Differential expression of human α- and β-defensins mRNA in gastrointestinal epithelia

European Journal of Clinical Investigation (2000) 30, 695±701 Paper 696

Differential expression of human a- and b-defensins mRNAin gastrointestinal epithelia

M. Frye, J. Bargon*, B. Lembcke², T. O. F. Wagner* and R. Gropp

Johann Wolfgang Goethe-University and *University Hospital Frankfurt, Frankfurt; ²St Barbara-Hospital, Gladbeck,

Germany

Abstract Background While defensins have received great attention for their role in bronchial innate

immune defence, little is known about the expression levels of the four human epithelial

defensins (HD5, HD6, hBD1 and hBD2) in the digestive tract. In this study we quanti®ed

the a- and b-defensins mRNA in biopsies obtained from the gastrointestinal mucosa and

identi®ed the cells expressing the b-defensin hBD1 mRNA in ileal mucosa.

Material and methods Biopsies from human stomach (corpus and antrum), duodenum,

jejunum, ileum and colon were analysed for their expression of a- and b-defensins. The

mRNA of defensins was quanti®ed by semiquantitative reverse transcription±polymerase

chain reaction. Cells expressing b-defensin hBD1 mRNA were identi®ed by in situ

hybridization with 35S-labelled RNA probes in tissue sections of human ileum.

Results The hBD1 mRNA was expressed at low levels with little variability throughout the

gastrointestinal tract and was detected in all epithelial cells of ileal mucosa. HD5 and HD6

mRNA expression was restricted to the intestine and displayed high interindividual variability.

The highest expression levels were observed in jejunum and ileum. Biopsies obtained from

duodenum displayed low levels or no expression of HD5 and HD6. The expression level

increased considerably in a biopsy obtained from a patient with acute coeliac sprue. In

contrast, low levels were observed in a biopsy from a patient with coeliac sprue in remission.

Conclusions The expression levels of hBD1, HD5 and HD6 throughout the gastro-

intestinal tract are tissue and peptide speci®c and these defensins are expressed with high

interindividual variability.

Keywords Antimicrobial peptides, digestive tract, epithelial defensins

Eur J Clin Invest 2000; 30 (8): 695±701

Introduction

The gastrointestinal tract is constantly exposed to a broad

range of potential pathogens. However, due to the presence

of highly effective defence systems, the actual incidence of

infection remains relatively low. The ®rst line of defence

against invading pathogens is the innate immune response.

Peptides with microbicidal activity are key components of

innate immunity [1±3]. The conservation of these peptides

during evolution and their distribution throughout the

animal kingdom re¯ect the importance of these molecules

in host defence [4].

Human defensins, small cationic peptides, constitute one

class of these highly microbicidal peptides. Defensins were

originally discovered in neutrophils, but they are also pro-

duced by epithelial cells and are considered an important

barrier at mucosal surfaces [5±7]. Defensins are character-

ized by six cysteines forming three disulphide bridges. They

bind electrostatically tonegatively chargedmembranes, thus

rendering them permeable to small molecules by forming

pores [8±10]. Defensins possess microbicidal and cytotoxic

activities against bacteria, fungi and viruses [11±13].

To date, four different human epithelial defensins have

been identi®ed. Two of them, HD5 and HD6, belong to

the family of a-defensins. In the small intestine, they are

located in the lysozyme-rich secretory granules of Paneth

cells within the crypts of LieberkuÈhn [14±16]. Recently

they were also detected in the female reproductive tract

Q 2000 Blackwell Science Ltd

Institute for Anthropology and Human Genetics, J. W. Goethe-

University, Frankfurt, Germany (M. Frye, R. Gropp);

Department of Internal Medicine II, University Hospital

Frankfurt, Frankfurt, Germany (J. Bargon, T. O. F. Wagner);

Department of Internal Medicine, St Barbara-Hospital,

Gladbeck, Germany (B. Lembcke).

Correspondence to: Roswitha Gropp, PhD, Bernina-Biosystems,

Am Klopferspitz 19, 82152 Martinsried, Germany. Tel.: +49-89-

89511220; fax: +49-89-89511229; e-mail: gropp@bernina-

biosystems.com

Received 28 February 2000; accepted 10 March 2000.

696 M. Frye et al.

[17,18]. The defensins hBD1 and hBD2 belong to the

family of b-defensins [19,24]. Both b-defensins differ sig-

ni®cantly with respect to their expression pattern; hBD1 is

highly expressed in the kidney and considered to be constitu-

tively expressed in epithelial organs [21±23] while hBD2 is

most abundant in in¯amed skin and expressed at low levels in

other epithelial organs [24,25]. Their main difference, how-

ever, is their different inducibility. Upon exposure to bacteria or

cytokines (e.g. tumour necrosis factor-a, interleukin-1b)

hBD2 expression is highly induced [26]. Whereas, hBD1 is

considered to be constitutively expressed [21].

Furthermore, due to the high microbicidal activity

against a broad spectrum of micro-organisms, the idea of

using defensins as `antibiotics' in the prevention and ther-

apy of gastrointestinal infections is intriguing. Knowledge

about the expression pattern of defensins and mechanisms

underlying the regulation of expression, however, is pre-

requisite for any clinical study. Several recent studies have

elucidated the importance of hBD1 and hBD2 in the

airways [22,25,28,29], but nothing has been known

about the distribution of human b-defensins throughout

the gastrointestinal tract until now.

In this study we ®rst evaluated data concerning the

expression of defensins throughout the gastrointestinal

tract and then identi®ed the cellular localization of hBD1

mRNA in ileal mucosa.

Methods and materials

Subjects

Mucosal specimens were obtained at routine endoscopy

(Olympus 1T130 gastroscope, Olympus colonoscope

Hamburg, Germany). Forceps biopsies were taken from

the normal gastric corpus (n� 4), antrum (n�4), duode-

num (n� 5) and colon (n� 5), as well as from each patient

with untreated and treated coeliac sprue. These patients,

except the two patients with coeliac sprue, underwent

endoscopy for the exclusion of organic diseases. Jejunal

mucosa was obtained by biopsy of a patient with BII-

resection who did not show any mucosal lesion at endo-

scopy. The patient providing ileal mucosa underwent total

colectomy for severe ulcerative colitis. All mucosal speci-

mens used were from unremarkable mucosa and were

especially free from in¯ammation. The samples were trans-

ferred to ice and immediately used for RNA-isolation or

®xed in 4% paraformaldehyde for in situ hybridization. In

most patients two biopsies were separately analysed. As we

did not observe signi®cant differences in the level of defensin

expression the analysis of only one patient is shown.

Biopsy and specimen acquisition was performed in

accord with the declaration of Helsinki and all patients

gave their fully informed consent.

RNA-isolation and polymerase chain reaction

(PCR) analysis

Total RNA was isolated from the mucosal samples by using

RNAzol BTM (Wak-Chemie, Bad Homburg, Germany) and

1±5mg of total RNA were reverse transcribed (RT) into cDNA

using SuperscriptTMII system (Gibco BRL, Eggenstein,

Germany) both by following the manufacturers' instructions.

The expression values of each defensin were quanti®ed

by semiquantitative PCR analysis. Therefore, the defensin

cDNA and a gene fragment of the housekeeping gene

glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as

an internal standard were ampli®ed in the same tube. The

adequate PCR conditions were empirically determined.

The most critical aspect for quanti®cation studies is the

number cycles because of the self-limiting process of PCR

reactions. In PCR reactions up to 32 cycles the amount of

all analysed targets was doubled in samples with highest

concentrations of cDNA. Therefore, the DNA targets were

ampli®ed for 30 cycles.

All PCR reactions were performed as follows: 1 mL of

cDNA was used for ampli®cation with 0´5 U Taq DNA

Polymerase (Qiagen, Hilden, Germany), 1 ´ PCR buffer,

0´1 mM dNTPs (each) and 1 pmol of each speci®c

upstream and downstream primer (MWG-Biotech, Ebers-

berg, Germany; primers: HD5, 50 ATGAGGACCATCGC

CATCC, 30 TCAGCGACAGCAGAGTCTG; HD6, 50

ATGAGAACCCTCACCATCC, 30 TCAGAGGCAGCA

GAATCT; hBD1, 50 ATGAGAACTTCCTACCTTCTG,

30 TCACTTGCAGCACTTGGCC; hBD2, 50 CCAGCC

ATCAGCCATGAGGGT; 30 GGAGCCCTTTCTGAAT

CCGCA; GAPDH, 50 ATCTTCCAGGAGCGAGATCC;

30 ACCACTGACACGTTGGCAGT). The denaturing

and extension temperatures were 94 8C and 72 8C, respec-

tively. The annealing temperature for all primers was 60 8C.

PCR reactions, especially for analysing hBD1 and hBD2,

were performed with positive and negative controls. As

negative control for hBD1 we used cDNA of melanocytes.

In this case hBD1 was not detectable. As positive control

for hBD2 expression we used cDNA of stimulated

keratinocytes (HaCaT, Prof. Fusenig, DKFZ, Heidelberg,

Germany). This cell line was incubated with Pseudomonas

aeruginosa. All expression values were veri®ed by at least

two independent RT-PCRs.

Densitometric analysis of PCR results

Ethidium bromide-stained agarose gels were analysed

by densitometry and compared in semiquantitative

manner using the ZERO-DSCANTM software (Scanalytics,

Billerica, MA). The ratio of the PCR-fragment intensities

of defensins relative to GAPDH was determined.

In situ hybridization

The complete hBD1 cDNA fragment was obtained by RT-

PCR from a human bronchial cell culture (16HBE14o-)

using gene-speci®c primers as described above. Full-length

cDNA of hBD1 was gel-puri®ed (QIAquick Gel Extraction

Kit, Qiagen, Hilden, Germany) and cloned into pGEM-T-

easy Vector (Promega, Mannheim, Germany). The construct

Q 2000 Blackwell Science Ltd, European Journal of Clinical Investigation, 30, 695±701

Human defensin expression in the digestive tract 697


was con®rmed by DNA sequencing. The template was

linearized and 35S-labelled probes (sense and antisense;

Hartmann Analytics, Braunschweig, Germany) were pre-

pared using RiboprobeÒ Germini System II (Promega,

Mannheim, Germany) according to the manufacturers'

instructions.

Hybridization steps were conducted according to con-

ventional methods with some modi®cations. Brie¯y, just

before hybridization, the slides were treated with

50 mg mLÿ1 proteinase K, rinsed with phosphate-buffered

saline (PBS) and acetylated with 0´1 M triethanolamine

and 0´25% acetic anhydride. The slides were dehydrated in

graded ethanol and air dried. Riboprobe was denatured at

80 8C before adding to the hybridization mix containing

10 mM dithiothreitol, 50% formamide, 0´3 M NaCl,

20 mM Tris (pH 8´0), 5 mM ethylenediaminetetraacetic

acid (EDTA), 10% dextran sulphate, 1´ Denhardt's solu-

tion and 0´5 mg mLÿ1 tRNA. The hybridization solution

was spread over the sections and allowed to hybridize at

60 8C for 16±20 h. After hybridization, sections were

washed with high stringency (50% formamide, 2´ SSC,

and 20 mM dithiothreitol) at 65 8C for 30 min, rinsed with

0´5 M NaCl, 10 mM Tris, 5 mM EDTA and treated with

20 mg mLÿ1 RNase A. After a second series of high strin-

gency washes and dehydration the sections were coated

with LM-1 autoradiography emulsion (Amersham,

Braunschweig, Germany), exposed at 4 8C before being

developed, and then counterstained with toluidine blue.

Localization of neutrophilic myeloid and tissue

mast cells

To exclude that the positive signals of hBD1 in epithelial

cells obtained by in situ hybridization were caused by other

cell types, such as incoming neutrophils, we selectively

stained neutrophilic myeloid cells and tissue mast cells using

the naphthol AS-D chloracetate esterase procedure [20].

Results

PCR analysis

Figure 1 demonstrates some quanti®cation results obtained

by RT-PCR of hBD1 (Fig. 1a), hBD2 (Fig. 1b) as well as

HD5 (Fig. 1c) and HD6 (Fig. 1d). The GAPDH fragment

of 500 base pairs (bp) was expressed at the same levels in

the biopsies. In contrast, the intensity of defensin PCR

fragments varied between the samples. Furthermore, the

high quality of the PCR reaction, without background and

unspeci®c PCR fragments, resulted from nondenatured

and freshly isolated RNA.

Quanti®cation of b-defensins

The hBD1 and hBD2 mRNA was quanti®ed in stomach

(corpus and antrum), duodenum, jejunum, ileum and

colon. Figure 2(a) depicts the mRNA levels of hBD1

throughout the gastrointestinal tract. In all mucosal speci-

mens examined, the hBD1 mRNA was quanti®ed at rather

low levels. Furthermore, in samples from the stomach,

duodenum, jejunum and the ileum no signi®cant variability

of mRNA levels was detected. Taken together, the mRNA

levels in the duodenum and jejunum were lower compared

to those in the stomach, ileum and colon. A higher expres-

sion was found in the colon and only here were the levels of

hBD1 mRNA variable from individual to individual.

In all gastrointestinal biopsies analysed in our series no

hBD2 mRNA expression was detected using semiquanti-

tative RT-PCR (Fig. 2b), whereas high expression values

were measured in positive controls (Fig. 1b; lane 8). The

positive control was represented by a cell line (HaCaT)

incubated with P. aeruginosa.

Quanti®cation of a-defensins

The a-defensins HD5 and HD6 mRNA could be quanti-

®ed in the duodenum, jejunum, ileum and in the colon

(Fig. 2c,d). No signal of either HD5 or HD6 mRNA was

detected in biopsies from the stomach (either corpus or

Figure 1 Semiquantitative reverse transcription±polymerase

chain reaction (RT-PCR) expression analysis of human epithelial

defensins with GAPDH as a standard (500 base pairs). All PCR

reactions were performed with controls (C); a PCR reaction con-

taining all required supplements, with the exception of DNA. (a)

Expression values of hBD1 mRNA of colon (lane 1), duodenum

(lane 2) stomach (lane 3) and negative control (melanocytes;

lane 4); (b) expression values of hBD2 mRNA of stomach (lane

5), duodenum (lane 6), jejunum (lane 7) and a positive control

(bacteria-stimulated cell line; lane 8); (c) expression values of

HD5 mRNA of duodenum (lane 9), colon (lane 10 and 11) and

jejunum (lane 12); (d) Expression values of HD6 mRNA of duo-

denum (lanes 13±15) and colon (lane 16).

698 M. Frye et al.

antrum). Expression of HD5 and HD6 mRNA among

different individuals was highly variable, both in the duo-

denum (n� 5) and in the colon (n� 5). The highest

expression of HD5 and HD6 mRNA was found in the

ileum and/or the jejunum which can be attributed to the

amount of Paneth cells within these segments. To examine

whether the epithelial a-defensin expression is actually

correlated with the amount of Paneth cells within the

same tissue, we compared the HD5 and HD6 mRNA

levels of control samples with tissue samples of a patient

with untreated coeliac sprue, which is characterized by

villous atrophy. The ratio between crypt and villous cells

is altered in favour of crypt cells. In duodenal biopsies from

a patient with coeliac sprue only mRNA levels of a-

defensins were increased (two- to four-fold), while hBD1

mRNA remained low (Fig. 3, SA). Conversely, in a coeliac

sprue patient who underwent duodenal biopsy in remission

(i.e. under gluten-free diet) with improved villous archi-

tecture, no signal of HD5 and HD6 was detected in

duodenal biopsy (Fig. 3, SR).

Intracellular localization of ileal hBD1

In situ hybridization with 35S-labelled hBD1 antisense

probe revealed a strong speci®c signal in the crypts of

LieberkuÈhn of the ileum (Fig. 4a). No signal could be

detected with sense probes of hBD1 mRNA as control

(Fig. 4b). This ®nding showed that hBD1 is located in

Paneth cells, like other antimicrobial peptides which are

involved in local host defence. In contrast to both a-

defensins, hBD1 mRNA expression is not restricted to

the Paneth cells. Epithelial cells from the villous region

also showed a speci®c signal for hBD1 (Fig. 4c,d).

Localization of neutrophilic myeloid and tissue

mast cells

The red stained neutrophilic myeloid cells and tissue mast

cells in tissue sections of ileum were localized in the

connective tissue and were not co-localized with the

hBD1 mRNA (Fig. 4e,f).

Discussion

This report is the ®rst identifying human b-defensin

mRNA in various regions of the digestive tract. In our

study, hBD1 mRNA was quanti®ed in all samples analysed

at relatively low levels. Variability among all samples from

the gastrointestinal tract (stomach to colon) was small,

while hBD1 mRNA levels in the colon were slightly

higher than in the other segments of the digestive tract

(Fig. 2a). To date, hBD1 expression has been detected for

example in human airways, kidney, urogenital tract and

gingival tissue [21±23,27]. Taking into account the data

from all these studies as well as the results obtained from

in vitro experiments, the mechanism underlying the expres-

sion of hBD1 is far from being understood. In the lung,

hBD1 mRNA levels were described as low and constitutive

[21,22]. Analysis of hBD1 in gingival biopsies suggests

variable expression levels, however, the expression was

unresponsive to bacterial in¯ammatory stimuli [27].

Furthermore, hBD1 is a dominant microbicidal peptide

of the urogenital tract and there, interindividual variability

of expression levels has also been observed [23]. Finally,

our own results suggest induced hBD1 mRNA expression

in nasal epithelia during acute rhinitis [30]. Thus, hBD1

expression responds to pathological stimuli. The nature of


Figure 2 Expression pattern of b-defensins hBD1 and hBD2

and a-defensins HD5 and HD6 mRNA throughout the gastroin-

testinal tract with samples of stomach (corpus, 1±4; antrum, 5±

8), duodenum (9±13), jejunum (14), ileum (15) and colon (16±

20). The mRNA values of all defensins were quanti®ed relative

to GAPDH in per cent (ordinate). (a) Quanti®cation of hBD1

mRNA revealed in a tissue-speci®c pro®le with the highest level

in colon. (b) In all specimens examined no hBD2 mRNA signal

was detectable under these conditions. (c) HD5 mRNA could be

quanti®ed in duodenum, jejunum, ileum and colon. The highest

expression values were found in jejunum and ileum. (d) HD6

mRNA was most abundant in ileum but could also be quanti®ed

in duodenum, jejunum and colon. V, mRNA was not detectable.



such stimuli, however, have so far eluded identi®cation.

Since none of the hitherto observed conditions with

induced hBD1 expression correlate with bacterial infec-

tions, alternative factors, e.g. steroids, cell differentiation

and development, have to be taken into consideration

[31,32]. The low expression level of hBD1 mRNA we

observed throughout the gastrointestinal tract does not

necessarily result from constitutive expression of this b-

defensin in these epithelia, but most probably re¯ects the

normal expression under physiological conditions. All ana-

lysed specimens were from unremarkable mucosa and were

especially free from in¯ammation.

In all gastrointestinal biopsies that we analysed, the

mRNA of the b-defensin hBD2 was not detectable by

semiquantitative RT-PCR (Fig. 2b). In contrast, hBD2

was expressed in positive controls (Fig. 1b; lane 8). As

positive control we used a cell line incubated with bacteria.

Considering the extremely variable mRNA values of the

a-defensins HD5 and HD6 in unremarkable intestinal

mucosa observed in our study, the expression pattern of

defensins throughout the gastrointestinal tract is apparently

even more complex. Neither HD5 nor HD6 mRNA were

detectable by PCR in gastric biopsies. In the intestine,

HD5 mRNA was most abundant in jejunum and ileum,

whereas the highest expression value of HD6 mRNA was

found in ileum (Fig. 2c,d). The samples of jejunum and

ileum were both endoscopically and histologically free of

in¯ammation. The expression levels of HD5 and HD6 are

plausible with regard to the distribution of Paneth cells in

the intestinal tract. Paneth cells are most abundant in the

region of the jejunum and ileum. They populate the crypts

of LieberkuÈhn and are considered as effectors of mucosal

barrier function [33]. The release of lysozyme, secretory

phospholipase A2 and defensins by Paneth cells may

in¯uence the micro¯ora of the crypt environment

[14,15,34,35]. The a-defensins are prominent constituents

of mouse and human Paneth cell granule vesicles [16,36].

Nothing is known about regulatory factors of epithelial

a-defensin gene expression. So far, induced expression of

intestinal HD5 has been observed only in the Paneth cells

of newborns with necrotizing enterocolitis [37]. In recent

studies, HD5 was shown to be also expressed in the female

reproductive tract, where the HD5 mRNA expression was

elevated by hormonal alterations and in¯ammation [18].

Most interestingly, two- to four-fold increased HD5 and

HD6 expression was observed in a patient with coeliac

sprue. Although a thorough clinical study will be necessary

to prove the clinical relevance; this observation suggests

that the expression of both a-defensins might be correlated

with the morphological alteration in intestinal epithelium.

In contrast, hBD1 expression remained low (Fig. 3).

Results obtained from in situ hybridization might explain

this discrepancy. HBD1 was exclusively detected in goblet

cells, enterocytes and Paneth cells (Fig. 4a±d) and not in

other cell types which contribute to innate immunity, like

neutrophils (Fig. 4e,f), whereas HD5 and HD6 expression

is restricted to Paneth cells. Coeliac sprue is characterized

by a disruption of the integrity of the intestinal epithelium.

Due to villous atrophy the ratio of crypt to villous cells is

altered in favour of crypt cells. In this scenario a relative

preponderance of Paneth cells vs. goblet cells and enter-

ocytes occurs. In consequence, more a-defensins are

observed. The ®nding that the hBD1 expression remained

constant might result from the loss of goblet cells and

Figure 3 Quanti®ed mRNA levels of hBD1, hBD2, HD5 and

HD6 in duodenal samples relative to the intensity of the standard

GAPDH in per cent (ordinate). Elevated mRNA levels of HD5

and HD6 were measured in samples of a patient with acute

coeliac sprue (SA), compared to a biopsy of a patient with coe-

liac sprue in remission (SR) and control samples (1±5); V,

mRNA was not detectable.

700 M. Frye et al.

enterocytes counterbalancing the proliferation of Paneth

cells. Alternatively, we cannot exclude that coeliac

sprue causes an environment which induces the expression

of a-defensins and not b-defensins.

Our study strongly supports the importance of further

investigations which elucidate the regulation mechanisms

of epithelial defensins in the intestine.

Acknowledgements

This work was supported by a grant from the BMBF

(FKZ: 01KV95526) and Mukoviszidose e.V. We thank

U. Langenbeck for unsel®sh and generous support. We

also thank G. Herrmann for ASDCL staining.

References

1 Hancock RE, Falla T, Brown M. Cationic bacterial peptides.

Adv Microb Physiol 1995;37:135±75.

2 Boman HG. Peptide antibiotics and their role in innate

immunity. Annu Rev Immunol 1995;13:61±92.

3 Lehrer RI, Ganz T. Endogenous vertebrate antibiotics.

Defensins, protegrins, and other cysteine-rich antimicrobial

peptides. Ann NY Acad Sci 1996;797:228±39.

4 Martin E, Ganz T, Lehrer RI. Defensins and other endo-

genous peptide antibiotics of vertebrates. J Leuk Biol

1995;58:128±36.

5 Lehrer RI, Lichtenstein AK, Ganz T. Defensins: antimicro-

bial and cytotoxic peptides of mammalian cells. Annu Rev

Immunol 1993;11:105±28.

6 Ganz T, Lehrer RI. Defensins. Pharmacol Ther 1995;66:

191±205.

7 Ganz T, Weiss J. Antimicrobial peptides of phagocytes and

epithelia. S Hematol 1997;34:343±54.

8 Kagan BL, Selsted BE, Ganz T, Lehrer RI. Antimicrobial

defensin peptides form voltage-dependent ion-permeable

channels in planar lipid bilayer membranes. Proc Natl Acad

Sci USA 1990;87:210±14.

9 White SH, Wimley WC, Selsted BE. Structure, function, and

membrane integration of defensins. Curr Opin Struct Biol

1995;5:521±7.

10 Wimley WC, Selsted ME, White SH. Interactions between

human defensins and lipid bilayers: Evidence for formation of

multimeric pores. Protein Sci 1994;3:1362±73.


Figure 4 (a) Paraf®n-embedded section of adult ileum hybri-

dized with 35S-labelled antisense hBD1 mRNA. Positive signals

were detected in crypts of LieberkuÈhn. (b) Control sections

hybridized with 35S-labelled sense hBD1 mRNA with no unspe-

ci®c signals. (c) In situ hybridization with antisense hBD1

mRNA focused on epithelial cells of the villi revealed in a speci®c

signal in goblet cells and enterocytes. (d) Control sections, hybri-

dized with sense hBD1 mRNA. (e) Localization of neutrophilic

myeloid cells and tissue mast cells by naphthol AS-D chlorace-

tate esterase procedure in sections of the ileal mucosa focused on

villous cells and (f) focused on crypt cells.



11 Miyasaki KT, Bodeau AL, Ganz T, Selsted ME, Lehrer RI.

In vitro sensitivity of oral, gram-negative, facultative bacteria

to the bactericidal activity of human neutrophil defensins.

Infect Immun 1990;58:3934±40.

12 Ogata K, Linzer BA, Zuberi RI, Ganz T, Lehrer RI,

Catanzaro A. Activity of defensins from human neutrophilic

granulocytes against Mycobacterium avum±Mycobacterium

intracellulare. Infect Immun 1992;60:4720±5.

13 Daher KA, Selsted ME, Lehrer RI. Direct inactivation of

viruses by human granulocyte defensins. J Virol

1986;60:1068±74.

14 Jones DE, Bevins CL. Paneth cells of the human small

intestine express an antimicrobial peptide gene. J Biol Chem

1992;267:23216±25.

15 Jones DE, Bevins CL. Defensin-6 mRNA in human Paneth

cells: implications for antimicrobial peptides in host defense

of the human bowel. FEBS Lett 1993;315:187±92.

16 Porter EM, Liu L, Oren A, Anton PA, Ganz T. Localization

of the human intestinal defensin 5 in Paneth cell granules.

Infect Immun 1997;65:2389±95.

17 Svinarich DM, Wolf NA, Gomez R, Gonik B, Romero R.

Detection of human defensin 5 in reproductive tissues. Am J

Obstet Gynecol 1997;176:470±5.

18 Quayle AJ, Porter EM, Nussbaum AA, Wang YM, Brabec C,

Yip KP et al. Gene expression, immmunolocalization, and

secretion of human defensin-5 in human female reproductive

tract. Am J Pathol 1998;452:1247±58.

19 Bensch KW, Raida M, Magert HJ, Schulz-Knappe P, For-

ssmann WG. hBD-1: a novel beta-defensin from human

plasma. FEBS Lett 1995;368:331±5.

20 Leder LD. The selective enzymatical demonstration of

neutrophilic myeloid cells and tissue mast cells in paraf®n

sections. Klin Wochenschr 1964;42:533.

21 Zhao C, Wang I, Lehrer RI. Widespread expression of

human beta-defensin hBD-1 in human secretory glands and

epithelial cells. FEBS Lett 1996;396:319±22.

22 McCray PB, Bentley L. Human airway epithelia express a

beta defensin. Am. J Respir Cell Mol Biol 1997;16:343±9.

23 Valore EV, Park CH, Quayle AJ, Wiles KR, McCray PB Jr,

Ganz T. Human b-defensin-1: an antimicrobial peptide of

urogenital tissues. J Clin Invest 1998;101:1633±42.

24 Harder J, Bartels J, Christophers E, Schroeder JM. A peptide

antibiotic from human skin. Nature 1997;387:861±2.

25 Bals R, Wang X, Wu Z, Freeman T, Bafna V, Zasloff M et al.

Human b-defensin 2 is a salt-sensitive peptide antibiotic

expressed in human lung. J Clin Invest 1998;102:874±80.

26 Schroeder JM, Harder J. Human beta-defensin-2. Int J Bio-

chem Cell Biol 1999;31:645±51.

27 Krisanaprakornkit S, Weinberg A, Perez CN, Dale BA.

Expression of the peptide antibiotic human b-defensin 1 in

cultured gingival epithelial cells and gingival tissue. Infect

Immun 1998;66:4222±8.

28 Goldmann MJ, Anderson GM, Stolzenberg ED, Kari UP,

Zasloff M, Wilson MJ. Human b-defensin-1 is a salt sensitive

antibiotic in lung that is inactivated in cystic ®brosis. Cell

1997;88:553±60.

29 Smith JJ, Travis SM, Greenberg E, Welsh MJ. Cystic ®brosis

airway epithelia fail to kill bacteria because of abnormal

airway surface ¯uid. Cell 1996;85:229±36.

30 Daueletbaev N, Gropp R, Frye M, Loitsch S, Wagner TOF,

Bargon J. Impairment of beta defensins mRNA expression in

CF nasal epithelium. Pediatric Pulmonol 1998;17:372.

31 Herwig S, Su Q, Zhang W, Ma YS, Tempst P. Distinct tem-

poral patterns of defensin mRNA regulation during drug-

induced differentiation of human myeloid leukemia cells.

Blood 1996;87:350±64.

32 Huttner KM, Brezinski-Caliguri DJ, Mahoney MM,

Diamond G. Antimicrobial peptide expression is develop-

mentally regulated in the ovine gastrointestinal tract. J Nutr

1998;128:297S±299S.

33 Ouellette AJ. Paneth cells and innate immunity in the crypt

microenvironment. Gastroenterology 1997;113:1779±84.

34 Ghoos Y, Vantrappen G. The cytochemical localization

of lysozyme in Paneth cell granules. Histochem J 1971;3:

175±8.

35 Minami T, Tojo H, Shinomura Y, Matsuzawa Y, Okamoto M.

Puri®cation and characterization of phospholipase A2 from

ileal mucosa. Biochim Biophys Acta 1993;1170:125±30.

36 Ouellette AJ, Hsieh MM, Nosek MT, Cano-Gauci DF,

Huttner KM, Buick RN et al. Mouse Paneth cell defensins:

Primary structures and antimicrobial activities of numerous

cryptdin isoforms. Infect Immun 1994;62:5040±7.

37 Salzman NH, Polin RA, Harris MC, Ruchelli E, Hebra A,

Zirin-Butler S et al. Enteric defensin expression in necrotizing

enterocolitis. Ped Res 1998;44:20±6.

Differential expression of human α- and β-defensins mRNA in gastrointestinal epithelia

Documents

Transcript of Differential expression of human α- and β-defensins mRNA in gastrointestinal epithelia