1

In silico evidence for the horizontal gene transfer of gsiB, a σΒ-regulated gene in 1

Gram-positive bacteria, to lactic acid bacteria 2

3

Ioanna-Areti Asteria,b

, Effrossyni Boutoub, Rania Anastasiou

a, Bruno Pot

c, 4

Constantinos E. Vorgiasb, Effie Tsakalidou

a and Konstantinos Papadimitriou

a,b,* 5

6

a Laboratory of Dairy Research, Department of Food Science and Technology, 7

Agricultural University of Athens, Iera Odos 75, 118 55 Athens, Greece 8

b Department of Biochemistry and Molecular Biology, Faculty of Biology, National 9

and Kapodistrian University of Athens, Panepistimioupolis-Zographou, 157 84 10

Athens, Greece 11

c Applied Maths N.V., B-9830 Sint-Martens-Latem, Belgium 12

13

* Corresponding author: Konstantinos Papadimitriou 14

Laboratory of Dairy Research 15

Department of Food Science and Technology 16

Agricultural University of Athens 17

Iera Odos 75, 118 55 Athens, Greece 18

Tel: +30 210 529 4661 19

Fax: +30 210 529 4672 20

E-mail address: kpapadimitriou@aua.gr 21

Keywords: Lactic acid bacteria, Pediococcus, Bacillus, plasmid, stress, gsiB, sigma 22

B, LEA proteins, horizontal gene transfer, hydrophilins 23

Short title: Horizontal gene transfer of gsiB in LAB 24

Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved.Appl. Environ. Microbiol. doi:10.1128/AEM.02569-10 AEM Accepts, published online ahead of print on 18 March 2011

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

2

Abstract 25

gsiB coding for glucose starvation inducible protein B is a characteristic 26

member of the σΒ

stress regulon of Bacillus subtilis and several other Gram-27

positive bacteria. Here we provide in silico evidence for the horizontal gene 28

transfer of gsiB in lactic acid bacteria that are devoid of the σΒ

factor. 29

30

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

3

In Bacillus subtilis and many other Gram-positive species the alternative 31

sigma factor σΒ is responsible for redirecting RNA polymerase under stress conditions 32

to transcribe a set of genes known as the general stress regulon (41). In contrast, lactic 33

acid bacteria (LAB) are devoid of a σΒ ortholog and they have evolved other types of 34

regulatory networks (36, 40, 44). Included among the genes of the σΒ

regulon is the 35

gene coding for the glucose starvation inducible protein B (gsiB) (27). It is well 36

established that gsiB is activated under different stress conditions, including starvation 37

or exposure of cells to heat, acid, ethanol, high osmolality, etc (9, 25, 27). GsiB is of 38

particular interest, since it belongs to the late embryogenesis abundant (LEA) family 39

of proteins. LEA proteins were originally characterized in plants, where they were 40

found to play an important role in the desiccation tolerance of maturing seeds and in 41

vegetative organs under water deficit (5, 42). In fact, B. subtilis GsiB was the first 42

prokaryotic Group 1 LEA-like protein to be reported (35). 43

During our investigation of the plasmid content of Pediococcus pentosaceus 44

ACA-DC 3431, isolated from traditional Formaela cheese, we sequenced and 45

characterized plasmid pPS1. The protocols and the bioinformatic tools used have been 46

described previously (4). The annotated nucleotide sequence of pPS1 (2,721 bp) was 47

deposited in the EMBL database under Acc. No.: FN869858. Based on its features, 48

pPS1 is a new member of the pC194/pUB110 family of rolling circle replicating 49

plasmids (data not shown) and it carries two orfs. orf1 encodes a replication initiation 50

protein (Rep) which exhibits 93% similarity (e-value 1.0e-159

, 100% query coverage) 51

with the respective protein of pLTK2 plasmid isolated from Lactobacillus plantarum 52

(23). BLASTP searches for the orf2 product (128 amino acids), revealed an 53

interesting similarity pattern. The most significant matches until the first non-bacterial 54

protein could be classified in two categories. The first three hits were LAB proteins, 55

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

4

i.e. a general stress protein (Gsp) of plasmid pLS141-1 from Lactobacillus sakei 56

LK141 (94% similarity, e-value 8.0e-44

, 94% query coverage) (Acc. No.: BAC99042, 57

direct submission) and two identical GsiB proteins found on chromosomal contigs in 58

the unfinished genomes of Pediococcus acidilactici strains 7_4 and DSM 20284 (93% 59

similarity, e-value 8.0e-43

, 98% query coverage) (Acc. No.: ZP_06197568 and 60

ZP_07367445, respectively, direct submissions). Remaining hits were also GsiB 61

proteins mainly from several Bacillales species (in all cases similarity ≥ 84%, e-value 62

≤ 5.0e-17

, ≥ 80% query coverage). 63

The multiple sequence alignment of pPS1 GsiB with its related proteins 64

mentioned above was generated by MUSCLE (17) and revealed a significant degree 65

of conservation among them (Fig. 1A). It should be noted that in the case of more 66

than one BLAST matches from the same species, the best hit was selected for the 67

multiple sequence alignment in order to exclude putative paralogs. Detailed inspection 68

of the LAB GsiBs identified five tandem repeats of 20 amino acids in each sequence, 69

an organization very similar to that previously reported for the GsiB of B. subtilis 70

(Fig. 1A) (35). In fact, all GsiBs exhibited a variable number of 20-mer tandem 71

repeats. The consensus sequence created by the WebLogo tool (14) for all repeats 72

present in the multiple sequence alignment revealed several highly conserved 73

positions (Fig. 1B). ProDom (29) under default settings recognized several protein 74

family domains corresponding to two LEA_5 (PF00477) and up to five KGG 75

(PF10685) pfam motifs in each of the LAB GsiB sequences. The LEA_5 motif is 76

characteristic of the Group 1 LEA proteins (5, 21, 39), while the KGG motif is found 77

in bacterial stress induced proteins (33), as well as in eukaryotic LEA proteins (42). 78

Furthermore, ProDom analysis of the sequence comprising the most conserved amino 79

acid positions in the logo of the GsiB tandem repeats (i.e. 80

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

5

GX1KGGEATSX2NHDKEFYQEI, X1: R, E, K, Q, H and X2: K, E, R, N, D, Q, S) 81

demonstrated that each tandem repeat is essentially part of the LEA_5 motif and 82

includes the KGG motif (data not shown). In addition, the four LAB GsiB molecules 83

exhibited a significant hydrophilic index between -1 and -3 over their entire length, as 84

revealed by the Kyte-Doolittle hydropathy analysis (performed at 85

http://gcat.davidson.edu/DGPB/kd/kyte-doolittle.htm) (16) and a high glycine content 86

ranging from 15.2 to 15.8%. Our findings clearly suggest that LAB GsiBs belong to 87

the hydrophilin-like superfamily that today contains diverse proteins (including all 88

LEA groups) whose putative assigned function is to protect cells under conditions of 89

dehydration (18). The in silico prediction of the existence of the gsiB gene in the pPS1 90

plasmid was further verified by RT-PCR, using primers 5’-91

ATGGCTAAGAAAGATAACGA-3’ and 5’-GAATTGGCTTTTCCGCCT-3’ (data 92

not shown), as described previously (4). Noteworthy, predictions concerning the 93

secondary structure of the LAB GsiBs were inconclusive. Different predictors [e.g. 94

PSIPRED (22) and Jpred 3 (12)] returned contradicting results, supporting both an 95

unstructured and a highly structured organisation of these proteins (data not shown), 96

which coincide with the current debate on the actual structure of hydrophilins (5, 10, 97

18, 19, 42). 98

To gain more insight into the origin of GsiBs in LAB, their evolutionary 99

relation to other GsiBs was investigated. The multiple sequence alignment shown in 100

Figure 1A was further curated with Gblocks using default parameters (11) and the 101

phylogenetic tree of GsiBs was calculated by PhyML (20) with the WAG substitution 102

model and the Chi2-based parametric approximate likelihood-ratio test (aLRT) for 103

branch support (3). The analysis was performed with the Phylogeny.fr pipeline (16). 104

LAB GsiBs formed a separate clade within the phylogenetic tree that was fully 105

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

6

surrounded by Bacillales deriving sequences (Fig. 2A). No other sequences belonging 106

to LAB could be placed within this phylogenetic tree, since even a PSI-BLAST search 107

of GsiB did not return any additional LAB homolog, even distantly related. While the 108

phylogenetic distance between the LAB and the Bacillales species carrying GsiBs is 109

obvious, the close phylogenetic relatedness of their GsiBs suggested some type of 110

horizontal gene transfer (HGT). To assess HGT, we employed T-REX, a program that 111

identifies topological violations in a gene/protein tree in relation to the respective 112

species tree and calculates the possibility of HGT events during the evolution of the 113

considered organisms (7, 26). For this reason, we constructed the 16S rRNA 114

phylogenetic tree of all strains presented in Figure 2A (Fig. 2B). Full or partial 16S 115

rRNA sequences were retrieved from the Ribosomal Database Project web site (13) or 116

GenBank (6). The partial 16S rRNA sequence of P. pentosaceus ACA-DC 3431 was 117

deposited in the EMBL database under Acc. No.: FR714835. In the case of L. sakei, 118

we used the 16S rRNA sequence of the L. sakei type strain (DSM 20017T), since the 119

16S rRNA of L. sakei LK141 is not available. Multiple sequence alignment of the 16S 120

rRNA sequences was performed using ClustalW (38) and was curated with Gblocks 121

under settings for a less stringent selection (11). The phylogenetic tree was 122

constructed with the neighbor-joining method (34) and the Kimura 2 parameters 123

substitution model using the Phylogeny.fr pipeline (16). Branch support was 124

estimated by bootstrapping (1000 replicates). T-REX analysis using the detection 125

mode of several HGTs by iteration and the optimization criterion of bipartition 126

dissimilarity (8) predicted HGT routes that could resolve the differences between the 127

GsiB phylogenetic tree and the relevant 16S rRNA species tree. Among these routes, 128

we identified one that could mediate gsiB transfer from the Paenibacillus clade to 129

LAB and dispersion of this gene from the pLS141-1 L. sakei plasmid to the 130

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

7

chromosomes of the two strains of P. acidilactici (arrows in Fig. 2B). A number of 131

scenarios for the GsiB HGT among Bacillales were also predicted, including the 132

transfer of GsiB from Bacillus to Paenibacillus species (data not shown). 133

The HGT between Paenibacillus and LAB was also supported by further 134

analysis of pLS141-1. The most significant matches of the BLASTP analysis for the 135

pLS141-1 Rep protein (in all cases similarity ≥ 88%, e-value ≤ 4.0e-81

, ≥ 94% query 136

coverage) were used to construct the phylogenetic tree shown in Figure 3 with the 137

same methodology as for the pPS1 GsiB tree. Among the evolutionary partners of the 138

pLS141-1 Rep, the majority of which were of LAB origin, the Rep proteins of the L. 139

sakei plasmid pLS55 (1), the Paenibacillus larvae plasmid pMA67 (30), the 140

Sporosarcina ureae plasmid pSU1 (Acc. No.: YP003560375, direct submission) and 141

the Bacillus sp. 24 plasmid pBHS24 (32) could be identified (in all cases similarity ≥ 142

89%, e-value ≤ 8.0e-99

, 99% query coverage) (Fig. 3). The aforementioned plasmids 143

i.e. pLS55, pMA67, pSU1 and pBHS24 are practically identical (less than 10 144

nucleotides different over their 5 kb length) and they carry the tetracycline resistance 145

gene tetL. Importantly, the partaking of the pLS55/pMA67 replicon by both P. larvae 146

and L. sakei has been suggested to account for the HGT of the tetL gene in these 147

species (30). Since the replication backbone of pLS141-1 is similar to the 148

pLS55/pMA67/pSU1/pBHS24 replicon (data not shown), the plasmid is a perfect 149

candidate as a Bacillales/Lactobacillus vehicle. Such an intra-species vehicle, able to 150

overcome the species barrier, is a prerequisite when HGT is mediated by plasmids in 151

bacteria (37). pLS141-1 could have acted as an acceptor of the ancestral gsiB in 152

Paenibacillus species. Transmission of pLS141-1 to LAB may account for their 153

acquisition of gsiB, which could have further moved by recombination events to the 154

chromosome (e.g. gsiB of P. acidilactici strains 7_4 and DSM 20284) or to plasmids 155

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

8

(e.g. gsiB of pPS1). In fact, Paenibacillus and LAB species co-exist in several 156

ecological niches, including food matrices like milk or dairy products (15), and thus 157

HGT among these bacteria is feasible. Furthermore, it has been previously suggested 158

that gsiB was transferred to B. subtilis by HGT from plants (24). In our opinion, the 159

acquisition of gsiB by B. subtilis through HGT is also supported by the fact that the 160

gsiB gene is absent in the species of the Bacillus cereus group (2). Consequently, 161

LAB GsiBs seem to be the endpoint of a domino of HGT events that started from 162

plants. 163

Finally, inspection of the LAB gsiB sequences revealed that no σΒ promoter 164

(31) could be identified (Fig. 4). This finding shows that irrespective of the underlying 165

evolutionary process of gsiB acquisition by LAB, the σΒ promoter was rejected, since 166

it would anyhow have been useless for regulating the expression of the gene in these 167

bacteria that are devoid of a σΒ

ortholog. 168

It should be emphasized that no phenotype is as yet associated with the gsiB B. 169

subtilis mutant (28), while heterologous expression of plant LEA proteins in 170

Escherichia coli resulted in only a moderate improvement of its ability to grow under 171

salt or low temperature stress (43). To the best of our knowledge, this is the first 172

report concerning the identification of a putative GsiB in LAB, providing in silico 173

evidence for the existence of Group 1 LEA hydrophilins in these bacteria. We are now 174

investigating the functional role of GsiB in LAB stress physiology. 175

176

Ioanna-Areti Asteri was financially supported by the State Scholarships Foundation of 177

Greece (IKY-Idryma Kratikon Ypotrofion). 178

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

9

References 179

1. Ammor, M. S., M. Gueimonde, M. Danielsen, M. Zagorec, A. H. van 180

Hoek, C. G. de Los Reyes-Gavilan, B. Mayo, and A. Margolles. 2008. Two 181

different tetracycline resistance mechanisms, plasmid-carried tet(L) and 182

chromosomally located transposon-associated tet(M), coexist in Lactobacillus 183

sakei Rits 9. Appl Environ Microbiol 74:1394-401. 184

2. Anderson, I., A. Sorokin, V. Kapatral, G. Reznik, A. Bhattacharya, N. 185

Mikhailova, H. Burd, V. Joukov, D. Kaznadzey, T. Walunas, 186

Markd'Souza, N. Larsen, G. Pusch, K. Liolios, Y. Grechkin, A. Lapidus, 187

E. Goltsman, L. Chu, M. Fonstein, S. D. Ehrlich, R. Overbeek, N. 188

Kyrpides, and N. Ivanova. 2005. Comparative genome analysis of Bacillus 189

cereus group genomes with Bacillus subtilis. FEMS Microbiol Lett 250:175-190

84. 191

3. Anisimova, M., and O. Gascuel. 2006. Approximate likelihood-ratio test for 192

branches: A fast, accurate, and powerful alternative. Syst Biol 55:539-52. 193

4. Asteri, I. A., K. Papadimitriou, E. Boutou, R. Anastasiou, B. Pot, C. E. 194

Vorgias, and E. Tsakalidou. 2010. Characterization of pLAC1, a cryptic 195

plasmid isolated from Lactobacillus acidipiscis and comparative analysis with 196

its related plasmids. Int J Food Microbiol 141:222-8. 197

5. Battaglia, M., Y. Olvera-Carrillo, A. Garciarrubio, F. Campos, and A. A. 198

Covarrubias. 2008. The enigmatic LEA proteins and other hydrophilins. 199

Plant Physiol 148:6-24. 200

6. Benson, D. A., I. Karsch-Mizrachi, D. J. Lipman, J. Ostell, and D. L. 201

Wheeler. 2008. GenBank. Nucleic Acids Res 36:D25-30. 202

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

10

7. Boc, A., and V. Makarenkov. 2003. New Efficient Algorithm for Detection 203

of Horizontal Gene Transfer Events, p. 190-201. In G. Benson and R. Page 204

(ed.), Algorithms in Bioinformatics, vol. 2812. Springer Berlin / Heidelberg. 205

8. Boc, A., H. Philippe, and V. Makarenkov. 2010. Inferring and validating 206

horizontal gene transfer events using bipartition dissimilarity. Syst Biol 207

59:195-211. 208

9. Brigulla, M., T. Hoffmann, A. Krisp, A. Volker, E. Bremer, and U. 209

Volker. 2003. Chill induction of the SigB-dependent general stress response 210

in Bacillus subtilis and its contribution to low-temperature adaptation. J 211

Bacteriol 185:4305-14. 212

10. Browne, J. A., K. M. Dolan, T. Tyson, K. Goyal, A. Tunnacliffe, and A. 213

M. Burnell. 2004. Dehydration-specific induction of hydrophilic protein 214

genes in the anhydrobiotic nematode Aphelenchus avenae. Eukaryot Cell 215

3:966-75. 216

11. Castresana, J. 2000. Selection of conserved blocks from multiple alignments 217

for their use in phylogenetic analysis. Mol Biol Evol 17:540-52. 218

12. Cole, C., J. D. Barber, and G. J. Barton. 2008. The Jpred 3 secondary 219

structure prediction server. Nucleic Acids Res 36:W197-201. 220

13. Cole, J. R., Q. Wang, E. Cardenas, J. Fish, B. Chai, R. J. Farris, A. S. 221

Kulam-Syed-Mohideen, D. M. McGarrell, T. Marsh, G. M. Garrity, and 222

J. M. Tiedje. 2009. The Ribosomal Database Project: improved alignments 223

and new tools for rRNA analysis. Nucleic Acids Res 37:D141-5. 224

14. Crooks, G. E., G. Hon, J. M. Chandonia, and S. E. Brenner. 2004. 225

WebLogo: a sequence logo generator. Genome Res 14:1188-90. 226

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

11

15. De Jonghe, V., A. Coorevits, J. De Block, E. Van Coillie, K. Grijspeerdt, 227

L. Herman, P. De Vos, and M. Heyndrickx. 2010. Toxinogenic and spoilage 228

potential of aerobic spore-formers isolated from raw milk. Int J Food 229

Microbiol 136:318-25. 230

16. Dereeper, A., V. Guignon, G. Blanc, S. Audic, S. Buffet, F. Chevenet, J. F. 231

Dufayard, S. Guindon, V. Lefort, M. Lescot, J. M. Claverie, and O. 232

Gascuel. 2008. Phylogeny.fr: robust phylogenetic analysis for the non-233

specialist. Nucleic Acids Res 36:W465-9. 234

17. Edgar, R. C. 2004. MUSCLE: multiple sequence alignment with high 235

accuracy and high throughput. Nucleic Acids Res 32:1792-7. 236

18. Garay-Arroyo, A., J. M. Colmenero-Flores, A. Garciarrubio, and A. A. 237

Covarrubias. 2000. Highly hydrophilic proteins in prokaryotes and 238

eukaryotes are common during conditions of water deficit. J Biol Chem 239

275:5668-74. 240

19. Goyal, K., L. Tisi, A. Basran, J. Browne, A. Burnell, J. Zurdo, and A. 241

Tunnacliffe. 2003. Transition from natively unfolded to folded state induced 242

by desiccation in an anhydrobiotic nematode protein. J Biol Chem 278:12977-243

84. 244

20. Guindon, S., and O. Gascuel. 2003. A simple, fast, and accurate algorithm to 245

estimate large phylogenies by maximum likelihood. Syst Biol 52:696-704. 246

21. Hundertmark, M., and D. K. Hincha. 2008. LEA (late embryogenesis 247

abundant) proteins and their encoding genes in Arabidopsis thaliana. BMC 248

Genomics 9:118. 249

22. Jones, D. T. 1999. Protein secondary structure prediction based on position-250

specific scoring matrices. J Mol Biol 292:195-202. 251

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

12

23. Kaneko, Y., H. Kobayashi, P. Kiatpapan, T. Nishimoto, R. Napitupulu, H. 252

Ono, and Y. Murooka. 2000. Development of a host-vector system for 253

Lactobacillus plantarum L137 isolated from a traditional fermented food 254

produced in the Philippines. J Biosci Bioeng 89:62-7. 255

24. Koonin, E. V., K. S. Makarova, and L. Aravind. 2001. Horizontal gene 256

transfer in prokaryotes: quantification and classification. Annu Rev Microbiol 257

55:709-42. 258

25. Kovacs, T., A. Hargitai, K. L. Kovacs, and I. Mecs. 1998. pH-dependent 259

activation of the alternative transcriptional factor sigmaB in Bacillus subtilis. 260

FEMS Microbiol Lett 165:323-8. 261

26. Makarenkov, V. 2001. T-REX: reconstructing and visualizing phylogenetic 262

trees and reticulation networks. Bioinformatics 17:664-8. 263

27. Maul, B., U. Volker, S. Riethdorf, S. Engelmann, and M. Hecker. 1995. 264

sigma B-dependent regulation of gsiB in response to multiple stimuli in 265

Bacillus subtilis. Mol Gen Genet 248:114-20. 266

28. Mueller, J. P., G. Bukusoglu, and A. L. Sonenshein. 1992. Transcriptional 267

regulation of Bacillus subtilis glucose starvation-inducible genes: control of 268

gsiA by the ComP-ComA signal transduction system. J Bacteriol 174:4361-73. 269

29. Mulder, N., and R. Apweiler. 2007. InterPro and InterProScan: tools for 270

protein sequence classification and comparison. Methods Mol Biol 396:59-70. 271

30. Murray, K. D., K. A. Aronstein, and J. H. de Leon. 2007. Analysis of 272

pMA67, a predicted rolling-circle replicating, mobilizable, tetracycline-273

resistance plasmid from the honey bee pathogen, Paenibacillus larvae. 274

Plasmid 58:89-100. 275

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

13

31. Petersohn, A., J. Bernhardt, U. Gerth, D. Hoper, T. Koburger, U. Volker, 276

and M. Hecker. 1999. Identification of sigma(B)-dependent genes in Bacillus 277

subtilis using a promoter consensus-directed search and oligonucleotide 278

hybridization. J Bacteriol 181:5718-24. 279

32. Phelan, R. W., C. Clarke, J. P. Morrissey, A. D. Dobson, F. O'Gara, and 280

T. M. Barbosa. 2011. Tetracycline resistance-encoding plasmid from Bacillus 281

sp. strain #24, isolated from the marine sponge Haliclona simulans. Appl 282

Environ Microbiol 77:327-9. 283

33. Robbe-Saule, V., M. D. Lopes, A. Kolb, and F. Norel. 2007. Physiological 284

effects of Crl in Salmonella are modulated by sigmaS level and promoter 285

specificity. J Bacteriol 189:2976-87. 286

34. Saitou, N., and M. Nei. 1987. The neighbor-joining method: a new method 287

for reconstructing phylogenetic trees. Mol Biol Evol 4:406-25. 288

35. Stacy, R. A., and R. B. Aalen. 1998. Identification of sequence homology 289

between the internal hydrophilic repeated motifs of group 1 late-290

embryogenesis-abundant proteins in plants and hydrophilic repeats of the 291

general stress protein GsiB of Bacillus subtilis. Planta 206:476-8. 292

36. Sugimoto, S., M. Abdullah Al, and K. Sonomoto. 2008. Molecular 293

chaperones in lactic acid bacteria: physiological consequences and 294

biochemical properties. J Biosci Bioeng 106:324-36. 295

37. Thomas, C. M., and K. M. Nielsen. 2005. Mechanisms of, and barriers to, 296

horizontal gene transfer between bacteria. Nat Rev Microbiol 3:711-21. 297

38. Thompson, J. D., D. G. Higgins, and T. J. Gibson. 1994. CLUSTAL W: 298

improving the sensitivity of progressive multiple sequence alignment through 299

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

14

sequence weighting, position-specific gap penalties and weight matrix choice. 300

Nucleic Acids Res 22:4673-80. 301

39. Tunnacliffe, A., and M. J. Wise. 2007. The continuing conundrum of the 302

LEA proteins. Naturwissenschaften 94:791-812. 303

40. van de Guchte, M., P. Serror, C. Chervaux, T. Smokvina, S. D. Ehrlich, 304

and E. Maguin. 2002. Stress responses in lactic acid bacteria. Antonie Van 305

Leeuwenhoek 82:187-216. 306

41. van Schaik, W., and T. Abee. 2005. The role of sigmaB in the stress response 307

of Gram-positive bacteria - targets for food preservation and safety. Curr Opin 308

Biotechnol 16:218-24. 309

42. Wise, M. J., and A. Tunnacliffe. 2004. POPP the question: what do LEA 310

proteins do? Trends Plant Sci 9:13-7. 311

43. Ying, L. A. N., C. A. I. Dan, and Z. Yi-Zhi. 2005. Expression in Escherichia 312

coli of Three Different Soybean Late Embryogenesis Abundant (LEA) Genes 313

to Investigate Enhanced Stress Tolerance. Journal of Integrative Plant Biology 314

47:613-621. 315

44. Yother, J., P. Trieu-Cuot, T. R. Klaenhammer, and W. M. De Vos. 2002. 316

Genetics of streptococci, lactococci, and enterococci: review of the sixth 317

international conference. J Bacteriol 184:6085-92. 318

319

320

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

15

Legends to figures 321

322

Figure 1. Analysis of the protein sequences of LAB and non-LAB GsiBs. (A). 323

Multiple sequence alignment of the pPS1 GsiB and its related proteins. Grey shading 324

in the alignment reflects the degree of amino acid conservation. Boxes indicate the 20 325

amino acid tandem repeats identified manually in the LAB and the B. subtilis GsiBs. 326

(B). Consensus sequence created by the WebLogo tool (14) for all 20-mer repeats 327

present in the multiple sequence alignment. Regions R1 to R5 in the multiple 328

sequence alignment were used for this analysis. 329

330

Figure 2. HGT route for the acquisition of GsiB by LAB. (A). Maximum likelihood 331

phylogenetic tree of the pPS1 GsiB and its related proteins. (B). Neighbor-joining 332

phylogenetic tree of the 16S rRNA of the species carrying GsiBs presented in (A). 333

Dotted arrows indicate HGT routes predicted by T-REX (26). Phylogenetic analysis 334

was performed at the Phylogeny.fr pipeline (16), as described in the text. The length 335

of the curated multiple sequence alignments used for the construction of phylogenetic 336

trees presented in (A) and (B) was 73 and 1449 positions, respectively. Branch 337

support values above 50% are indicated. Brackets highlight the position of important 338

clades in the phylogenetic trees that are further discussed in the text. 339

340

Figure 3. Relatedness of the pLS141-1 with the pLS55/pMA67/pSU1/pBHS24 341

replicon. The phylogenetic tree of the pLS141-1 Rep and its related proteins was 342

constructed using maximum likelihood at the Phylogeny.fr pipeline (16), as described 343

in the text. The length of the curated multiple sequence alignment used for the 344

construction of the phylogenetic tree was 214 positions. The bracket and the solid 345

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

16

arrow highlight the positions of the Bacillales/Lactobacillus clade and the pLS141-1 346

protein, respectively that are further discussed in the text. 347

348

Figure 4. Promoter regions of the LAB and B. subtilis str. 168 gsiB genes. In LAB no 349

σΒ

promoters were detected that would satisfy the requirements of the consensus σΒ 350

sequences GTTTaa (-35 region) and GGG(A/T)A(A/T) (-10 region) determined 351

previously (31). The σΒ

promoter was only detected for the gsiB of B. subtilis. In all 352

other cases, the non σΒ

promoters and RBS sequences were predicted as described 353

before (4). Right arrow indicates the start codon of the genes. 354

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Figure 1.

A.

B.

R1 R2 R3

R4 R5

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Figure 2.

A.

B.

LAB GsiBs

Paenibacillus GsiBs

98

70

100

100

90

79

100

93

93

89

99

100

52

94

99

86

86100

100

62

73

80

57

100

100

66

100

10076

63

100

100

100

10098

98

LAB clade

Paenibacillus clade

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Figure 3.

100

100

100100

100

100

100

100

100100

89

86

89

77

95

Bacillales/Lactobacillus clade

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from

Figure 4.

AACCGTTTACTTAAAAAAATTACGTGATAATATAGCGTTAGTAGAAGAAATTGTTCTTAAGCAGATACAAATACTCAATATTAGAGGAGGATTTTTATG

AATTTCTCAAAACTAAGCATAATGTTTGTGGTCTAGTAAGAAAGCGCTTAATATAAAGACCGTAGAAGAAATCAAATTTTAGGAGGAAAGAGAATATG

TTTTCTGAGCATCTGCAAGCGTTAAATTTGTAATCGCTTTAAAAAGCATTTAACATAACACTCGTAGAAAAAAACTAACTCAAGGAGGAATGAAACATG

TTTTCTGAGCATCTGCAAGCGTTAAATTTGTAATCGCTTTAAAAAGCATTTAACATAACACTCGTAGAAAAAAACTAACTCAAGGAGGAATGAAATATG

TTTTTTTAGTGGAAACATACCCAATGTGTTTTGTTTGTTTAAAAGAATTGTGAGCGGGAATACAACAACCAACACCAATTAAAGGAGGAATTCAAAATG

pPS1:

pLS141-1:

P. acidilactici 7_4:

P. acidilactici DSM20284:

B. subtilis 168:

σB promoter

RBS-10-35

on Septem

ber 12, 2020 by guesthttp://aem

.asm.org/

Dow

nloaded from