yields of heterologous products. However, since haptoglobin and a ^antitrypsinbehave differently, the difference in expression for prohaptoglobin compared with the expression of mature«,-antitrypsin is about three orders of magnitude. In addition, we provide evidence that glycosylation ofboth proteins can occur in yeast only when the signal sequence is present in the DNA constructions.

INTRODUCTION

Haptoglobin (Hp) and ai-antitrypsin (arAT) are twoglycoproteins synthesized in the liver and secreted into

the plasma. One of Hp's functional roles is to protect kid-neys from tissue destruction by binding hemoglobin irre-versibly following hemolysis. Hp also exhibits antiproteaseactivity and could act as a natural bacteriostatic agent (forreview, see Putnam, 1985). Cloning and sequencing of HpcDNA has demonstrated that a single mRNA encodes thea1 and ß polypeptides and that processing of the a2ß pre-cursor protein is accompanied by the release of a single ar-

ginine residue (van der Straten et ai, 1983, 1984). Thesefindings confirmed the strong similarity between Hp andserine proteases (Greer, 1980; Kurosky et ai, 1980).

cti-AT is an inhibitor of various proteases, but its maintarget is elastase, a protein involved in the degradation oflung tissues (for review, see Putnam, 1985). We previouslyreported the cloning of human «[-AT cDNA and its expres-sion in yeast (Bollen et ai, 1983; Cabezón et ai, 1984).Yeast and higher eukaryotes share many common featuresin the mechanisms controlling protein expression and co-or posttranslational processes (Blobel et ai, 1979; Doch-erty and Steiner, 1982). Thus, it appeared worthwhile to

compare the expression of two eukaryotic coding se-

quences, Hp and a,-AT, placed under the control of thesame yeast regulatory elements and to evaluate possible dif-ferences.

We report the construction of recombinant plasmids ex-

pressing prepro- and pro-Hp under the control of the yeastARG3 expression signals. We compare the levels of specificproducts obtained in these conditions to those measuredfor recombinant plasmids expressing pre- and mature «,-AT under the control of identical 5' and 3' regulatory se-

quences. We show that Hp cDNAs are poorly expressedwith respect to «i-AT coding sequences and that this largedifference is not due to variations in specific mRNA levels.In addition, we demonstrate that prepro-Hp and pre a,-ATare partially glycosylated in yeast.

MATERIALS AND METHODS

Plasmids, strains, and mediaPlasmids pULB1148 (van der Straten et ai, 1983) and

pRIT10779, pRIT10782, and pRIT10787 (Cabezón et ai,1984) have been described previously. E. coli K12 strainMM294 (endA, thr", hsr", hsmQ was used for bacterial

•Service for Applied Genetics, University of Brussels, 24 rue de l'Industrie, B-1400 Nivelles, Belgium.tMolecular Genetics Department, Smith Kline RIT, 89 rue de l'Institut, B-1330 Rixensart, Belgium.

129

130 VAN DER STRATEN ET AL.

transformation as described in Maniatis et ai (1982). LBmedium for E. coli growth was supplemented with the ap-propriate antibiotics for the selection of transformants.Yeast strain Icl697d (argj *, leu2) was grown in yeast nitro-gen base medium (Difco) supplemented with 4 pg of argi-nine per ml when needed. Transformation of yeasts wasdone as described in Hinnen et ai. (1978).

General methodsRestriction nucleases, T4 DNA polymerase, and T4

DNA ligase were purchased from Boehringer-MannheimBiochemicals or Amersham and used as recommended bythe manufacturer. Bal 31 and mung bean nucleases wereobtained from P-L Biochemicals and used as described inManiatis et ai (1982). Endoglycosidase H was obtainedfrom Miles Scientific and used as recommended by themanufacturer.

DNA sequencing was performed according to Maxamand Gilbert (1977). Colony hybridization experiments fol-low the procedure of Grunstein and Hogness (1975). TotalRNA from yeast cells harboring the various recombinantplasmids was prepared according to Warner and Goren-stein (1977). Separation of mRNA species, transfer to Bio-dine membranes, and hybridization with labeled probeswere performed as described by Thomas (1980).

Yeast extracts for immunodetection of Hp and a,-ATwere prepared as described by Cabezón et al. (1984). Ex-tracts were assayed for protein concentration using the pro-cedure of Lowry et ai (1951).

ImmunoassaysImmunodetection of Hp and a,-AT in cell extracts was

done using a micro-ELISA system described by Hérion etal. (1983). For the Hp assay, IgG fractions from rabbit anti-human Hp (Dako) and mouse anti-human Hp antiserumwere used. Assay for a,-AT used purified IgG fractionsfrom goat anti-human a,-AT (Immuno) and a peroxidase-labeled monoclonal anti-human a,-AT antibody (Hérion etai, 1984). Electrophoretic transfer blotting and immuno-detection for Hp characterization were done as describedby Bollen et al. (1984). Cell labeling and immunoprecipita-tion of ai-AT followed the protocol described by Julius etai (1984).

RESULTSRecombinant plasmids for expression of humanHp in yeast

Human <x2ß Hp is synthesized as a 406-amino-acid pre-cursor containing an 18-amino-acid signal sequence (vander Straten et ai, 1983, 1984). To express the precursor andthe proprotein, we constructed the following recombinantplasmids (Fig. 1, upper). Plasmid pULB1148 (van derStraten et ai, 1983) contains, as a Pst I insert, the cDNAcoding for human a2ß Hp including 6 bp of 5' and 176 bpof 3' noncoding sequence. This insert was isolated and

treated with Bal 31 to remove unnecessary nucleotides on

the 5' end of the cDNA. It was then ligated to the expres-sion vector pRIT 10779 previously treated with Nco I andT4 DNA polymerase. The mixture was used to transformE. coli MM294. Several plasmids carrying the insert in thecorrect orientation for expression were recovered and usedto transform the yeast strain Icl697d. Two plasmids were

selected for expression studies; pRIT12597 programs a pro-tein starting at the first codon of the a2ß sequence andpRIT 12598 a polypeptide beginning 14 codons upstream inthe signal sequence. Junctions between ARG3 and HpcDNAs sequences have been determined and are shown inFig. 1 (lower).

Expression of human HpThe yeast strain Icl697d was used as host for the recom-

binant plasmids pRIT 12597 and pRIT 12598. This strain isleaky for arginine (Delforge et al., 1975) and was grown atlow arginine concentration (4 pg/ml) to obtain maximumexpression levels of Hp. Transformants were analyzed forHp production as follows. Cell extracts were prepared andthen assayed in the amplified ELISA described previously(Hérion et ai, 1983). This assay, which allows detection oflow levels of Hp (down to 2 ng/ml), was calibrated using a

standard human Hp preparation and applied to serial dilu-tions of the yeast extracts. As seen in Table 1, both plas-mids, pRIT12597 and pRIT12598, direct the expression ofHp although at very low levels; the prepro form of Hp isnevertheless produced 30-fold more than the proprotein(0.085 versus 0.003 as percent of total soluble proteins).The products were characterized by NaDodS04-polyacryl-amide gel electrophoresis, Western blotting, and immuno-detection on the nitrocellulose blots. As seen in Fig. 2, a

single polypeptide of MW = 45 kD is detected in extractsof cells carrying pRIT 12597. Its molecular weight is consis-tent with that calculated from the DNA sequence of the un-

cleaved Hp a2ß proprotein. On the other hand, two poly-peptides of MW s 45 and 53 kD were detected in extractsof cells carrying pRIT12598, which codes for prepro-Hp(Fig. 3a).

Comparative expression of Hp and a^-ATcDNAs in yeast

Total cellular extracts were prepared from yeast carryingeither pRIT12597 (pro-Hp), pRIT12598 (prepro-Hp),pRIT10782 (pre a,-AT), or pRIT10787 (mature a,-AT) andthen assayed for the production of specific polypeptides byELISA. As shown in Table 1, large differences are found inthe production of Hp and at-AT. First, mature «,-AT isproduced roughly 20-fold more abundantly than the corre-

sponding preprotein, whereas pro-Hp is much less abun-dant (30-fold) than prepro-Hp. In addition, although thelevels of pre at-AT and prepro-Hp are similar (within a

twofold range), those of the corresponding proteins with-out the signal peptide are three orders of magnitude apart(2.74 versus 0.003% of total soluble proteins).

EXPRESSION OF cDNAs in YEAST

HIND m

t fï2 t ß fPstI BamHI Psi I

I-18

Met

-14

Cly

1

Val

142 12

Gin Arg Ile Leu

pULB1148 GGGATGACTGCCTTGJGGÂ]GCTGTCATTGCCCTCCTGCTCTGGGGACAGCTTTTTGCA|GTG| -Hpa2-CAG |cGg| ATC lere)—HpE

pRIT10779

pRIT12598

pRIT12597

.- mRNA start

catcaacttgtacactcgtta£c|atc|gatcc .

Ncol

. . . AedATGJCOA . . .

Gly-14. . . TCGTTACC]ÄTGbTG . . .

ValKa)

prepro-Hp

pro-Hp

FIG. 1. Construction of recombinant plasmids expressing human Hp in yeast. Upper. Outline of cloning steps. TheBal 31-treated Pst I fragment encoding Hp derived from pULBl 148, was inserted at the Nco I site of vector pRIT10779,overlapping the ATG initiation codon of the Arg3 promoter sequence. In pRIT12598, the insert results from a 27-bp Bal31 digestion and starts at the codon for Gly-14. In pRIT12597, the insert results from a 69-bp Bal 31 digestion and starts atthe first valine codon of the Hp a2ß sequence. In both constructions, the Nco I site overlapping the ATG initiation codonis reconstituted. Lower. Nucleotide sequences at the promotor-coding sequence junction in the different constructs.

To correlate the large differences in the production ofspecific proteins with possible variations at the transcrip-tional level, we determined the relative amount of specificmRNAs produced in yeast strains carrying the various re-combinant plasmids. (The plasmids are maintained in thehost at the same copy number, data not shown.) TotalRNAs were fractionated on agarose gels in denaturing con-

ditions, transferred onto nitrocellulose filters, and hybrid-ized with 32P-labeled Hp, cti-AT, and Leu2 DNA probes(the DNA fragments are of similar size and labeled to thesame specific activity). Since the Leu2 gene is present on

the vector, it can be taken as a reference to measure thetranscription level for the cloned Hp and a,-AT cDNA se-

quences. Densitometry of the autoradiograms (Fig. 4) al-lowed measurement of relative ratios of specific mRNAswith respect to the control Leu2 species. Pro-Hp mRNAappears to be threefold less abundant than prepro-HpmRNA whereas mature a¡-AT mRNA is fourfold moreabundant than the pre-at-AT species (Table 1). These vari-ations are relatively small and are unlikely to account forthe large differences measured for the accumulation of Hpand a,-AT in yeast.

132 VAN DER STRATEN ET AL.

Table 1. Comparison Between Human Hp and «,-AT cDNAs Expressed in Yeast

Plasmid Coding Seguence

Concentration ofHeterologous Proteins

(ng/ml)% Total

Soluble Proteins3

Relative Yield ofHeterologous

ProteinRelative Levels ofSpecific mRNAs

pRIT 10779

pRIT12597pRIT12598pRIT10782pRIT10787

pro-Hpa2/3prepro-Hpa2/3pre-a,-ATmature a,-AT

<360

1,7003,350

54,800

0.0030.0850.172.74

128

57913

0.51.5

0.251

All coding sequences are under the control of the ARG3 promotor; the same yeast strain, Icl697d, was used throughout the experi-ments. The protein concentration in the extracts was adjusted to 2 mg/ml. Relative yields of heterologous proteins were calculated withrespect to the production of pro-Hp. Specific mRNA levels were measured by densitometry and normalized to the level of control Leu2mRNA. Relative values are measured with respect to mature a,-AT mRNA; in this case, levels of heterologous and control mRNAs are

equivalent.aYeast extracts derive from disruption in a French pressure cell; insoluble material, dissolved in 1 % NaDodS04/6 M urea and analyzed

on NaDodSO„-polyacrylamide gels, contained less than 25% of the total amount of Hp or «,-AT present in whole cells (data not shown).

HPq2ß45k "

.43k

.42kjx

.25.7k

.17ktiQ

FIG. 2. Characterization of Hp in yeast extracts. Yeastextracts were analyzed on 15% NaDodS04-polyacrylamidegels (Laemmli, 1970). Proteins were then electrically trans-ferred onto nitrocellulose sheets and reacted with mouseanti-human Hp serum followed by treatment with peroxi-dase-labeled goat anti-mouse serum and the chromogenicsubstrate (Bollen et ai, 1983). Lane 1, pRIT12597 (pro-Hp); lane 2, pRIT10779 (control); lane 3, commercial hu-man Hp standard (500 ng). Molecular weights (in kilodal-tons) of standards (right) and of pro-Hp produced in yeast(left) are indicated by arrows.

Glycosylation of Hp and at-A T in yeastPre-cxi-AT cDNA cloned in yeast is expressed as several

polypeptides specifically recognized by antiserum raisedagainst at-AT (Cabezón et ai, 1984). In addition to a poly-peptide corresponding to unglycosylated pre-a,-AT (47,000daltons), the experiment revealed two species of higher mo-lecular weight (51 and 53 kD). These heavy species couldresult from partial glycosylation of avAT in yeast. A simi-lar situation is found for Hp; expression of the cDNA cod-ing for prepro-Hp results in the production of a 45-kDmolecule which fits the calculated MW for unglycosylated(pre)pro-Hp, and of a 53-kD polypeptide which could alsoderive from glycosylation. To check this hypothesis, wetreated appropriate samples with endoglycosidase H, an en-

zyme known to hydrolyse oligosaccharide side-chains ofglycoproteins, then performed immunodetection on nitro-cellulose blots (in the case of Hp) or autoradiography ofimmunoprecipitated labeled proteins (in the case of c*,-

AT). As shown in Fig. 3, a and b, for both Hp and a,-AT,heavy MW species disappear, totally or partially, aftertreatment with endoglycosidase H and a marked increase inthe product corresponding to the unglycosylated form oc-

DISCUSSION

Two recombinant plasmids, pRIT12597 and pRIT12598,which carry the yeast ARG3 regulatory elements, expresshuman a2ß Hp in yeasts either as a proprotein or as a pre-pro-species, respectively. In comparison with expressionlevels of human a,-AT cDNAs, cloned in the same expres-sion vector, Hp polypeptides are produced rather poorly.

In constructions with signal sequences, a twofold differ-ence is found between the production of pre-cti-AT andprepro-Hp. However, suppression of the signal sequencesin these constructions increases the level of cc-AT by a fac-tor of 15 and, conversely, decreases the level of Hp -30-fold. Consequently, mature «i-AT is expressed - 103-foldmore than pro-Hp. However, the level of Hp could have

EXPRESSION OF cDNAs in YEAST 133

53k

45k

-•—43k

46 k.

66k

257k

.53K

.51 K

^-47 K

FIG. 3. Glycosylation of human Hp and a,-AT in yeast. a. Hp. Immunodetection of haptoglobin in extracts of yeastcarrying pRIT12598. Aliquots were incubated with endoglycosidase H (Julius et ai, 1984) before analysis on NaDodS04-polyacrylamide gels and Western blotting. Lane 1, pRIT12598; lane 2, pRIT12598 treated with endoglycosidase H; lane3, pRIT12597 (pro-Hp); lane 4, pRIT10779, control. MW standards are indicated on the right side of the figure. Arrows,on the left, point to unglycosylated Hp (45 kD) and to the glycosylated product (53 kD). Other bands on the blot appearedto be artifacts, and their intensity varies from experiment to experiment, b. a,-AT. [35S]Methionine-labeled proteinsfrom yeasts carrying pRIT10782 were immunoprecipitated with goat antihuman cxi-AT. Aliquots of the immunoprecipi-tates were treated with endoglycosidase H (Julius et ai, 1984). Samples were then analyzed on polyacrylamide gels andautoradiographed. Lane 1, MW standard (ovalbumin); lane 2, untreated control; lane 3, pRIT10782 treated with endo-glycosidase H. MW of oii-AT polypeptides are indicated by arrows on the right side of the figure. The 53- and 51-kD spe-cies correspond to glycosylated products; the 47-kD polypeptide is the nonglycosylated precursor.

134 VAN DER STRATEN ET AL.

2000—

1500—

1210—

FIG. 4. Analysis of Hp and ce,-AT mRNAs in yeast. Total RNA from yeast strain Icl697d harboring pRIT10787,pRIT10782, pRIT12597, and pRIT12598 was prepared by the LiCl method (Warner and Gorenstein, 1977). Separation ofmRNA species, transfer to biodine membranes and hybridization with labeled probes was performed as described byThomas (1980). DNA fragments of almost identical size were chosen as probes. Specific activity of each probe was 7.2 x107 cpm//*g and used at a concentration of 21 ng/ml in the hybridization mix. The Hp probe corresponds to a Pst l-BamHI cDNA fragment of 480 bp; the a,-AT probe corresponds to a Ava 1-BstE II cDNA fragment of 450 bp and the Leu2probe corresponds to a BstE ll-Eco RI gene fragment of 542 bp. The autoradiogram was obtained from a 1-week North-ern blot exposure; it displays the pattern of heterologous and Leu2 mRNAs in each yeast strain. Specific mRNA length areindicated in brackets. Lane 1, pRIT10787 (1580 b); lane 2, pRIT12598 (1710 b); lane 3, pRIT12597 (1650 b); lane 4,pRIT10782 (1650 b). The sizes of the DNA standards are indicated on the left (in bp). On the right side, the arrow indi-cates the control Leu2 mRNA.

been underestimated in the immunoassay, since the mi-crobially produced material (uncleaved precursor) is struc-turally different from the natural product, and thus couldbe recognized less efficiently by the antibodies. We alsoconsidered the possibility that Hp could be partially insolu-ble when made in yeast and thus underestimated; however,this possibility seems to be excluded since we could detectno difference in the amount of pellet-bound Hp or at-AT(data not shown).

The use of a peptidase-deficient strain as host for the re-combinant plasmids did not lead to increases in Hp produc-tion; this indicates that nonspecific protein degradationdoes not occur in the original host and, thus, that Hp wasnot underestimated in this respect (data not shown). Whenthe cDNA coding only for the ß-chain of Hp was cloned inthe expression vector pRIT 10779 and expressed in yeasts,no significant increase in the production of Hp-like poly-peptides was apparent, indicating that the Hp«2 sequence isnot responsible for the poor expression of Hp in yeasts(data not shown).

The codon bias index according to yeast codon selection(Bennetzen and Hall, 1982) was calculated for both a,-ATand Hp cDNAs. The values, close to zero, indicate an al-most random choice of codons, slightly positively biasedfor a.-AT (0.14) and negatively biased for Hp (-0.044).Therefore, codon bias might contribute slightly to the dif-ference observed between the production of a,-AT andHp.

The relative amounts of heterologous mRNAs were mea-

sured in comparison to the level of a control mRNA (Leu2)in the yeast strains carrying various constructions for ex-

pression of Hp and a,-AT cDNAs. All specific mRNA lev-els are similar and range within a ratio of 0.25-1.5.Variations in the protein yields therefore cannot result en-

tirely from differences at the level of transcription. Otherreports have recently described large variations between theprecursor and mature forms of heterologous proteins pro-duced in yeast, although similar specific RNA values werefound (Mellor et ai, 1983). Roberts et al. (1984) comparedthe expression of several heterologous genes in yeast, anddescribe variations in expression levels but no differencesbetween the expressed genes at the RNA level.

The different yields observed between pre- and maturea,-AT, prepro- and pro-Hp, and between Hp and a,-ATexpressed in yeast, therefore, could be explained in termsof protein instability or variation in turnover rates deter-mined by intrinsic properties of the molecules and cellularlocalization. Moreover, some slowing could occur duringtranslation, corresponding to the codon bias or to an envi-ronment 3' to the ATG which could be less favorable in thecase of Hp-coding sequences. Finally, an unfavorable sec-

ondary structure in the mRNA transcribed from some ofthe constructions could also prevent efficient expression ofHp in yeast.

Immunoblotting experiments revealed that cells carryingpRIT12597 express Hp as a 45-kD polypeptide, in agree-ment with the calculated molecular weight of unglycosyl-ated pro a2ß Hp. In contrast, two polypeptides reacting

EXPRESSION OF cDNAs in YEAST 135

with antibodies to Hp are detected in cells carryingpRIT12598: a 45-kD species which could be the prepropro-tein and a 53-kD molecule. Since in our constructions, pre-pro-Hp and pro-Hp differ by only 14 codons, it is not pos-sible to determine from the immunoblot data whether the1.5-kD signal sequence has been processed from the ungly-cosylated 45-kD species in pRIT 12598. This situation issimilar to the one encountered for yeast cells expressing re-

combinant human cti-AT. Pre-ai-AT was found to be syn-thesized as a 47-kD molecule, corresponding to the pre-protein, and as two heavier species of 51 and 53 kD,respectively (Cabezón et ai, 1984).

The high MW polypeptides, 53 kD in the case of prepro-Hp, 51 and 53 kD in the case of pre-a,-AT, are very proba-bly different glycosylated forms of these proteins as shownby treatment of the extracts with endoglycosidase H. In thecase of cti-AT, the 53-kD species disappears totally and the51-kD species remains, although attenuated, after treat-ment with Endo H; this can be explained by an incompleteenzymatic digestion. The presence of the signal sequence isthus required for glycosylation of a,-AT and Hp; theseproteins must therefore have entered into the secretorypathway since core oligosaccharide glycosylation occurs

during passage through the endoplasmic reticulum (Schek-man and Novick, 1982). Incomplete processing of the pre-proteins could be due to intrinsic properties of the mole-cules or to strain variations. This hypothesis is supportedby the fact that neither a,-AT nor Hp could be detected inthe culture medium (data not shown).

ACKNOWLEDGMENTS

A. vdS. thanks Dr. M. De Wilde (Smith Kline RIT) forgenerous hospitality in his laboratory and C. de Buyl and J.Jottard for preparing the manuscript.

A. vdS. is an IRSIA grantee and A.B. is Chargé deCours associé at the Fonds National de la Recherche Scien-tifique (Belgium). Work performed at Smith Kline RITwas, in part, funded by IRSIA. Pro-Hp expression fromyeast cells carrying recombinant plasmid pRIT 12597 was

briefly presented in a symposium at Bratislava, Czechoslo-vakia (van der Straten et ai, 1984b).

REFERENCES

BENNETZEN, J.L., and HALL, B.D. (1982). Codon selection inyeast. J. Biol. Chem. 257, 3026-3031.

BLOBEL, G., WALTER, P., CHANG, C.N., GOLDMAN,B.M., ERICKSON, A.H., and LINGAPPA, V.R. (1979).Translocation of proteins across membranes: The signal hy-pothesis and beyond. In Symposium of the Society of Experi-mental Biology (Great-Britain). C.R. Hopkins and C.J. Dun-can, Eds. (Cambridge University Press, London) 33, pp. 9-36.

BOLLEN, A., HERZOG, A., CRAVADOR, A., HERION, P.,CHUCHANA, P., van der STRATEN, A., LORIAU, R.,JACOBS, P., and VAN ELSEN, A. (1983). Cloning and ex-

pression in E. coli of full-length complementary DNA codingfor human «i-antitrypsin. DNA 2, 255-264.

BOLLEN, A., LORIAU, R., HERZOG, A., and HERION, P.(1984). Expression of human a,-antitrypsin in E. coli. FEBSLett. 166, 67-70.

CABEZÓN, T., DE WILDE, M., HERION, P., LORIAU, R.,and BOLLEN, A. (1984). Expression of human ct,-antitrypsincDNA in the yeast Saccharomyces cerevisae. Proc. Nati. Acad.Sei. USA 81, 6594-6598.

DELFORGE, J., MESSENGUY, F., and WIAME, J.M. (1975).The regulation of arginine biosynthesis in S. cerevisiae. Eur. J.Biochem. 57, 231-239.

DOCHERTY, K., and STEINER, D.F. (1982). Post-translationalproteolysis in polypeptide hormone biosynthesis. Ann. Rev.Physiol. 44, 625-638.

GREER, J. (1980). Model for haptoglobin heavy chain basedupon structural homology. Proc. Nati. Acad. Sei. USA 77,3393-3397.

GRUNSTEIN, M., and HOGNESS, D. (1975). Colony hybridiza-tion: A method for the isolation of cloned DNAs that contain a

specific gene. Proc. Nati. Acad. Sei. USA 72, 3961-3965.HERION, P., PORTETELLE, D., FRANSSEN, J.-D., UR-

BAIN, J., and BOLLEN, A. (1983). Solid phase enzyme immu-noassay of urokinase using monoclonal antibodies. BioscienceRep. 3, 381-388.

HERION, P., SIBERDT, D., FRANCOTTE, M., URBAIN, J.and BOLLEN, A. (1984). Monoclonal antibodies againstplasma protease inhibitors: II. Production and characterizationof 25 monoclonal antibodies against human a,-antitrypsin. Cor-relation between antigenic structure and functional sites. Biosci-ence Rep. 4, 139-147.

HINNEN, A., HICKS, J.B., and FINK, G.R. (1978). Transfor-mation of yeast. Proc. Nati. Acad. Sei. USA 72, 3961-3965.

JULIUS, D., SCHEKMAN, R., and THORNER, J. (1984). Gly-cosylation and processing of prepro-tx-factor through the yeastsecretory pathway. Cell 36, 309-318.

KUROSKY, A., BARNETT, D.R., LEE, T.H., TOUCHSTONE,B., HAY, R.E., ARNOTT, M., BOWMAN, B., and FITCH,W.M. (1980). Covalent structure of human haptoglobin: A se-rine protease homolog. Proc. Nati. Acad. Sei. USA 77, 3388-3392.

LAEMMLI, U.K. (1970). Cleavage of structural proteins duringthe assembly of the head of the bacteriophage T4. Nature 227,680-685.

LOWRY, O., ROSEBROUGH, N., FARR, A., and RANDALL,R. (1951). Protein measurement with the Folin phenol reagent.J. Biol. Chem. 193, 265-275.

MANIATIS, T., FRITSCH, E.F., and SAMBROOK, J. (1982).Molecular Cloning: A Laboratory Manual. (Cold Spring Har-bor Laboratory, Cold Spring Harbor, New York.)

MAXAM, A.M., and GILBERT, W. (1977). A new method forsequencing DNA. Proc. Nati. Acad. Sei. USA 74, 560-564.

MELLOR, J., DOBSON, M.J., ROBERTS, N.A., TUITE, M.F.EMTAGE, J.S., WHITE, S., LOWE, P.A., PATEL, T.,KINGSMAN, A.J., and KINGSMAN, S.M. (1983). Efficientsynthesis of enzymatically active calf chymosin in Saccharomy-ces cerevisiae. Gene 24, 1-14.

PUTNAM, F.W., Ed. (1985). The Plasma Proteins, Vol. IV.(Academic Press, New York).

ROBERTS, N.A., MELLOR, E.J., DOBSON, M.J., KINGS-MAN, S.M., and KINGSMAN, A.J. (1984). A comparison ofheterologous gene expression in S. cerevisiae. In 12th Interna-tional Conference on Yeast Genetics and Molecular Biology,Edinburgh, p. 148.

SCHEKMAN, R., and NOVICK, P. (1982). The secretory processand yeast cell-surface assembly. In 77¡e Molecular Biology ofthe Yeast Saccharomyces. Metabolism and Gene Expression.J.N. Strathern, E.W. Jones, and J.R. Broach, Eds. (Cold

136 VAN DER STRATEN ET AL.

Spring Harbor Laboratory, Cold Spring Harbor, New York)pp. 361-398.

THOMAS, P.S. (1980). Hybridization of denatured RNA andsmall DNA fragments transferred to nitrocellulose. Proc. Nati.Acad. Sei. USA 77, 5201-5205.

van der STRATEN, A., HERZOG, A., JACOBS, P., CABE-ZÓN, T., and BOLLEN, A. (1983). Molecular cloning of hu-man haptoglobin cDNA: Evidence for a single mRNA codingfor a and ß chains. EMBO J. 2, 1003-1007.

van der STRATEN, A., HERZOG, A., CABEZÓN, T., andBOLLEN, A. (1984a). Characterization of human haptoglobincDNAs coding for a2?sß and aiSß variants. FEBS Lett. 168,103-107.

van der STRATEN, A., HERZOG, A., JACOBS, P., CABE-ZÓN, T., and BOLLEN, A. (1984b). Molecular cloning of hu-man haptoglobin cDNA: Evidence for a single mRNA coding

for a and ß chains. In Metabolism and Enzymology of NucleicAcids Including Gene Manipulations, Vol. 5. Zalinka andBalan, Eds. (Publ. House Slovak Acad. Sciences, Bratislava)pp. 239-248.

WARNER, J.R., and GORENSTEIN, C. (1977). The synthesis ofeucaryotic ribosomal proteins in vitro. Cell 11, 201-212.

Address reprint requests to:Dr. Alex Bollen

Service for Applied GeneticsUniversity of Brussels 24 rue de l'Industrie

B-1400 Nivelles, Belgium

Received for publication June 3, 1985, and in revised formNovember 27, 1985.