Estradiol decreases taurine level by reducing cysteine sulfinic acid decarboxylase via the estrogen...

Estradiol decreases taurine level by reducing cysteine 1

sulfinic acid decarboxylase via the estrogen 2

receptor-alpha in female mice liver 3

4

Qiwang Ma*, Jianjun Zhao*, Wei Cao, Jiali Liu, and Sheng Cui 5

6

State Key Laboratory of Agrobiotechnology, College of Biological Sciences, China 7

Agricultural University, Beijing, People’s Republic of China 8

9

*Qiwang Ma and *Jianjun Zhao contributed equally to this work. 10

11

Address for reprint requests and other correspondence: Sheng Cui, College of Biology 12

Sciences, China Agricultural University, Beijing, People’s Republic of China. (e-mail: 13

[email protected]). 14

15

Cysteine sulfinic acid decarboxylase (CSAD) and cysteine dioxygenase (CDO) are 16

two rate-limiting enzyme in taurine de novo synthesis and their expressions are 17

associated with estrogen concentration. The present study was designed to determine 18

Articles in PresS. Am J Physiol Gastrointest Liver Physiol (November 13, 2014). doi:10.1152/ajpgi.00107.2014

Copyright © 2014 by the American Physiological Society.

ESTRADIOL REDUCES CSAD AND TAURINE THROUGH ERα IN THE LIVER

2

the relationship between 17-β-estradiol (E2) and taurine in female mice liver. We 19

initially observed the mice had lower levels of CSAD, CDO and taurine during estrus 20

than diestrus. We then respectively treated the ovariectomized mice, the cultured 21

hepatocytes, and HepG2 cells with different doses of E2, and the CSAD, CDO 22

expressions and taurine levels were analyzed. The results showed that E2 decreased 23

taurine level in the serum and the cultured cells by inhibiting CSAD and CDO 24

expressions. Further, we identified the molecular receptor types through which E2 25

plays its role in regulating taurine synthesis, and our results showed that estrogen 26

receptor-alpha (ERα) expression was much higher than estrogen receptor-beta (ERβ) 27

in the liver and hepatocytes, and the inhibiting effects of E2 on CSAD, CDO and 28

taurine level were partially abrogated in the ICI 182,780 pretreated liver and 29

hepatocytes, and in ERα knockout mice. These results indicate that estradiol decreases 30

taurine content by reducing taurine biosynthetic enzymes expression in mice liver. 31

32

estradiol; estrogen receptors; CSAD; CDO; taurine 33

34

TAURINE (2-aminoethanesulfonic acid), one metabolic product of cysteine, is a very 35

abundant amino acid in mice (20), and it has been detected in several organs including 36


3

the liver (8, 42). Tissue taurine concentration vary considerably such as about 20 37

μmol/g of taurine measured in the mouse liver (23), whereas about 2 μmol/g of taurine 38

found in mouse mammary glands (44). Hepatic taurine contributes the majority of 39

total body taurine due to its high taurine de novo synthesis capacity plus with a large 40

organ mass. Previous works have documented the functional effects of taurine in the 41

liver, such as promoting taurocholate formation (4), reducing oxidative stress (35), and 42

decreasing liver fibrosis (36). 43

Taurine de novo biosynthesis is mainly through two rate-limited enzyme, cysteine 44

dioxygenase (CDO; EC 1.13.11.20) and cysteine sulfinic acid decarboxylase (CSAD; 45

EC 4.1.1.29). The uptake and excretion of taurine in the liver are via the 46

sodium/chloride-dependent taurine transporter (TauT; SLC6A6). These genes express 47

in numerous organs including the liver (29, 34, 45). However, taurine transporter plays 48

the minor role in the hepatocyte (45). Taurine biosynthetic enzymes activity in the 49

liver is much higher than other organs (10, 40), and between these two enzymes, 50

CSAD behaves a much direct relation to taurine concentration than CDO (39, 41). 51

Body taurine homeostasis is mainly rely on these genes expression. 52

Estrogen is an important reproductive hormone. In the liver, estrogen and ERs are 53

involve in bile formation (12), oxidative stress moderating (2), and liver fibrosis 54


4

progress (7). Besides that, its concentration is associated with CSAD and taurine levels 55

in the liver and other organs (19, 28, 44). In female rat liver, estrogen could reduce the 56

decarboxylation of cysteine sulfinic acid (5). But beyond that, it is needed to be 57

revealed that whether estrogen also adjusting another taurine biosynthetic enzymes, 58

CDO, expression. Also, the receptor via which estrogen exert its function is also 59

elusive. So the precise relationship between estrogen and taurine biosynthesis in 60

female mice is needed to be elucidated. 61

Another metabolic product of cysteine is glutathione (GSH), which is closely 62

related to the intracellular cysteine level in the liver (30). Its content is also interfered 63

by the estradiol (37). GSH has many beneficial effects in the liver including reducing 64

oxidative stress and slowing liver fibrosis process (15). Since taurine, taurine 65

biosynthetic enzymes, GSH and E2 all have related functions in the liver, so we focus 66

our study on investigating their interconnection. 67

To determine whether E2 regulates the expression level of liver taurine 68

biosynthetic enzymes, and to investigate which receptor mediates this regulation, and 69

also to further explore whether the expression level of taurine biosynthetic enzymes 70

has influence on intracellular GSH, we initially analyzed taurine biosynthetic enzymes 71

and taurine levels in the liver, primary hepatocytes and HepG2 cells treated with E2. 72


5

We then used an estrogen receptor antagonist and the ERs knockout mice to determine 73

the receptor mediating this regulating. Finally, we examined the relation between 74

taurine biosynthetic enzymes expression level and intracellular GSH level in HepG2 75

cells. The collective results of the present study indicate that E2 decreases taurine level 76

by reducing taurine biosynthetic enzymes expression via the estrogen receptor-alpha in 77

female mice liver. 78

79

MATERIALS AND METHODS 80

81

Reagents. 17-β-estradiol (E2), taurine, type I collagenase, type IV collagenase, 82

insulin, CaCl2, disodium selenite, phenol red-free Dulbecco's modified Eagle’s 83

medium (DMEM), trypan blue, transferrin, dexamethasone, fetal bovine albumin 84

(FBA), nitro blue tetrazolium (NBT), 5-bromo-4-chloro-3-indolyl phosphate (BCIP), 85

EDTA, phthaldialdehyde (OPA), 2-hydroxy-1-etanethiol, diaminobenzidine, 86

β-estradiol 6-(O-carboxymethyl) oxime, bovine serum albumin (E2-BSA), and 87

anti-GAPDH antibody were purchased from Sigma-Aldrich Chemical Company 88

(Sigma, St. Louis, MO, USA). CDO antibody was purchased from Abcam (Cambridge, 89

MA, USA). Antibodies of Glutamate cysteine ligase catalytic subunit (GCLC) and 90


6

Glutamate cysteine ligase modifier subunit (GCLM) were purchase from Protein Tech 91

Group (Chicago, IL, USA). All other chemicals were purchased from Sinopharm 92

Chemical Reagent Co., Ltd (Beijing, PR China). 93

Animals and treatments. Adult female C57BL/6 mice were used and all the 94

animal experiments were approved by the Chinese Association for Laboratory Animal 95

Science. The mice weight were 25±1 g and were housed at 24±2 ℃, relative humidity 96

of 55±15%, and kept in clean cages under 14–h/10–h light–dark cycle and fed with 97

standard rodent chow. Estrus cycle was determined by microscopic identification of 98

vaginal smears. Female wild type (WT) mice and ERα KO mice underwent bilateral 99

ovariectomy (OVX). Experiments were performed 3 weeks after the procedure. The 100

OVX mice were treated with varying doses of E2 by intraperitoneal injection. After E2 101

treatment, the mice were then sacrificed by cervical fracture. Their blood was 102

collected and stored at 4˚C overnight for serum collection. The left lateral lobe of the 103

liver was collected, and one part was fixed in 4% (wt/vol) paraformaldehyde (PFA) 104

diluted in phosphate buffered saline (PBS, pH 7.4) for immunohistochemistry. The rest 105

of the liver was immediately frozen in liquid nitrogen for CSAD, CDO and taurine 106

detection. The ERs KO mice were purchased from Jackson laboratory. The ERα KO 107

allele symbol is B6.129P2-Esr1tm1Ksk/J. The estrogen receptor-beta knockout (ERβ KO) 108


7

allele symbol is B6.129P2-Esr2tm1Unc/J. Genotype identification was performed by 109

separated polymerase chain reaction (PCR) with specific primers as shown in Table 1. 110

Mouse primary hepatocytes culture. The hepatocytes isolation was followed an 111

adoption of a modified two-step collagenase perfusion technique (25). Briefly, we 112

perfused into inferior vena cava calcium and magnesium-free D-Hanks' Balanced Salt 113

Solution (D-HBSS, pH 7.4) containing 1 mM EDTA followed by serum-free Williams’ 114

medium E solution (Gibco, Grand Island, NY, USA) supplemented with 0.1% (wt/vol) 115

collagenase type I, 0.1% (wt/vol) type IV and 1 mM CaCl2. The crude hepatocytes 116

were collected by a mechanical operation, and filtered through a stainless steel mesh 117

filter (100 μm in diameter). The hepatocytes were separated from other cells by twice 118

centrifuging (50 × g for 2 min) and purifying over a 45% Percoll® gradient (GE 119

Healthcare, Piscataway, PA, USA). Cell count and cell viability were assessed by the 120

Trypan blue exclusion test. The cells were incubated in Petri dishes pre-coated with 121

the collagen type I (BD Biosciences, San Jose, CA, USA) at a density of 0.5 × 106 122

cells per ml only when cell viability was over 85%. The complete culture medium was 123

Williams’ medium E (Gibco) containing 10% (vol/vol) fetal bovine serum (FBS) 124

(Hyclone, Logan, UT, USA), 1% (vol/vol) antibiotic/antimycotic solution (Gibco), 100 125

nM insulin, 100 nM dexamethasone and 0.3 nM disodium selenite. 24 h later, the 126


8

medium was replaced with phenol red-free Williams’ medium E (Gibco) supplemented 127

with 1% (vol/vol) antibiotic/antimycotic solution (Gibco), 200 nM insulin and 200 nM 128

dexamethasone, 0.5 nM disodium selenite, 1 mg/L transferrin and 1 mg/L FBA. After 129

18 h of starving culture, primary culture hepatocytes were treated with varying doses 130

of E2. Unless specifically mentioned, the cells were harvested 15 h after E2 treatments. 131

HepG2 cells and 293FT cells culture. 293FT cells were purchased from 132

Invitrogen (Invitrogen, Carlsbad, CA, USA). HepG2 cells and 293FT cells were 133

maintained in completed Dulbecco's modified Eagle’s medium (DMEM) (Gibco) 134

supplemented with 10% (vol/vol) FBS (Hyclone) and 1% (vol/vol) 135

antibiotic/antimycotic solution (Gibco). When the cells confluence was over 80%, the 136

cells were passaged by 0.25% (wt/vol) trypsin at a ratio of 1:4. After 18 h of plating, 137

the culture medium was aspirated and replaced with phenol red-free DMEM. Unless 138

specifically mentioned, the harvest times for these cells were 15 h after E2 treatments. 139

Real-time polymerase chain reaction (real-time PCR) assay. Total RNA was 140

extracted with a Takara RNA PLUS™ extraction kit (Takara Biotechnology Co., Ltd, 141

Dalian, PR China) according to the manufacturer’s instruction. 1–2 μg of total RNA 142

was reversed transcribed to cDNA with the M-MLV reverse transcriptase (Promega, 143

Madison, WI, USA). The primers used for real-time PCR assay were purchased from 144


9

Sangon (Shanghai, PR China) as shown in Table 2. The real-time PCR assays were 145

performed on an ABI 7500 real-time PCR system (Applied Biosystems, Foster City, 146

CA, USA) according to the instruction of SYBR® Premix Ex Taq™ GC (Takara). The 147

analysis was based on the PCR products Ct values. The ΔΔCt values were the Ct 148

values of the house-keeping gene (GAPDH) (ΔCt) subtracted from the target genes Ct 149

values such as CSAD. The expression level of the target genes were calculated as 150

2-ΔΔCt. 151

Western blot assay. The samples were homogenized and centrifuged. The total 152

protein contents were determined by a BCA Protein Assay Kit (Beyotime, Nanjing, PR 153

China). Samples containing 50 μg total proteins were resolved by 5%–15% 154

SDS-polyacrylamide gels (wt/vol) and transferred onto a PVDF membrane (Millipore, 155

Billerica, MA, USA). Non-specific binding sites were blocked by 5% (wt/vol) non-fat 156

milk powder diluted in tween/tris-buffered saline (TBST) for at least 2 h at room 157

temperature (RT). The membranes were then incubated with primary antibodies 158

(CSAD 1:10000, CDO 1:2000, GCLC 1:1000, GCLM 1:1000, GAPDH 1:20000) 159

diluted in TBST buffer overnight at 4˚C. The antibody against CSAD was produced by 160

injecting keyhole limpet hemocyanin (KLH)-conjugated phosphorylated peptide into 161

SPF New Zealand white rabbits using a standard protocol outlined by Beijing B&M 162


10

Biotech Co., Ltd. The sequences of the synthetic peptides: 163

“MADSKPLRTLDGDPVAV [C]”, [C] was used to ligate the KLH. After washing for 164

30 min with 3 changes of TBST, the membranes were incubated with horseradish 165

peroxidase-conjugated secondary antibody (1:20000) (Zhongshan Bio Corp., Beijing, 166

PR China) or alkaline phosphatase-conjugated secondary antibody (1:5000) 167

(Zhongshan) diluted in TBST for 2 h at RT. The signals were exposed on 168

autoradiograph X-ray film (Kodak, Rochester, NY, USA) with a Pierce ECL Kit 169

(Pierce, Rockford, IL, USA) or incubated with NBT/BCIP solution, respectively. All 170

the films and membranes were imaged in a Tannon gel imager (Beijing, PR China). 171

The relative intensities of each protein band were quantified by the Alphaimager 2200 172

software (Alpha Innotech, San Leandro, CA, USA). The intensity values pertaining to 173

each sample were normalized against the density of GAPDH. 174

Immunohistochemistry (IHC) and immunocytochemistry (ICC). The liver samples 175

were dehydrated, embedded in paraffin then sliced into 5 μm sections. After dewaxing 176

and rehydration, antigen retrieval was performed by microwaving the sections for 20 177

min in 0.01 M sodium citrate buffer (pH 6.0). After washing with PBS (pH 7.2) for 30 178

min, non-specific endogenous peroxidase activity was blocked by 3% (vol/vol) H2O2 179

diluted in PBS. Non-specific binding sites were then blocked by 10% normal goat 180


11

serum diluted in PBS at least for 3 h at RT. For CSAD detection, the sections were 181

firstly incubated with rabbit anti mouse CSAD antibody (1:200) diluted in PBS 182

overnight at 4˚C. After washing with PBS for 30 min, the sections were incubated with 183

biotinylated goat anti-rabbit IgG (1:200) (Zymed laboratories, San Francisco, CA, 184

USA) for 2 h at RT. After washing with PBS for 30 min, the sections were incubated 185

with streptavidin peroxidase complex (1:200) (Zymed laboratories) for 2 h at RT. 186

Finally, the signals were visualized by incubating the sections with 0.05 mol/L 187

Tris-HCL (pH 6.5) containing 0.06% (wt/vol) diaminobenzidine (DAB) and 0.03% 188

(vol/vol) H2O2. For ERα detection, the dilution ratios for the three antibodies and were 189

anti-ERα (NCL-ER-LH2) antibody (1:30) (Novocastra, Newcastle, UK), sheep anti 190

mouse IgG (1:50) (SAPU, Carluke, UK) and mouse alkaline phosphatase-anti alkaline 191

phosphatase complex (APAAP) (1:50) (Serotec, Oxford, UK). The anti-ERα sections 192

were visualized by incubating these sections with NBT/BCIP solution for 4 – 10 min. 193

The sections for CSAD and ERα detection were all dehydrated and mounted for 194

photograph collection. 195

For ICC, primary hepatocytes and HepG2 cells were fixed with 4% PFA for 20 196

min, then treated with cold methanol for 10 min. Subsequent procedures were as the 197

protocol of IHC for CSAD and ERα but without the step of antigen retrieval. 198


12

Measurement of taurine. The samples were weighed, homogenized and 199

deproteinized. After centrifuging at 14000 × g for 20 min, the supernatant was loaded 200

into a dual-bed syringe containing cation-exchange resin to remove other amino acids. 201

After adding L-glutamine as an internal standard, the samples were filtrated through a 202

0.22 μm PVDF membrane filter (Millipore). Before these samples were automatically 203

analyzed in a Beckman Coulter HPLC equipment (Beckman Instr., Fullerton, CA, 204

USA), they were derivatized with OPA solution (20 mg OPA, 2 ml methanol, 80 μl 205

2-hydroxy-1-ethanethiol, 18 ml 0.1 M borate buffer (pH 9.6)) for 3 min. The detection 206

wavelength was set at 340 nm. The flow rate was 1.1 ml/min. The mobile phase 207

contained a mixture of 0.1 M NaH2PO4 and 1.3 mM Na2HPO4 in water/methanol 208

(Fisher Scientific, Pittsburgh, PA, USA) (50/50 vol/vol) (pH 4.7). The separation was 209

performed on a Waters Symmetry C18 Column (4.6 μm, 150 mm × 5 mm) (Waters, 210

Milford, MA, USA) at 30˚C. The retention time for glutamine and taurine was around 211

3 min and 4.95 min, respectively. 212

Plasmid construction. Various lengths of CSAD promoter (–1919/+29, –859/+29, 213

–440/+29, –227/+29 and –168/+29) were amplified with specific primers containing 214

specific restriction enzyme cutting sites and inserted into a pGL3.0-basic luciferase 215

reporter vector (Promega) in the sense orientation, as presented in a schematic diagram 216


13

(Fig. 9A). The expression vectors of ERα, CDO and CSAD were constructed by 217

inserting the full-length coding sequence (CDS) into the pcDNA3.1 vector (Invitrogen) 218

in the sense orientation. As shown in Fig. 9B, the difference between wild ERα and 219

truncated ERα (tERα) vectors is the deletion of the DNA binding domain. All vectors 220

were confirmed by DNA sequence analysis from Sangon (Beijing, PR China). 221

Luciferase assay and measurement of intracellular GSH. The ERα vector, CSAD 222

luciferase reporter vector and pTK-Ranilla vector (Promega) were mixed at a ratio of 223

10:4:1. The mixture was then transfected into 293FT cells with Vigofect (Vigorous 224

biotechnology, Beijing, PR China) according to the manufacture’s protocol. The cells 225

were harvested 12 h after E2 treatment. After washing with PBS for 3 times, Firefly 226

and Renilla luciferase activities from the cell lysates were first incubated with the 227

Dual-Luciferase Assay Kit (Vigorous) according to the manufacture’s instruction and 228

then measured on a Modulus™ Microplate Multimode Reader (Turner BioSystems, 229

Sunnyvale, CA, USA) according to the technical manual. The values were calculated 230

as the ratio of Firefly luciferase (Fluc) activity to Renilla luciferase (Rluc) activity. For 231

GSH and GSSG assay, we followed the instruction of the Kit purchased from 232

Promega. 233

Statistical analysis. Data were analyzed by one-way ANOVA, followed by a 234


14

Student’s t test. All values are expressed as means ± SE. A P value < 0.05 was 235

considered significant. 236

237

RESULTS 238

239

Taurine and taurine biosynthetic enzymes expression level during estrus and 240

diestrus. To determine the relationship between the global estrogen and taurine 241

homeostasis, we initially assessed hepatic CSAD and CDO expression level and 242

taurine level in the liver and serum at estrus and diestrus stages, two distinguishable 243

stages during the estrus cycle. The results showed the mRNA and protein levels of 244

CSAD and CDO were remarkably lower at estrus than at diestrus. Meanwhile, the 245

serum and liver taurine concentration were well correlated with the taurine 246

biosynthetic enzymes expression (CSAD and CDO) level. However, the TauT mRNA 247

expression level did not have obvious change (Fig. 1). Taking into account that mice 248

plasma estrogen is higher during estrus and proestrus than diestrus (31), the inverse 249

correlation between the expression of taurine biosynthetic enzymes and the global 250

estrogen level, suggesting estrogen may reduce taurine de novo biosynthesis. 251

Estradiol reduced taurine level and taurine biosynthetic enzymes expression 252


15

both in vivo and in vitro. Next, we used the OVX mice model with and without an 253

estrogen replacement to mimic the two stages during estrus cycle. CSAD and CDO 254

mRNA and protein levels plus with the TauT mRNA expression level were reduced 255

after one-week estrogen replacement (Fig. 2A–D). Moreover, the increment of serum 256

taurine concentration exhibited in OVX mice were completely reversed by the E2 257

replacement (Fig. 2E). However, E2 had no obvious influence on the liver taurine 258

concentration (Fig. 2F). The above results supported the hypothesis that estradiol 259

negatively regulating taurine concentration. 260

To further assess whether a dose-dependent manner of E2 reducing CSAD 261

exists, we administrated 0.4 μg/kg, 4 μg/kg and 40 μg/kg E2 into the OVX mice, then 262

CSAD, CDO, and TauT mRNA levels were analyzed after 15 h. The results showed 263

that both 4 μg/kg and 40 μg/kg E2 treated mice liver had significantly decreased 264

hepatic mRNA levels of CSAD, CDO and TauT, whereas the significant decline of the 265

liver CSAD protein expression level, liver and serum taurine levels were detected only 266

when the E2 concentration was at up to 40 μg/kg (Fig. 3). 267

Based on the above in vivo experiments, we further evaluated the estradiol’s 268

function on taurine biosynthesis in the cultured hepatocytes and HepG2 cells. The 269

primary hepatocytes were treated with 1, 10, 50, and 100 nM E2, the CSAD and CDO 270


16

mRNAs were assessed after 3, 6, 9, 12 and 15 h E2 treatments, respectively. The PCR 271

results showed that 9 h, 12 h and 15 h E2 treatments significantly decreased CSAD and 272

CDO mRNAs expression level. However, the CSAD mRNA was more sensitive to E2 273

treatment than the CDO mRNA (Fig. 4A–B). Further, 15 h E2 treatments with all of 274

doses resulted in the significant decline of the level of CSAD protein (Fig. 4C), 275

whereas the significant reduction of hepatocyte taurine concentration was detected 276

only when the E2 concentration was up to 100 nM (Fig. 4D). 277

In HepG2 cells, 10 nM and 100 nM E2 significantly decreased CSAD mRNA 278

and protein levels after 15 h (Fig. 4, E and G). In addition, our results showed that 100 279

nM E2 treatment significantly decreased CDO and TauT mRNAs expression level (Fig. 280

4F). HepG2 cells taurine content was also reduced by 10 nM and 100 nM E2 after 15 h 281

(Fig. 4I). These in vivo and in vitro results indicate that E2 negatively regulates taurine 282

content. 283

Estradiol exerted its functional effect on taurine and taurine biosynthetic 284

enzymes via ERα. In order to answer whether efffects of E2 on the taurine biosythetic 285

enzyme expression level and taurine content rely on estrogen receptors (ERs), we 286

assessed the molecular types of ERs in liver, hepatocytes, and HepG2 cells. The 287

RT-PCR results showed that ERα was dominant in all of the examined cells (Fig. 5A) 288


17

Consistent with the RT-PCR results, IHC and ICC results further demonstrated CSAD 289

and ERα were co-expressed in the liver, primary hepatocytes and HepG2 cells (Fig. 5, 290

B and C). In addition, a mutual restrained staining pattern was observed in the liver. 291

Since CSAD and ERα were co-expressed in primary hepatocytes and HepG2 292

cells, further to determine which ER mediates the E2 effect, we used an estrogen 293

receptor antagonist, ICI 182,780 and ER KOs mice model. Notably, the reductions of 294

CSAD and CDO mRNAs level, CSAD protein level and taurine level after E2 295

administration were abrogated in the ICI 182,780 2 h pretreated liver (Fig. 6, A–E). 296

This blocking effect of ICI on E2 reducing CSAD, CDO and TauT mRNAs expression 297

level in the liver was also detected in primary hepatocytes with the exception on the 298

CDO mRNA level (Fig. 6F and G). In addition, the CSAD mRNA level in primary 299

hepatocytes did not respond to E2-BSA treatment (Fig. 6H). 300

From ERKOs mice, we found that ERα KO mice had increased CSAD, CDO 301

and TauT mRNAs expression level as compared with WT mice. By contrast, ERβ KO 302

mice had slightly decreased CSAD, CDO and TauT mRNAs expression level in 303

comparsion with ERβ heterozygote (ERβ HE) mice (Fig. 7, A and B). The proteins 304

level of CSAD and CDO were mirrored the results of their mRNA expression (Fig. 7, 305

C and D). However, taurine level in the ER KOs mice did not significantly differ from 306


18

the control mice level (Fig. 7, E and F). 307

We furthermore analyzed the levels of taurine biosynthetic enzymes and 308

taurine in ERα KO mice, and found that their levels were not remarkably responded to 309

either an ovariectomy procedure or an estrogen replacement. However, the expression 310

level of TauT mRNA was increased after E2 treatment (Fig. 8, A–F). Meanwhile, E2 311

restrained its ability to reduce the abundance of CSAD mRNA and protein level only 312

in the hepatocytes from the ERα KO mice but not from the ERβ KO mice (Fig. 8, G 313

and H). 314

In thought that E2 affected mRNA expression mainly through ERα, we 315

performed a dual-luciferase assay, and found E2 reducing CSAD (–1919/+29) 316

luciferase activity only when ERα was co-transfected (Fig. 9C). To further analysis the 317

bund part of ERα on the CSAD promoter, we transfected with various truncated 318

promoters and found that 100 nM E2 dramatically suppressed –1919/+29, –859/+29 319

and –440/+29 luciferase activities (Fig. 9D). Taken together, these data suggest that 320

ERα is responsible for estradiol’s effect on CSAD mRNA expression. 321

Taurine biosynthetic enzymes expression level was not associated with 322

intracellular GSH level. Finally, to determine whether E2 reducing the expression level 323

of taurine biosynthetic enzymes was asscociated with E2 regualting GSH, we firstly 324


19

checked taurine biosynthetic enzymes overexpression efficience (Fig. 1A) and then 325

analyzed the intralcellar GSH content, GSH/GSSG ratio in taurine biosynthetic 326

enzymes overexpressed HepG2 cells. The results showed the GSH content and 327

GSH/GSSG ratio in all of these overexpressed groups did not have significant 328

difference compared with the control (Fig. 11, B and C). Besides that, the GSH 329

sythetic enzyme GCLC/GCLM mRNA and protein levels in HepG2 cells incresed 330

after taurine biosynthetic enzymes overexpression compared with the control group 331

level (Fig. 11, D – F). 332

333

DISCUSSION 334

335

CSAD has been identified as the main enzyme for the decarboxylation of cysteine 336

sulfinic acid. Our study is agreed with a previous report (5), showing that the 337

enzymatic activity and abundance of CSAD in the liver increase after an ovariectomy 338

procedure and decrease after E2 replacement. Besides that, we also found estrogen 339

reduced taurine related gene, CDO and TauT expressions. Among these three genes, 340

the CSAD was most sensitively responded to E2 treatment, and this may because its 341

protein has a longer half-life than CDO (21). Finally, we clarify the relations among 342


20

liver taurine biosynthetic enzymes expression levels, taurine content and E2 based on 343

the following results. Firstly, we obtained a parallel result of hepatic taurine levels 344

with taurine biosynthetic enzymes expression level elicited by E2 treatment. Then, the 345

associated reduction in serum taurine level also obtained, suggesting the processes of 346

taurine synthesis and excretion from the liver (14), absorption and reabsorption in the 347

intestine and kidney (1) are interfered, to some extent, by E2. However, in the long 348

term E2 treated liver or in ER KOs mice, taurine levels in the liver and/or the serum 349

was not always paralleled with the expression level of taurine biosynthetic enzymes. 350

This may cause that the serum taurine was also regulated by the TauT expression (3, 351

17, 18). Due to TauT has a minor contribution to the total taurine concentration in 352

hepatocytes (45). We could assume that the abundance of taurine biosynthetic 353

enzymes determines the content of taurine in the liver and hepatocytes. 354

E2 exerts its function through many signaling pathways. Our observations 355

demonstrate that the classic ERα plays an indispensable role in estradiol’s effect on 356

taurine biosynthetic enzymes expression. Those results achieved from ICI 182,780 357

pretreatment and the addition of E2-BSA experiments exclude the roles of GPR30 and 358

non-classic ERs participating in 15 h E2 treated hepatocytes (6, 11, 33). Also, the data 359

from ER KO mice have identified ERα as the pivotal receptor mediating estradiol’s 360


21

effect. 361

Based on our observations that taurine biosynthetic enzymes proteins level 362

nearly always well parallel with their mRNAs level, it is conceivable that E2 mainly 363

regulates taurine biosynthetic enzymes on the transcriptional level (32, 38). Our 364

dual-luciferase results supported this hypothesis. Analysis of the CSAD promoter 365

suggests that there are three possible half-estrogen response elements (ERE) (13, 16, 366

24). To determine which one is the key element that interacts with ERα, further 367

explorations are needed. 368

Taurine and glutathione are two metabolic products of cysteine and methionine. A 369

previous report has shown that both of them are mainly synthesized in liver (14). 370

Therefore, a competitive relation between taurine and glutathione suggests that the 371

over-synthesis of taurine may reduce the intracellular GSH. In consistent with this 372

hypothesis, CDO overexpression decreasing glutathione level confirms such an 373

hypothesis (9). The liver-specific knockout of CDO mice has an increased liver 374

glutathione level (43). However, our results did not support this hypothesis. This may 375

due to the increment of GCLC/GCLM expression caused by intracellular cysteine 376

depletion in the HepG2 cells (26, 27). 377


22

The effect of E2 reduced CSAD and CDO expression in the liver is directly with 378

taurine de novo synthesis. But this regulatory effect, to some extent, was not 379

inconsistent with the synergetic effect between E2 and taurine in the progress of 380

fibrosis (36, 46). This may interpreted by that E2 reduced CSAD and CDO expression 381

also disturbed the homeostasis of sulfur-containing amino acids (9, 22). So the 382

functional effect of E2 on the taurine biosynthetic enzymes expression is associated not 383

only the taurine homeostasis but also the sulfur compound homeostasis. 384

In conclusion, our results clearly demonstrate that estradiol decreases taurine 385

concentration mainly via the reduction of taurine biosynthetic enzymes expression 386

level through the ERα. The expression level of taurine biosynthetic enzymes is not 387

directly connected with intracellular GSH level. Further studies are needed to explore 388

the role of taurine biosynthetic enzymes participated on liver diseases. 389

390

ACKNOWLEDGMENTS 391

The authors of this manuscript gratefully acknowledge Dr. Mechael Kanovsky for 392

English editing. 393

394

GRANTS 395


23

This study was supported by the National Key Program for Transgenic Breeding 396

(2013ZX08011-006), and grant from the National Natural Science Foundation of 397

China (J1103520), and the Specialized Research Fund for the Doctoral Program of 398

Higher Education (20120008110048). 399

400

DISCLOSURES 401

No conflicts of interest, financial or otherwise, are declared by the authors. 402

403

REFERENCES 404

405

1. Awapara J. Absorption of injected taurine-S35 by rat organs. J Biol Chem 225: 406

877-882, 1957. 407

2. Bhat HK, Calaf G, Hei TK, Loya T, and Vadgama JV. Critical role of oxidative 408

stress in estrogen-induced carcinogenesis. Proc Natl Acad Sci U S A 100: 3913-3918, 409

2003. 410

3. Bitoun M, and Tappaz M. Taurine down-regulates basal and osmolarity-induced 411

gene expression of its transporter, but not the gene expression of its biosynthetic 412

enzymes, in astrocyte primary cultures. J Neurochem 75: 919-924, 2000. 413


24

4. Carey JB, Jr., and Williams G. Metabolism of lithocholic acid in bile fistula 414

patients. J Clin Invest 42: 450-455, 1963. 415

5. Chatagner F, and Bergeret B. Effects of estradiol on the decarboxylation of 416

cysteinesulfinic acid by the liver of the ovariectomized adult rat. C R Hebd Seances 417

Acad Sci 244: 2322-2323, 1957. 418

6. Dauvois S, White R, and Parker MG. The antiestrogen ICI 182780 disrupts 419

estrogen receptor nucleocytoplasmic shuttling. J Cell Sci 106 ( Pt 4): 1377-1388, 420

1993. 421

7. Di Martino V, Lebray P, Myers RP, Pannier E, Paradis V, Charlotte F, 422

Moussalli J, Thabut D, Buffet C, and Poynard T. Progression of liver fibrosis in 423

women infected with hepatitis C: long-term benefit of estrogen exposure. Hepatology 424

40: 1426-1433, 2004. 425

8. Ding WG, Tooyama I, Kimura H, Kuriyama K, and Ochi J. Distribution of 426

taurine-like immunoreactivity in the mouse liver during ontogeny and after carbon 427

tetrachloride or phenobarbital intoxication. Histochem J 25: 376-383, 1993. 428

9. Dominy JE, Jr., Hwang J, and Stipanuk MH. Overexpression of cysteine 429

dioxygenase reduces intracellular cysteine and glutathione pools in HepG2/C3A cells. 430

Am J Physiol Endocrinol Metab 293: E62-69, 2007. 431


25

10. Ensunsa JL, Hirschberger LL, and Stipanuk MH. Catabolism of cysteine, 432

cystine, cysteinesulfinate, and OTC by isolated perfused rat hindquarter. Am J Physiol 433

264: E782-789, 1993. 434

11. Filardo E, Quinn J, Pang Y, Graeber C, Shaw S, Dong J, and Thomas P. 435

Activation of the novel estrogen receptor G protein-coupled receptor 30 (GPR30) at 436

the plasma membrane. Endocrinology 148: 3236-3245, 2007. 437

12. Forker EL. The effect of estrogen on bile formation in the rat. J Clin Invest 48: 438

654-663, 1969. 439

13. Gao H, Falt S, Sandelin A, Gustafsson JA, and Dahlman-Wright K. 440

Genome-wide identification of estrogen receptor alpha-binding sites in mouse liver. 441

Mol Endocrinol 22: 10-22, 2008. 442

14. Garcia RA, and Stipanuk MH. The splanchnic organs, liver and kidney have 443

unique roles in the metabolism of sulfur amino acids and their metabolites in rats. J 444

Nutr 122: 1693-1701, 1992. 445

15. Gasso M, Rubio M, Varela G, Cabre M, Caballeria J, Alonso E, Deulofem R, 446

Camps J, Gimenez A, Pajares M, Pares A, Mato JM, and Rodes J. Effects of 447

S-adenosylmethionine on lipid peroxidation and liver fibrogenesis in carbon 448

tetrachloride-induced cirrhosis. J Hepatol 25: 200-205, 1996. 449


26

16. Gruber CJ, Gruber DM, Gruber IM, Wieser F, and Huber JC. Anatomy of the 450

estrogen response element. Trends Endocrinol Metab 15: 73-78, 2004. 451

17. Han X, and Chesney RW. Mechanisms of regulation of taurine transporter 452

activity: a complex interplay of regulatory systems. Adv Exp Med Biol 583: 79-90, 453

2006. 454

18. Han X, Patters AB, Jones DP, Zelikovic I, and Chesney RW. The taurine 455

transporter: mechanisms of regulation. Acta Physiol (Oxf) 187: 61-73, 2006. 456

19. Higuchi M, Celino FT, Tamai A, Miura C, and Miura T. The synthesis and role 457

of taurine in the Japanese eel testis. Amino Acids 43: 773-781, 2012. 458

20. Huxtable RJ. Physiological actions of taurine. Physiol Rev 72: 101-163, 1992. 459

21. Huxtable RJ. Sources and turnover rates of taurine in nursing and weaned rat 460

pups. J Nutr 111: 1275-1286, 1981. 461

22. Jerkins AA, and Steele RD. Dietary sulfur amino acid modulation of cysteine 462

sulfinic acid decarboxylase. Am J Physiol 261: E551-555, 1991. 463

23. Kim SK, Choi KH, and Kim YC. Effect of acute betaine administration on 464

hepatic metabolism of S-amino acids in rats and mice. Biochem Pharmacol 65: 465

1565-1574, 2003. 466

24. Klinge CM. Estrogen receptor interaction with estrogen response elements. 467


27

Nucleic Acids Res 29: 2905-2919, 2001. 468

25. Kreamer BL, Staecker JL, Sawada N, Sattler GL, Hsia MT, and Pitot HC. 469

Use of a low-speed, iso-density percoll centrifugation method to increase the viability 470

of isolated rat hepatocyte preparations. In: In Vitro Cell Dev Biol1986, p. 201-211. 471

26. Lee JI, Dominy JE, Jr., Sikalidis AK, Hirschberger LL, Wang W, and 472

Stipanuk MH. HepG2/C3A cells respond to cysteine deprivation by induction of the 473

amino acid deprivation/integrated stress response pathway. Physiol Genomics 33: 474

218-229, 2008. 475

27. Lee JI, Kang J, and Stipanuk MH. Differential regulation of glutamate-cysteine 476

ligase subunit expression and increased holoenzyme formation in response to cysteine 477

deprivation. Biochem J 393: 181-190, 2006. 478

28. Lobo MV, Alonso FJ, Latorre A, and del Rio RM. Immunohistochemical 479

localization of taurine in the rat ovary, oviduct, and uterus. J Histochem Cytochem 49: 480

1133-1142, 2001. 481

29. Loriette C, and Chatagner F. Cysteine oxidase and cysteine sulfinic acid 482

decarboxylase in developing rat liver. Experientia 34: 981-982, 1978. 483

30. Lu SC. Regulation of hepatic glutathione synthesis: current concepts and 484

controversies. FASEB J 13: 1169-1183, 1999. 485


28

31. Meijs-Roelofs HM, Uilenbroek JT, de Jong FH, and Welschen R. Plasma 486

oestradiol-17beta and its relationship to serum follicle-stimulating hormone in 487

immature female rats. J Endocrinol 59: 295-304, 1973. 488

32. Mendelsohn ME. Genomic and nongenomic effects of estrogen in the vasculature. 489

Am J Cardiol 90: 3F-6F, 2002. 490

33. Parker MG. Action of "pure" antiestrogens in inhibiting estrogen receptor action. 491

Breast Cancer Res Treat 26: 131-137, 1993. 492

34. Parsons RB, Ramsden DB, Waring RH, Barber PC, and Williams AC. Hepatic 493

localisation of rat cysteine dioxygenase. J Hepatol 29: 595-602, 1998. 494

35. Pushpakiran G, Mahalakshmi K, and Anuradha CV. Taurine restores 495

ethanol-induced depletion of antioxidants and attenuates oxidative stress in rat tissues. 496

Amino Acids 27: 91-96, 2004. 497

36. Refik Mas M, Comert B, Oncu K, Vural SA, Akay C, Tasci I, Ozkomur E, 498

Serdar M, Mas N, Alcigir G, and Yener N. The effect of taurine treatment on 499

oxidative stress in experimental liver fibrosis. Hepatol Res 28: 207-215, 2004. 500

37. Ruiz-Larrea MB, Garrido MJ, and Lacort M. Estradiol-induced effects on 501

glutathione metabolism in rat hepatocytes. J Biochem 113: 563-567, 1993. 502

38. Simoncini T, Mannella P, Fornari L, Caruso A, Varone G, and Genazzani AR. 503


29

Genomic and non-genomic effects of estrogens on endothelial cells. Steroids 69: 504

537-542, 2004. 505

39. Stipanuk MH. Role of the liver in regulation of body cysteine and taurine levels: a 506

brief review. Neurochem Res 29: 105-110, 2004. 507

40. Stipanuk MH, Londono M, Lee JI, Hu M, and Yu AF. Enzymes and metabolites 508

of cysteine metabolism in nonhepatic tissues of rats show little response to changes in 509

dietary protein or sulfur amino acid levels. J Nutr 132: 3369-3378, 2002. 510

41. Tappaz ML. Taurine biosynthetic enzymes and taurine transporter: molecular 511

identification and regulations. Neurochem Res 29: 83-96, 2004. 512

42. Terauchi A, Nakazaw A, Johkura K, Yan L, and Usuda N. 513

Immunohistochemical localization of taurine in various tissues of the mouse. Amino 514

Acids 15: 151-160, 1998. 515

43. Ueki I, Roman HB, Hirschberger LL, Junior C, and Stipanuk MH. 516

Extrahepatic tissues compensate for loss of hepatic taurine synthesis in mice with 517

liver-specific knockout of cysteine dioxygenase. Am J Physiol Endocrinol Metab 302: 518

E1292-1299, 2012. 519

44. Ueki I, and Stipanuk MH. Enzymes of the taurine biosynthetic pathway are 520

expressed in rat mammary gland. J Nutr 137: 1887-1894, 2007. 521


30

45. Warskulat U, Borsch E, Reinehr R, Heller-Stilb B, Monnighoff I, Buchczyk D, 522

Donner M, Flogel U, Kappert G, Soboll S, Beer S, Pfeffer K, Marschall HU, 523

Gabrielsen M, Amiry-Moghaddam M, Ottersen OP, Dienes HP, and Haussinger 524

D. Chronic liver disease is triggered by taurine transporter knockout in the mouse. 525

FASEB J 20: 574-576, 2006. 526

46. Xu JW, Gong J, Chang XM, Luo JY, Dong L, Hao ZM, Jia A, and Xu GP. 527

Estrogen reduces CCL4- induced liver fibrosis in rats. World J Gastroenterol 8: 528

883-887, 2002. 529

530

531 FIGURE LEGENDS 532

533

Fig. 1. The expression level of taurine biosynthetic enzymes (CSAD and CDO) and 534

taurine concentrations in the liver and serum of female mice at estrus and diestrus 535

stages. A and B: liver CSAD, CDO and TauT mRNAs level were analyzed by 536

real-time PCR. C and D: liver CSAD and CDO proteins level were detected by 537

Western blot. GAPDH was used as a control. E: serum taurine and F: liver taurine 538

concentration was measured by HPLC. L-glutamine was used as an internal standard. 539

Values are given as means ± SE (n=4). *P < 0.05. D, diestrus. E, estrus. 540


31

541

Fig. 2. Taurine biosynthetic enzymes and taurine levels in OVX mice after one-week 4 542

μg/kg E2 replacement. A and B: liver CSAD, CDO and TauT mRNAs level, C and D: 543

liver CSAD and CDO proteins level, E and F: serum and liver taurine concentrations. 544

Significant effects of E2 on decreasing CSAD, CDO and TauT mRNAs level, CSAD 545

and CDO proteins level and serum taurine concentration were observed. Liver taurine 546

concentration was not significantly different from the oil control mice. Values are 547

given as means ± SE (n=4). *P < 0.05. Oil, maize oil (100 μl/ day). E2, 17-β-estradiol 548

(4 μg/kg/100 μl/ day). 549

550

Fig. 3. Taurine biosynthetic enzymes and taurine levels in OVX mice treated with 551

various dose of E2 (0.4 μg/kg, 4 μg/kg, 40 μg/kg) diluted in maize oil. A and B: liver 552

CSAD, CDO and TauT mRNAs level, C and D: liver CSAD and CDO proteins level, 553

E and F: serum and liver taurine concentrations. 4 μg/kg and 40 μg/kg E2 remarkably 554

reduced CSAD and TauT mRNAs level in OVX mice. The significantly decreased 555

levels of CSAD protein, serum taurine and liver taurine in OVX mice were detected 556

only when the E2 dose was up to 40 μg/kg. CDO mRNA level was not significantly 557

decreased with different dose of E2. Values are given as means ± SE (n=5). *P < 0.05. 558


32

Con, OVX mice without any injection. Oil, maize oil (100 μl). 559

560

Fig. 4. Taurine biosynthetic enzymes and taurine levels in primary hepatocytes and 561

HepG2 cells. A and B: 3–15 h hepatocytes CSAD and CDO mRNAs level, C: 562

hepatocytes CSAD protein level, D: hepatocytes taurine concentration, E and F: 563

HepG2 CSAD, CDO and TauT mRNAs level, G and H: HepG2 CSAD and CDO 564

proteins level and I: HepG2 taurine concentration. E2 reduced the expression level of 565

taurine biosynthetic enzymes and decreased taurine levels at 100 nM. Values are given 566

as means ± SE from three independent experiments. *P < 0.05. Con, control group. 567

Eth, ethanol. 568

569

Fig. 5. RT-PCR detection, IHC and ICC localization of CSAD and ERα. A: RT-PCR 570

analysis of CSAD, ERα and ERβ in the liver and hepatocytes. ERα was the dominant 571

estrogen receptor in the liver and hepatocytes. B and C: IHC and ICC location of 572

CSAD and ERα in the liver, hepatocytes and HepG2 cells. CSAD was preferentially 573

stained in the cell cytoplasm around the regions of the central veins (CV) and the 574

protal veins (PV), especially the PV regions. ERα was intensely stained in cell nuclear 575

mainly in the regions between CV and PV. CV, central veins. PV, protal veins. Bars, 576

ESTRADIOL REDUCES CSAD AND TAURINE IN THE LIVER

33

100 μm. 577

578

Fig. 6. Taurine biosynthetic enzymes and taurine levels in the liver and primary 579

hepatocytes after E2 and ICI 182,780 treatment. A and B: liver CSAD and CDO 580

mRNAs level, C: liver CSAD protein level, D and E: Serum and liver taurine 581

concentration. The effects of 40 μg/kg E2 reducing CSAD, CDO and taurine levels 582

were abrogated in the 40 μg/kg ICI 2 h pretreated mice liver. F and H: primary 583

hepatocytes CSAD mRNA level. G: primary hepatocytes CDO and TauT mRNAs 584

level. 100 nM ICI and 100 nM BSA-E2 did not possess the capacity of 100 nM E2 on 585

deceasing CSAD, CDO and TauT mRNAs level in primary hepatocytes. Values are 586

given as means ± SE from three independent experiments. *P < 0.05. E2, estradiol. ICI, 587

ICI 182,780. Eth, ethanol. Oil, maize oil. BSA-E2, β-estradiol 6-(O-carboxymethyl) 588

oxime: bovine serum albumin. 589

590

Fig. 7. Taurine biosynthetic enzymes and taurine levels in ERs KO mice. A and B: 591

liver CSAD, CDO and TauT mRNAs level, C and D: liver CSAD and CDO proteins 592

level, E and F: serum and liver taurine concentrations. ERα KO mice had siginifcantly 593

increased CSAD and CDO mRNAs and proteins expression levels in comparsion with 594


34

ER WT mice, whereas ERβ KO mice had decreased CSAD levels as compared with 595

ERβ HE mice. Taurine contents in ERs KO mice, compared with their corresponding 596

control mice showed no significant difference. Values are given as means ± SE (n=5). 597

*P < 0.05. WT, wild type. HE, heterozygote. 598

599

Fig. 8. Taurine biosynthetic enzymes and taurine levels in OVX ERα KO mice. A and 600

B: liver CSAD, CDO and TauT mRNAs level, C and D: liver CSAD and CDO 601

proteins level, E and F: serum and liver taurine concentrations. Mice CSAD and CDO 602

mRNAs and proteins level were not respond to E2 treatment. However, the TauT 603

mRNA expression level was increased after E2 treatment in the OVX ERα KO mice. G: 604

hepatocytes CSAD mRNA level and H: hepatocytes CSAD protein level. 100 nM E2 605

decreased the CSAD level only in the hepatocytes from the ERβ KO mice but not 606

from the ERα KO mice. Values are given as means ± SE (n=5). *P < 0.05. Eth, ethanol. 607

E2, estradiol. 608

609

Fig. 9. A schematic representation and deletion assay of the CSAD promoter. A: a 610

schematic representation of the CSAD promoter reporter vectors. B: a schematic 611

representation of ERα and tERα. C: 100 nM E2 reduced the –1919/+29 luciferase 612


35

activity on the condition of co-expressing ERα. D: 100 nM E2 suppressed –1919/+29, 613

–859/+29 and –440/+29 luciferase activities with co-expression of ERα. Values are 614

given as means ± SE from three independent experiments. *P < 0.05. LUC, luciferase. 615

tERα, truncated ERα. Eth, ethanol. E2, estradiol. 616

617

Fig. 10 Intracellualar GSH and GCLC/GCLM expression levels in taurine biosynthetic 618

enzymes overexpressed HepG2 cells. A: taurine biosynthetic enzymes overexpressed 619

efficiency detection. B: GSH level, C: GSH/GSSG ratio, D: GCLC and GCLM 620

mRNAs level, E and F: GCLC and GCLM proteins level. The GSH content and 621

GSH/GSSG ratio were not directly with taurine biosynthetic enzymes expression level. 622

Values are given as means ± SE from three independent experiments. *P < 0.05. 623

CSAD: 1 μg CSAD vector. CDO: 1 μg CDO vector. CSAD+CDO: 0.5 μg CSAD vector 624

and 0.5 μg CDO vector. 625

Table 1. ERα and ERβ identification primers

Primer name Sequence (5’—3’) length

ERα KO 5’-CTCTTGATTCCCACTTTGTGGTTC-3’ 250bp

ERα Common 5’-GCGGGTGCAGGAAAGGAGACAG-3’

ERα WT 5’-GCCAGTCGGGCATCGCCTACGG-3’ 150bp

ERβ KO 5’-GCAGCCTCTGTTCCACATACAC-3’ ~160bp

ERβ Common 5’- TCACAGGACCAGACACCGTA-3’

ERβ WT 5’-GTTGTGCCAGCCCTGTTACT-3’ 106bp

Table 2. Primer sequences for real-time PCR assay and expression vector

Primer Primer sequence ( 5’ – 3’ )

Mice CSAD forward CCTGGAGAGGCAGATCATTC

Mice CSAD reverse GTCCGTGTCGCTGGCAAAC

Mice GAPDH forward GGTTGTCTCCTGCGACTTCA

Mice GAPDH reverse GGGTGGTCCAGGGTTTCTTA

Mice CDO forward ACTCGGCGGGATTGCTC

Mice CDO reverse ACCCTGGCGGACCTCAT

Mice TauT forward GTTCTGCACCTGGGTGGCTAAGC

Mice TauT reverse GACACGCGAGGTCAGGGAGAAG

Human CSAD forward CGTCCAGCATCAAACACT

Human CSAD reverse TGGCTAAGGCTAGGCAGA

Huamn GAPDH forward AGTATGACAACAGCCTCAAGAT

Human GAPDH reverse GTCCTTCCACGATACCAAA

Human CDO forward CAGTGGGAGTTGGTATGA

Human CDO reverse CCCGAAATCTTGTGGA

Human TauT forward CAGGCAGATGGCATAAGA

Human TauT reverse GGTCCACTGGGAAGGTC

Human GCLC forward CCCCTCCTCCAAACTCA

Human GCLC reverse CTTGCCACAACCATCCA

Human GCLM forward GTTCCCAAATCAACCCA

Human GCLM reverse AAGGCTGTAAATGCTCC

Mice CSAD CDS forward CTAGCTAGCGCCACCATGGCTGACTCAAAACCACTCA

Mice CSAD CDS reverse CCGCTCGAGCTCACAGGTCCTGGCCCAGGAGCTCCA

Mice CDO CDS forward CTAGCTAGCGCCACCATGGAACGGACCGAGCTGCTGAAG

Mice CDO CDS reverse CGCGGATCCCTAGTTGTTCTCCAGTGACCCTGAAGTTGTAAATG

Mice ERα CDS forward GCCACCATGACCATGACCCTTCACACCAAAGCCTCGGGAATGGCCT

Mice ERα CDS reverse TCAGATCGTGTTGGGGAAGCCCTCTGCTTCCGGGGGT

Mice truncated ERα forward GCAGTAACGAGAAAGGAAACATGATCATGGAAGTGGGCATGATGAAAGGCGGCA

Mice truncated ERα reverse TGCCGCCTTTCATCATGCCCACTTCCATGATCATGTTTCCTTTCTCGTTACTGC

Estradiol decreases taurine level by reducing cysteine sulfinic acid decarboxylase via the estrogen...

Documents

Transcript of Estradiol decreases taurine level by reducing cysteine sulfinic acid decarboxylase via the estrogen...