GENOMICS 14, 634-642 (1992)

Construction of a Yeast Artificial Chromosome Contig Encompassing the Human 5(IV) Collagen Gene (COL4A5)

DAVID VETRIE,* FRANCES FLINTER,* MARTIN BOBROW,* AND ANN HARRIS'-

*Paediatric Research Unit, Division of Medical and Molecular Genetics, United Medical and Dental Schools of Guy's and St. Thomas's Hospitals, Guy's Campus, London SE1 9RT, United Kingdom; and t Paediatric Molecular Genetics, Institute of Molecular Medicine,

The John Radcliffe Hospital, Headington, Oxford OX3 9DU, United Kingdom

Received April 29, 1992; revised August 4, 1992

A P C R - b a s e d s c r e e n i n g a p p r o a c h w a s u s e d to i s o l a t e s i x y e a s t ar t i f i c ia l c h r o m o s o m e (YAC) c l o n e s c o n t a i n - ing s e g m e n t s o f t h e h u m a n ~ 5 ( I V ) c o l l a g e n g e n e ( C O L 4 A 5 ) . T h i s g e n e is l o c a t e d at X q 2 2 and is k n o w n to be i n v o l v e d in the k i d n e y d i s o r d e r k n o w n as A l p o r t s y n d r o m e (AS) . B y a n a l y z i n g s e q u e n c e - t a g g e d s i t e s , c D N A c o n t e n t , and r a r e - c u t t i n g r e s t r i c t i o n s i t e pat - t e r n s in t h e s e Y A C c l o n e s , a c o n t i g tha t s p a n s the en- t i r e t y o f t h e ~ 5 ( I V ) g e n e w a s c o n s t r u c t e d . T h i s c o n t i g m a y c o n t a i n as m u c h as 6 9 0 k b o f D N A f r o m the ~ 5 ( I V ) locus . On the b a s i s o f the i n f o r m a t i o n o b t a i n e d f r o m t h e s e Y A C c l o n e s , the g e n o m i c m a p and g e n e s t r u c t u r e o f t h e ~ 5 ( I V ) g e n e h a v e b e e n re f ined . T h i s s t u d y has a l so p r o v i d e d a v a l u a b l e r e s o u r c e for s u b s e q u e n t s tud- i e s o f the a 5 ( I V ) g e n e and i ts f l a n k i n g D N A s e q u e n c e s . © 1992 Academic Press, Inc.

INTRODUCTION

Type IV collagen, the major structural component of basement membranes, consists of a group of structurally and functionally related proteins present in a wide vari- ety of organisms. In humans, this collagen family has been shown to include at least five distinct collagen a- chains. The a5-chain of type IV collagen (Hostikka et al., 1990; Myers et al., 1990) is of particular interest be- cause it has been shown to be involved in Alport syn- drome (AS) (Barker et al., 1990; Zhou et al., 1991a; Boye et al., 1991). This X-linked progressive kidney disorder is characterized by hematuria, chronic renal failure, and splitting and thickening of the glomerular basement membrane (GBM) and is often accompanied by deafness and eye lesions (Flinter et al., 1988; Flinter and Chantler, 1990). The gene encoding the a5(IV) chain (COL4A5) covers at least 110 kb of genomic DNA (Ve- trie e t al., 1992a) and is located on the middle of the long arm of the X chromosome at Xq22. The exon-intron structure of approximately 50 kb at the 3'-end of this gene has been characterized in bacteriophage h clones (Zhou et al., 1991b). However, to study further the struc- tural organization of the a5(IV) gene of both normal and

AS individuals, it would be useful to isolate the entire gene in a series of overlapping cloned DNA segments.

The advent of yeast artificial chromosomes (YACs) (Burke e t al., 1987) has provided a system that allows long-range coverage of regions of genomic DNA in cloned form. YAC cloning has already been applied to isolate large regions of DNA encompassing a number of genes implicated in genetic diseases (Green and Olson, 1990a; Anand et al., 1991; Gaensler et al., 1991; Palmieri et al., 1992; Coffey et al., 1992; Monaco et al., 1992). The isolation of YAC clones, and their subsequent assembly into contigs, has been greatly facilitated through the use of PCR-based screening of sequence-tagged sites (STSs) (Green and Olson, 1990b).

With the aim of establishing complete continuity across the a5(IV) collagen gene in cloned DNA, we used a PCR-based screening approach to isolate clones from two YAC libraries. Six clones were isolated and subse- quently analyzed to construct a contig spanning the en- tirety of the a5(IV) gene. The analysis of these YACs with respect to STSs, cDNA content, and rare-cutting restriction sites has provided additional information re- garding the gene structure of a5 (IV) and allowed refine- ment of the genomic map. These clones will also serve as a reagent in the search for other genes neighboring the a5(IV) locus, which may be implicated in Alport syn- drome.

MATERIALS AND METHODS

Screening of the Y A C libraries. YAC clones were isolated from the partial EcoRI libraries of Washington University (Brownstein et al., 1989) and the Imperial Cancer Research Fund (ICRF) (Larin et al., 1991). A two-step screening strategy was used to identify a5(IV) YAC clones. First, DNA samples representing pools of clones from either library were screened using a PCR-based approach (Green and Olson, 1990b) with reactions 4A5-1 and 4A5-18 (Table 1). Second, high-den- sity grids of YAC clones (Bentley et al., 1992) that corresponded to each positive PCR pool were hybridized with the a5(IV) partial cDNAs PF17-3 and PF7A (Fig. 1).

PCR analysis. Nine STSs representing 11 of the 18 exons at the 3'-end of the a5(IV) gene (exons being numbered from the 3'-end) were used to initially characterize YAC clones by colony PCR (Huxley et al., 1990). Amplification was in 15-td reactions containing 150 ng of

0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc. All rights of reproduction in any form reserved.

634

YAC CONTIG ACROSS COL4A5

T A B L E 1

P r i m e r S e q u e n c e s a n d S i ze s o f E x p e c t e d P r o d u c t s f o r E x o n - S p e c i f i c S T S s U s e d in t h e C h a r a c t e r i z a t i o n o f a5 (IV) Y A C C l o n e s

635

STS Exon(s) Primer 1 (5' -~ 3') Primer 2 (5' -~ 3') Size (bp)

4A5-1" 1 GATCTGATTGTCTTATTTC GTATTCTAGGGTTTCCTAC 676 4A5 -4 4 ATCTTTCTAGGGACGGCTGG CAATGCCTTACCGACTAATG 199 4A5 -5 5 GTATACTGATTATTTCGTGG TTGATTATCTCACCCAAGTC 252 4A5-6 6 GAATGCCTCATTCTTTTCCTG CTTGTCTTACCTGGCTGTCC 133 4A5-7 7 TTGTCTCATAGGTCCTCCTG AAGATGATCTGCATTGGTAC 160 4A5-89 8 and 9 TTATTCAGGGTAATCCTGGC GGTATAACTATCTTCAGGAA 316 4A5-10 10 GTGGATTATTAAGGTCTACC CCATTTCCTACCTGGAGTCC 158 4A5-1617 16 and 17 GGTCTCCCTGGACAGCCAGG AAGACCTGGAAGACCAATGC 501 4A5-18" 18 CTTGCCTCTTCTACTCATTC CTATCACACTTACCTGGTGG 137

* STS used in library screening. All primers were designed from the sequence data of Zhou et al. (1991). Conditions for amplification are under Materials and Methods.

each oligonucleotide primer, 67 mM Tris-HC1, pH 8.8, 16 mM (NH4)2SO4, 0.5 mM of each deoxyribonucleoside triphosphate (dATP, dTTP, dCTP, dGTP), 1.5 units Amplitaq (Cetus Inc.), 10 mM fl-mer- captoethanol, and 170 pg/ml bovine serum albumin (Sigma A-4628). Thirty cycles of PCR under the conditions 93°C/1 min, 60°C/1 min, 72°C/3 min were performed in a DNA thermal cycler (Perkin-Elmer/ Cetus). The primer sequences and product sizes for each STS are shown in Table 1.

YAC DNA preparation and restriction endonuclease digestion. Yeast chromosomal DNA was prepared in agarose blocks using the lithium dodecyl sulfate method (Anand et al., 1989) to yield approxi- mately 5 #g DNA per 100-td block. Restriction endonuclease digestion of DNA in blocks was as described in Vetrie et al. (1992a). Blocks containing DNA digested with EcoRI and PstI were melted at 68°C, cooled to 37°C, and treated with 5 units of agarase (Calbiochem) for 4 h prior to analysis.

Conventional and pulsed-field gel electrophoresis. EcoRI and PstI digests were electrophoresed through 1% agarose in 1× Tris-acetate- EDTA at 200 V and 8°C for 5 h. DNA blocks digested with BssHII, MluI, NotI, NruI, SalI, SfiI, and XhoI were analyzed on 1% agarose gels in 0.5× Tris-borate-EDTA buffer using contour-clamped homo- geneous electric field electrophoresis (DR-II, Bio-Rad). Additional PFGE conditions are described in the figure legends. Following electro- phoresis, the DNA in the agarose gels was nicked using 0.15 M HC1 for 15 min (conventional gels) or a 254-nm UV light source for 30 s (PFGE gels) and transferred (Southern, 1975) in 20× SSC to Hybond- N (Amersham). After transfer, filters were air-dried and the DNA was crosslinked using a 302-nm UV source for 5 rain.

Isolating end probes from YACs. End probes from several of the a5(IV) YAC clones were generated using a modified vectorette method (Riley et al., 1990). The vectorette libraries were constructed using RsaI. A 50-ttl PCR reaction included 5 ~l of the library, 1 unit of Perfect Match (Stratagene), and primer 1089 or 1091 with 224 (primers as in Riley et al., 1990). Reaction conditions were 93°C/1 rain, 65°C/1 min, 72°C/3 min for 38 cycles. The amplified product was subjected to a further 20 rounds of PCR (without Perfect Match) us- ing primers in the sup-4 gene (5'-GTTGGTTTAAGGCGCAAGAC-3' for the "left" end and 5'-GTCGAACGCCCGATCTCAAG-3' for the "right" end) along with the 224 primer. End probes were gel purified from 2.5% agarose minigels using Geneclean (Stratagene).

Probes and filter hybridization. The cDNA probes used in this study represent 95% of the a5(IV) coding sequence. The PF17 series of probes (Myers et al., 1990; Pihlajaniemi et al., 1990) found exclu- sively in the 5'-half of the coding sequence within the 7S and collage- nous domains include EcoRI fragments of 0.68 kb (PF17-2), 1.2 kb (PF17-1), and 0.55 kb (PF17-3). The probes HE6, PF7B, and PF7A (Myers et al., 1990; Pihlajaniemi et al., 1990) are 1.4-, 1.3-, and 1.2-kb EcoRI fragments, respectively, and constitute the 3'-half of the full- length cDNA. The probe JZ4 contains sequences coding for the 7S and

collagenous domains at the extreme 5'-terminus of the a5(IV) chain (J. Zhou, personal communication). The locations of each of these cDNA probes are shown on the long-range restriction map of a5(IV) in Fig. 1. The orientations of YACs across the a5(IV) gene were deter- mined using vectorette end probes, a 2.2-kb EcoRI-PvuII fragment of pBR322 ("left" end probe) and a 1.4-kb PvuII-SalI fragment of pBR322 ("right" end probe). Probes were labeled either individually or in pools with [a-mP]dCTP using the random hexanucleotide prim- ing method (Feinberg and Vogelstein, 1983) to a specific activity of 1-3 x 109 cpm/#g. Vectorette end probes were prereassociated with sonicated human placental DNA prior to use in hybridizations (Sealey et al., 1985). Conditions for filter hybridization and autoradiography are described in detail elsewhere (Vetrie et al., 1992a).

RESULTS

A n a l y s i s o f Y A C Clones by S T S a n d c D N A C o n t e n t

T h e n i n e S T S s u s e d to c h a r a c t e r i z e Y A C c lones (Ta -

b le 1) were d e r i v e d f r o m s e q u e n c e d a t a for e x o n s a t t h e 3 ' -end of t h e a5 ( IV) gene (Zhou et al., 1991a). T h e two S T S s 4A5-1 (exon 1) a n d 4A5-18 (exon 18), l o c a t e d a t

l eas t 40 kb apa r t , were u s e d to s c r e e n t h e Y A C l ibrar ies .

S ix Y A C c lones were i so la ted: four f r o m t h e W a s h i n g t o n U n i v e r s i t y l i b r a ry (c lones y C O L I - 1 , y C O L I - 2 , y C O L 1 8 -

1, y C O L 1 8 - 2 ) a n d two f r o m t h e I C R F l ib ra ry (c lones

y C O L P F - 1 a n d y C O L P F - 2 ) . A n a l y s i s w i t h t h e r e m a i n - ing s even S T S s was u s e d to d e t e r m i n e t h e S T S c o n t e n t

o f e a c h i so l a t ed Y A C c lone a n d to e s t a b l i s h o v e r l a p s be- t w e e n c lones . T h e s e r e su l t s a re s h o w n in Fig. 2. T w o of t h e c lones ( y C O L 1 - 2 a n d y C O L P F - 1 ) c o n t a i n al l n i n e o f

t h e S T S s . A d d i t i o n a l o v e r l a p s were d e t e c t e d b e t w e e n

y C O L I - 1 a n d y C O L 1 8 - 1 (us ing S T S s for e x o n s 7, 8, a n d 9) a n d b e t w e e n y C O L P F - 2 a n d y C O L 1 8 - 1 (us ing t h e S T S for e x o n s 16 a n d 17). C l o n e y C O L 1 8 - 2 c o n t a i n s on ly e x o n 18 ( r eac t i on 4A5-18) .

F u r t h e r c h a r a c t e r i z a t i o n o f t h e Y A C s to d e t e r m i n e

t h e e x t e n t o f ove r l ap ac ross t h e a5 ( IV) gene was c a r r i e d ou t by h y b r i d i z i n g c D N A p r o b e s to S o u t h e r n b lo t s o f E c o R I - a n d P s t I - d i g e s t e d D N A of e a c h c lone . T h e Y A C s were a s se s sed for a5 ( IV) c D N A c o n t e n t u s ing a p p r o x i - m a t e l y 95% of t h e c o d i n g s e q u e n c e in t h r e e h y b r i d i z a - t ions . H y b r i d i z a t i o n s were p e r f o r m e d us ing (i) t h e c D N A a t t h e 5 ' - t e r m i n u s o f a5 ( IV) (JZ4) , (ii) a poo l o f

636 VETRIE ET AL.

a l p h a - 5 IV l I N r B

. . . . v -J "f "f 3( X X

F S l" ~" S - t

PFIT-3 PFTB

H E 6 P F 7 A I I 1 I I I [ [ I k b

FIG. 1. A long-range restriction map of the a5(IV) collagen gene at Xq22 (Vetrie et al., 1992). The light shaded bar represents a 600-kb segment of genomic DNA. The darkened region shows the maximum extent of the a5(IV) gene based on restriction sites for BssHII (B), M l u I (M), Not I (Nt), NruI (Nr), Sa l I (S), Sf i I (F), and XhoI (X). Sites in square brackets have been detected only in DNA from a 5 X chromosome cell line while all other sites were detected in DNA derived from peripheral blood lymphocytes. The approximate locations of the a5(IV) cDNAs used to construct the map are shown as lightly shaded bars below the genomic map; the lengths of these bars show the region of genomic DNA covered by each partial cDNA clone.

three other 5' cDNAs (PF17-2, PF17-1, and PF17-3), and a pool of three 3' cDNAs (HE6, PF7B, and PF7A). Examples of this analysis are shown in Fig. 3A. The cDNA probe JZ4 cross-hybridized extensively with yeast sequences as shown by the fragment patterns that appear in each lane of Fig. 3Ai. Clone yCOLI-1 did not display any human-specific bands when hybridized with JZ4, demonstrating that this YAC does not contain cDNA sequences from the 5'-end of a5(IV). While the remaining five YACs showed common EcoRI and PstI fragments when hybridized with JZ4, clone yCOLPF-2

4A5-1 (exon 1)

4A5-4 (exon 4)

4A5-5 (exon 5)

, - - C ~ I [ . ~ r~ l I 03 013

0 0 0 0 0 0

I I I I I I

4A5-6 (exon 6)

4A5-7 (exon 7)

4A5-89 (exons 8 I 9)

4A5-10 (exon 10)

4A5- 1617 (exons 16117)

4A5 18 (exon I[~)

676 bp

199 bp

352 bp

133 bp

160 bp

316 bp

158 bp

501 bp

137 bp

FIG. 2. Analysis of the STS content of the a5(IV) YAC clones. The clone names are along the top of the figure; the STSs and sizes of the products are shown at the sides. PCR products were electrophor- esed on 2.5% agarose minigels and visualized by ethidium bromide staining. This figure is a composite of several photographs and small variations in the size of STS products found in different YAC clones are not real.

revealed 1.4-kb EcoRI and 2.1-kb PstI fragments that were not present in any of the other a5(IV) YAC clones (Fig. 3Ai). This would suggest that yCOLPF-2 contains part of the 5'-region of the a5(IV) gene that is absent in the other YACs.

Genomic DNA restriction maps for EcoRI and PstI have previously been determined at the 3'-end of the a5(IV) gene (Zhou et al., 1991b; Boye et al., 1991). There- fore, we were able to use the 3' cDNA pool consisting of HE6, PF7B, and PF7A (which cover the 14 most 3' exons) to detect the relevant EcoRI and PstI fragments in the YACs. Clone yCOLI-1 produced EcoRI fragments of 7.6, 6.3, 2.4, and 1.5 kb and Pst I fragments of 9.8, 5.4, 4.9, and 2.1 kb (Fig. 3Aii). These fragments contain the a5(IV) cDNA sequences for exons I through 9 inclusive. Clone yCOLI-2 showed all of the EcoRI and PstI frag- ments detected in yCOLI-1 and also displayed 5.4-kb EcoRI (exons 12, 13, and 14) and 16-kb Pst I (exons 10- 14) fragments. Taken together with the STS data, we were able to determine that clone yCOL1-2 spans the entire 3'-end of a5(IV) from exon I through to exon 18. Similarly, YAC clone yCOLPF-1 also contains this 3'- portion of the a5(IV) gene. Neither of the clones yCOL18-2 and yCOLPF-2 revealed human-specific EcoRI and PstI fragments with the 3' cDNA pool since they do not contain any of the 14 most 3' exons. Clone yCOL18-1 contains a5(IV) sequences from exon 7 through to exon 18. This clone also showed aberrant EcoRI and PstI fragments of 12 and 6.6 kb, respectively, when hybridized with the 3' cDNA pool. These aberrant fragments must contain exons 7,8, and 9, since the nor- mal fragments containing exons 10-14 are present in this clone. On the basis of these data, yCOL18-1 must have a segment of DNA adjacent to exons 7,8, and 9 that is of unknown origin (i.e., this YAC is chimaeric). Figure 3B summarizes the extent of overlap of the six ~5(IV) YAC clones at the 3'-end of the gene, based on STS con- tent, cDNA content, and EcoRI and PstI restriction pat- terns.

Characterization of Vectorette E n d Probes

Probes derived from insert DNA lying adjacent to the "left" and "right" vector arms were made from the ends

YAC C O N T I G A C R O S S COL4A5 6 3 7

A

(i) JZ4

i I II i I I i I I i I I f kb I li I i 1 i I I i 1 11 l - - 2 3 . 1 ( i i ) 3 ' pool

- - 9.4

- - 6.6

- - 4 . 4

2.3

2.0

L J t J

L _ _ EL i Eeo R1 Pst 1

kb

- - 23.1

- - 9 . 4

- - 6 . 6

- - 4 . 4

- - 2 . 3

- - 2 . 0

B

• _ _ V P I I I F I I 7~ i i l I II ~ "IP" yCOLPF-1

• I II I II I I I

E E E • I i i y C O L P F - 2 • I I I

E E y C O L 1 8 - 2

E E E EPX E E E E EP • i i i _ _ 7SI I I 1 I I i • I I I I

P E . . . . . . . . . . J . . . . . . . . I . . . . . . . . . . . . . . . . . . . . . . IL. _ p ~ H o ,

II I V y~vwu 1

E E E EPX | | I - - 7 ( I I I

• I I I i l I i I II I I~I I 11 1 I I I ~I~ y C O L 1 - 2

EP XE E P E XP EPE P__

i . . . . . . . . . . . . . . . . . . . . . . i i I! ! 7(I I I I i i l l ~ ~ y C O L l - 1

approx. [ 40 kb ]

E E E E PX E E E E E E P XE EPEE XP EPE P

I / k I ) 2 k k [ ) k l I I L ) k I

18 17 16 15 14 13 12 11 10 9 87 6 5 4 3 2 1

35 30 25 20 15 tO 5 0

I I I I ~ / I I I kilobases

g e n o r a i c

F I G . 3. (A) Au to rad iog raphs showing hybr id iza t ion of a5(IV) c D N A s to S o u t h e r n blots o f EcoRI- a n d PstI-digested YAC clones a n d y e a s t / p Y A C 4 control . (i) T h e hybr id iza t ion p a t t e r n s de tec ted wi th t he c D N A JZ4. T h e resu l t s shown in (ii) were de tec ted by t h e c D N A s HE6, PF7B, a n d P F 7 A (3' pool). T h e 5.6-kb EcoRI a n d 1.6-kb PstI f r a g m e n t s found in all t h e l anes of (ii) are der ived f rom the " lef t" a r m of t h e pYAC4 vector. Size m a r k e r s are HindIII digests of bac te r iophage X. (B) YAC clones a t the 3 ' -end of t he a5(IV) gene. T h e genomic m a p is sh o wn as t he l ight shaded bar across t he b o t t o m of t he figure. T h e pos i t ions of t he 18 m o s t 3' exons (numbered f rom the 3 ' -end of the gene) are sh o wn as vert ical ba r s on the genomic map. T h e genomic res t r ic t ion s i tes for EcoRI (E), PstI (P), and XhoI (X) are also shown. T h e YAC clones are r ep resen ted by t he hor izonta l line. a5(IV) D N A in each YAC is deno ted by solid lines; D N A of u n k n o w n origin is shown as do t ted l ines. Ar rowheads show t h a t a YAC ex t ends beyond t he region i l lus t ra ted in t he figure. T h e " lef t" a n d " r igh t " vector a r m s a t the ends of YACs are shown as gray and b lack rectangles , respectively. T h e EcoRI, PstI, a n d XhoI f r a g m e n t s de tec ted by a5(IV) coding sequence are s h o w n on t h e YACs. T h e downward vert ical ba r s on each YAC are t he S T S s descr ibed in Fig. 2.

638 VETRIE ET AL.

5.5 kb--

3.2 kb--

4.0 kb--

9.0 kb--

3.8 kb--

23 kb--

< >-

+

0 0 0 0 0 0

I vCOLI-IL

I vCOL1 1R

vCOL18-1L

I vCOL18-1R

I vCOL18-2R

FIG. 4. Autoradiograms showing hybridization of vectorette end probes to Southern blots of PstI-digested a5(IV) YAC clones. The vectorette probes used in each hybridization are shown at the right of each panel. Fragments were sized using k HindIII digests as size markers.

of YAC clones yCOLI-1, yCOL18-1, and yCOL18-2 us- ing a modified vectorette system as described under Ma- terials and Methods. A total of five end probes were iso- lated from the three clones analyzed. Figure 4 shows the results of hybridization of the vectorette end probes to Southern blots of PstI-digested DNA from all six YACs in the a5(IV) contig. The "left" end probe of YAC clone yCOLI-1 (vCOLI-IL) detected a 3.2-kb fragment in the lane containing yCOLI-1 DNA and also detected a 5.5- kb fragment in DNA from YAC clone yCOLPF-1. The "right" end probe from clone yCOL18-2 (vCOL18-2R) hybridized to 2.3-kb fragments in lanes containing DNA from yCOL18-2 and from clone yCOLPF-2. These data confirmed that the end probes vCOLI-IL and vCOL18- 2R originate from the a5(IV) locus. However, the "right" vectorette end of YAC clone yCOLI-1 (vCOL1- 1R) detected a fragment (4.0 kb) only in DNA from yCOLI-1 when used as a hybridization probe (Fig. 4). This suggests that vCOL1-1R originates from DNA that is not from the a5(IV) locus and that YAC clone yCOL1- 1 is chimaeric. The restriction map (Fig. 6) and cDNA content of yCOLI-1 suggest that approximately 15 kb of the clone is not from the a5(IV) locus. End probes from

YAC clone yCOL18-1 detected 9.0-kb (for vCOL18-1L) and 3.8-kb (for vCOL18-1R) PstI fragments in yCOL18- 1 DNA only (Fig. 4). Based on the extent of yCOL18-1, as well as its rare-cutter restriction map (Fig. 6), this chimaeric YAC clone yCOL18-1 contains a central por- tion of a5(IV) DNA and has segments of DNA of un- known origin at either end.

Refinement of a5(IV) Gene Structure and the Genomic Map

PFGE analysis was performed by hybridizing the a5(IV) cDNAs, YAC end probes, and vector probes to Southern blots containing YAC DNA digested with BssHII, MluI, NotI, NruI, SalI, SfiI, and XhoI. This analysis allowed the YACs to be positioned relative to the long-range restriction map of the a5(IV) locus. The restriction maps that show the rare-cutting sites found in all six a5(IV) YACs are summarized in the contig map of Fig. 6. On the basis of this PFGE information, we determined the overall extent of the YAC contig and also make the following refinements to the genomic map and gene structure of ~5(IV):

The cDNA probe PF17-3 contains coding sequences that lie on either side ofa SalI site and an SfiI site within the a5(IV) gene (Fig. 1). Clone yCOL18-2 contains this Sfi I site, as evidenced by the 8-kb Sfi I fragment detected by PF17-3 (Fig. 5A). The 20-kb SfiI product detected by PF17-3 in genomic DNA is also found in this clone (Fig. 5A). However, hybridization of PF17-3 to a SalI digest of yCOL18-2 showed that this rare-cutter failed to cleave the insert of this clone (Fig. 5A). Therefore, the SfiI site in question must lie 5' (with respect to the 5-3' orientation of the a5(IV) gene) to the SalI site in geno- mic DNA. Furthermore, since yCOL18-2 contains exon 18 (Fig. 2), this exon must also lie 5' of the SalI site. Given that this SalI site lies approximately 80 kb from exon 1, the genomic distance from the 3'-end of the a5(IV) gene to exon 18 is at least 80 kb. The distance between exons 1 and 18 had previously been estimated at approximately 40 kb, although the actual sizes of introns 14 and 15 were unknown (Zhou et al., 1991a). The data shown here suggest that these introns cover approxi- mately 40 kb of genomic DNA (Fig. 3B).

The clone yCOLPF-2 extends into the 5'-region of the gene. Digestion of yCOLPF-2 with MluI and subsequent hybridization with PF17-1 revealed a 260-kb fragment (Fig. 5B). The rare-cutters BssHII, NotI, and NruI did not cleave within this clone (Fig. 5B) as expected from the genomic map. The clone yCOLPF-2 also contains the 240-kb SalI and 185-kb SfiI fragments that lie across the 5'-half of the a5(IV) gene, as detected by the vectorette end probe vCOL18-2R (Fig. 5C). Hybridiza- tion with vCOL18-2R also detected an additional XhoI site in clone yCOLPF-2 (resulting in a 50-kb fragment) not previously found in genomic DNA. These data al- lowed the clone yCOLPF-2 to be positioned across the cluster of rare-cutter sites (a CpG island) for MluI, SalI, SfiI, and XhoI that defines the maximum extent of the 5'-end of the ~5(IV) gene. Therefore yCOLPF-2 con-

YAC CONTIG ACROSS COL4A5 639

A

146 - -

97--

4 9 - -

23--

9 - -

~9

©

53

I

-- 20 k b

- - S k b

C

D u undigested BssH II

] I I I

0 0 0 0 U U U U

I I I I

437 --

3 8 8 - -

340 - -

291 - -

243 - -

195 - -

146

97 --

Sal I I n ¢~1

I I

5 ~ 0 0

I t

Sfi I Xho 1

I I I I

~ 5 ~ 5 0 0 0 0

I I I I

Mlu I Not I

I [ I I

0 0 0 0 r) ~D U U

L [ I I

Nru l

[ I

0 0

F I

243 - -

195 - -

146 - -

9 7 - -

4 9 - -

F I G . 5 . Au to rad iog raphs showing hybr id iza t ion of a5(IV) probes to S o u t h e r n blots of YAC clones diges ted wi th var ious r a re -cu t t ing res t r ic t ion enzymes . (A) Clone yCOL18-2 d iges ted wi th SfiI and SalI a n d hybr id ized wi th t he c D N A PF17-3. (B) BssHII, MluI, NotI, a n d NruI digests of c lones y C O L P F - 1 a n d y C O L P F - 2 hybr id ized wi th the c D N A PF17-1. (C) SalI, SfiI, and XhoI digests of c lones y C O L P F - 1 a n d y C O L P F - 2 hybr id ized wi th t he vec tore t te end probe vCOL18-2R (Note: vCOL18-2R does no t de tec t f r a g m e n t s in yCOLPF-1 ) . P F G E condi- t ions were 8°C, 200 V for 24 h wi th pu l se t imes of 10 s [in (A)], 25 s [in (B)], or 15 s [in (C)]. Size ma rke r s were conca t emer s of bac te r iophage k a n d X HindIII digests .

ta ins the ent i re 5'-half of the a5(IV) gene. Since yCOLPF-2 contains a5(IV) cDNA sequences not pres- ent in any of the o ther YACs of the contig (see Fig. 3Ai) there mus t be a5(IV) coding regions tha t are located at least 240 kb away f rom the 3'-end of a5(IV) (see Fig. 6). Thus , the a5(IV) gene can now be es t imated to cover be tween 240 and 320 kb of DNA.

Clone yCOLPF-1 extends from within the 5'-half of a5(IV) to beyond the 3'-end of the gene (Fig. 6). Hybrid- izat ion of the cDNA PF17-1 to Sou the rn blots contain- ing BssHII, NotI, and NruI digests of yCOLPF-1 re- vealed 240-kb f ragments for all three enzymes (Fig. 5B). Therefore , this YAC clone crosses the CpG island con- ta ining sites for BssHII, NotI, NruI, SalI, and XhoI t ha t

is located 40 kb downst ream of the 3'-end of a5(IV). An addit ional ra re-cut te r site for BssHII, which resul ted in a 210-kb product , was detec ted in clone yCOLPF-1 by PF17-1 (Fig. 5B). This site was also found in clones yCOLI-1 and yCOL1-2 (Fig. 6) bu t is not detec ted in genomic DNA. As expected f rom the genomic map, MluI does not cleave yCOLPF-1 (Fig. 5B). Based on the posi- t ion of these and o ther known genomic restr ic t ion sites on clone yCOLPF-1 , this YAC contains at least 150 kb of DNA tha t lies 3' to the ~5(IV) gene.

DISCUSSION

By analyzing STSs, cDNA content , and rare-cut t ing restr ic t ion sites, we cons t ruc ted a YAC contig across the

640 VETRIE ET AL.

XM M [] r] iIi

F S

X X X X XX B' XBNr X

• q I ~ F'F~'J'~ I,~S I r l P s~t~l~ 1

X' X X X I I r i ) r \ 1~ . ~ yCOLPF-2 (385 kb)

X X X

, ¢, x I /N yCOLlO-2 (145 kb) F FFF F

X M X X X X X Nr B

~_LIJ_ . . . . . ~ ~ FI FFF/I' II\FS I L--~r---L-L--- ~ F s yC01.18-, (320 kb)

vCMI 8- IR vCo]I #- lL X X X X X B* XBNr

[31 # , , ' , I I I I I ~1( [ ] yCOL1-2(260kb) FF F FS SNt

X X B" XBNr X

I F - I I I 9( I IN yCOLt-] (140 kb) SNt

vCoH-117 vCoII-IL

M X X X X X XX XBNr X X

X

F [ ] yco~F-1 (42o kb)

~ vCoII-IL

JZ4 FF17-1 ~

PF17-3 PFTB

PF17-2 IIIIIIIIIIIIIIIIIIIIH M N HIgIIHIHli

lIE6 PF7A

I ~iph.-5 Jv ] 0 100 I I I I I P I I I I I kb

FIG. 6. A yeast artificial chromosome contig across the a5(IV) collagen gene. The long-range restriction map of the a5(IV) locus is shown as the thick bar at the bottom of the figure. Genomic restriction sites are denoted as in Fig. 1. Restriction sites found only in YAC clones are denoted by the asterisk (*). The locations of the a5(IV) cDNAs (gray bars) and the vectorette end probes vCOL18-2R and vCOLI-IL are shown on the genomic map; the length of the gray bars shows the amount of genomic DNA covered by each partial cDNA clone. The YAC clones are shown above the genomic map. DNA segments of unknown origin in clones yCOLI-1 and yCOL18-1 are shown as dashed lines. The "left" and "right" vector arms are shown as gray and black boxes, respectively. The orientation of clone yCOL1-2 has not been determined and its vector ends are shown as unshaded boxes. Vectorette ends probes from the clones yCOLI-1, yCOL18-1, and yCOL18-2 are shown on the YACS from which they were derived; end probes vCOLI-IL and vCOL18-2R are also shown on YAC clones yCOLPF-1 and yCOLPF-2, respectively.

h u m a n gene tha t encodes the a5 chain of type IV colla- gen (COL4A5). This gene is involved in the X-l inked kidney disorder AS. Six YAC clones were isolated from two YAC libraries using a PCR-based screening ap- proach. A min imum of two YAC clones (yCOLPF-1 and yCOLPF-2) represent the entire a5(IV) gene. On the basis of the posit ion of known rare-cut t ing restriction sites on these clones, the contig also contains 150 kb of D N A tha t lies 3' to a5(IV). The size of clone y C O L P F - 2 also suggests tha t approximately 120 kb of D N A lying 5' to a5(IV) could be present in the contig (al though we could not confirm this f rom the YAC restriction map of y C O L P F - 2 since there is no genomic mapping data from this region). At its max imum extent, the contig may span 690 kb around this locus, provided tha t nei ther clone y C O L P F - 1 nor clone y C O L P F - 2 is chimeric.

At least two of the YACs tha t lie within our contig (yCOLI-1 and yCOL18-1) are chimeric. YAC clone yCOL18-1 appears to contain three segments of DNA, with the central por t ion conta in ing a5(IV) sequences. The junct ion between a5(IV) D N A and unknown D N A sequences in the vicinity of exon 7 does not occur at an E c o R I restr ict ion site in clone yCOL18-1, as demon- s t rated by the aber rant E c o R I restriction site in clone yCOL18-1, as demons t ra ted by the aberrant E c o R I de- tected by the cDNAs at the 3'-end of a5(IV). This would suggest tha t the chimerism at this end of the clone was

not a result of coligation in vitro. I t has previously been reported tha t chimeric YACs may result from Alu-re- combinat ion between cloned D N A segments in vivo after t ransformat ion into the yeast cell (Green et al., 1991). The 140-kb clone y C O L I - 1 has approximately 15 kb of D N A tha t is derived from elsewhere in the genome. While we were able to detect this chimeric clone by ana- lyzing well-defined landmarks in the vicinity of the chi- meric junction, such small regions of unknown D N A may be undetectable in large YACs where known land- mark posit ions cannot be accurately posi t ioned on clones. In these instances, using end probes from these clones for chromosome "walking" may prove to be prob- lematic.

On the basis of the locations of the six YAC clones in the contig described in this study, we have established tha t the ~5(IV) collagen gene is at least 240 kb in size and is no larger t han 320 kb. This is the largest human collagen gene characterized to date. The a l ( IV) and ~2(IV) collagen genes (COL4A1 and COL4A2) tha t map to chromosome 13q34 have previously been sized at 100- 200 kb and 100-160 kb, respectively (Cutt ing et al., 1988; Soininen et al., 1989). In the case of ~I(IV), its size is reflected in an unequal distr ibution of exons, with the large introns 1, 2, 17, and 49 (numbered from the 5'-end of the gene) account ing for a large propor t ion of its geno- mic D N A content . Analysis of gene s tructure at the 3'-

YAC CONTIG ACROSS COL4A5 641

end of a5(IV) (Zhou et al., 1991a) has also shown that exons tend to be clustered in the 80 kb of DNA consti- tuting the 3'-half of the a5 (IV) cDNA sequence. Further- more introns 14 and/or 15 (as numbered from the 3'-end) appear to be large, encompassing a total of 40 kb (as shown in this study). Large introns at the 5'-end of a5(IV) may also contribute to the overall size of the gene, as demonstrated by the amount of genomic DNA (at least 160 kb) covered by the 5'-half of the a5(IV) cDNA. This observation is consistent with the large in- trons found at the 5'-end of al(IV). It is noteworthy that the large introns in al(IV) were of sufficient size to pre- vent closure of a ~ clone contig across this gene (Soin- inen et al., 1989). Similarily, the introns lying between exons 14/15 and 15/16 of a5(IV) had not previously been isolated in cloned DNA (Zhou et al., 1991a). The YAC clones we have described here span the large introns found at both the 3' and the 5' ends of the a5(IV) gene.

It has been postulated that a5(IV) and an, as yet, un- identified a6(IV) gene may be located as a pair in Xq22 (Gregory et al., 1990; Zhou et al., 1991a,b; see Vetrie et al., 1992b). This type of arrangement has been found for both the al(IV) and the a2(IV) genes (Poschl et al., 1988; Soininen et al., 1988) and the a3(IV) and the a4(IV) genes localized to 2q35-q37 (Mariyama et al., 1992). The YAC contig we have described here contains DNA flanking the 3'-end of a5(IV) and may also prove to include sequences flanking the 5'-end of the gene. This cloned material, therefore, will provide a means with which to investigate the presence of other type IV colla- gen coding sequences in the vicinity of a5(IV). Whether an a6(IV) chain is involved in Alport syndrome awaits the isolation of the novel cDNA and subsequent screen- ing of AS pedigrees. We are currently using YACs from the a5(IV) contig as a starting point to search for such novel genes.

A C K N O W L E D G M E N T S

The authors thank Drs. Taina Pihlajaniemi, Jing Zhou, and Karl Tryggvason (Oulu, Finland) and Dr. Jeanne Myers (Philadelphia, PA) for the cDNA probes used in this study; Dr. David Bentley (Guy's Hospital, London), Dr. Maynard Olson (Washington University, St. Louis), Dr. Hans Lehrach (ICRF, London), and Dr. Anthony Monaco (IMM, Oxford) for providing access to the YAC libraries; Dr. Chris Todd, John Collins, and Sheila Hassock (Guy's) for supplying PCR DNA pools and the gridded YAC filters; and Alison J. Coffey (Guy's) for help with vectorette PCR. This work was supported by the Genera- tion Trust, the Spastics Society, and the British Council. D.V. is a United Kingdom Commonwealth Scholar.

R E F E R E N C E S

Anand, R., Ogilvie, D. J., Butler, R., Riley, J. H., Finniear, R. S., Pow- ell, S. J., Smith, J. C., and Markham, A. F. (1991). A yeast artificial chromosome contig eneompassing the cystic fibrosis locus. Geno- mics 9: 124-130.

Anand, R., Villasante, A., and Tyler-Smith, C. (1989). Construction of yeast artificial chromosome libraries with large inserts using frac- tionation by pulsed-field gel eleetrophoresis. Nucleic Acids Res. 17: 3425-3433.

Barker, D. F., Hostikka, S. L., Zhou, J., Chow, L. T., Oliphant, A. R.,

Gerken, S. C., Gregory, M. C., Skolnick, M. H., Atkin, C. L., and Tryggvason, K. (1990). Identification of mutations in the COL4A5 collagen gene in Alport syndrome. Science 248: 1224-1227.

Bentley, D. R., Todd, C., Collins, J., Holland, J., Dunham, I., Hassock, S., Bankier, A., and Giannelli, F. {1992). The development and ap- plication of automated gridding for efficient screening of yeast and bacterial ordered libraries. Genomics 12: 534-541.

Boye, E., Vetrie, D., Flinter, F., Buckle, B., Pihlajaniemi, T., Myers, J. C., Bobrow, M., and Harris, A. (1991). Major rearrangements in the a5(IV) collagen gene in three patients with Alport syndrome. Genomics 11: 1125-1132.

Brownstein, B. H., Silverman, G. A., Little, R. D., Burke, D. T., Kors- meyer, S. J., Schlessinger, D., and Olson, M. V. {1989). Isolation of single-copy human genes from a library of yeast artificial chromo- some clones. Science 244: 1348-1351.

Burke, D. T., Carle, G. F., and Olsen, M. V. (1987). Cloning of large segments of exogenous DNA into yeast by means of artificial chro- mosome vectors. Science 236: 806-812.

Coffey, A. J., Roberts, R. G., Green, E. D., Cole, C. G., Butler, R., Anand, R., Gianelli, F., and Bentley, D. (1992). Construction of a 2.6-Mb contig in yeast artificial chromosomes spanning the human dystrophin gene using an STS-based approach. Genomics 12: 474- 484.

Cutting, G. R., Kazazian, H. H., Antonarakis, S. E., Killen, P. D., Yamada, Y., and Francomano, C. A. (1988). Macrorestriction map- ping of COL4A1 and COL4A2 collagen genes on human chromo- some 13q34. Genomics 3: 256-263.

Feinberg, A. P., and Vogelstein, B. (1983). A technique for radiolabel- ling DNA restriction endonuclease fragments to a high specific ac- tivity. Anal. Biochem. 132: 6-13.

Flinter, F. A., Cameron, J. S., Chantler, C., Houston, I., and Bobrow, M. (1988). Genetics of classic Alport's syndrome. Lancet 2: 1005- 1007.

Flinter, F. A., and Chantler, C. (1990). The inheritance of Alport's syndrome. In "Inheritance of Kidney and Urinary Tract Diseases" (A. Spitzer and E. Avner, Eds.), pp. 107-120, Kluwer Academic Publishers, Boston.

Gaensler, K. M. L., Burmeister, M., Brownstein, B. H., Taillon- Miller, P., and Myers, R. M. (1991). Physical mapping of yeast arti- ficial chromosomes containing sequences from the human ~-globin gene region. Genomics 10: 976-984.

Green, E. D., and Olson, M. V. (1990a). Chromosomal region of the cystic fibrosis gene in yeast artificial chromosomes: A model for human genome mapping. Science 245: 1434-1435.

Green, E. D., and Olson, M. V. (1990b). Systematic screening of yeast artificial-chromosome libraries using the polymerase chain reac- tion. Proc. Natl. Acad. Sci. USA 87: 1213-1217.

Green, E. D., Riethman, H. C., Dutchik, J. E., and Olson, M. V. {1991). Detection and characterization of chimeric yeast artificial-chromo- some clones. Genomics 11: 658-669.

Gregory, M., Atkin, C., Goldgar, D., Barker, D., and Skolnick, M. (1990). Allelism of Alport syndrome (AS) Types III and IV. Kidney Int. 37: 248.

Hostikka, S. L., Eddy, R. L., Byers, M. G., Hoyhtya, M., Shows, T. B., and Tryggvason, K. (1990). Identification of a distinct type IV colla- gen a-chain with restricted kidney distribution and assignment of its gene to the locus of X-linked Alport syndrome. Proc. Natl. Acad. Sci. USA 87: 1606-1610.

Huxley, C., Green, E. D., and Dunham, I. (1990). Rapid assessment of S. cerevisiae mating type by PCR. Trends Genet. 6: 236.

Larin, Z., Monaco, A. P., and Lehrach, H. (1991). Yeast artificial chro- mosome libraries containing large inserts from mouse and human DNA. Proc. Natl. Acad. Sc£ USA 88: 4123-4127.

Mariyama, M., Zheng, K., Yang-Feng, T. L., and Reeders, S. T. (1992). Colocalization of the genes for the a3(IV) and a4(IV) chains of type IV collagen to chromosome 2 bands q35-37. Genomics 13: 809-813.

642 VETRIE ET AL.

Monaco, A. P., Walker, A. P., Millwood, I., Larin, Z., and Lehrach, H. {1992). A yeast artificial chromosome contig containing the com- plete Duchenne muscular dystrophy gene. Genomics 12: 465-473.

Myers, J. C., Jones, T. A., Pohjolainen, E. R., Kadri, A. S., Goddard, A. D., Sheer, D., Solomon, E., and Pihlajaniemi, T. (1990). Molecu- lar cloning of a5(IV) collagen and assignment of the gene to the region of the X chromosome containing the Alport syndrome locus. Am. J. Hum. Genet. 46: 1024-1033.

Palmieri, G., Capra, V., Romano, G., D'Urso, M., Johnson, S., Schles- singer, D., Morris, P., Hopwood, J., DiNatale, D., Gatti, R., and Ballabio, A. (1992). The iduronate sulfatase gene: Isolation of a 1.2- Mb YAC contig spanning the entire gene and identification of heter- ogeneous deletions in patients with Hunter syndrome. Genomics 12: 52-57.

Pihlajaniemi, T., Pohjolainen, E. R., and Myers, J. C. (1990). Com- plete primary structure of the triple-helical region and the carboxyl- terminal domain of a new type IV collagen chain, a5(IV). J. Biol. Chem. 265: 13,758-13,776.

Poschl, E., Pollner, R., and Kuhn, K. (1988). The genes for the al(IV) and a2(IV) chains of human basement membrane collagen type IV are arranged head-to-head and separated by a bidirectional pro- moter of unique structure. EMBO J. 7: 2687-2695.

Riley, J., Butler, R., Ogilvie, D., Finniear, R., Jenner, D., Powell, S., Anand, R., Smith, J. C., and Markham, A. F. (1990). A novel, rapid method for the isolation of terminal sequences from yeast artificial chromosome (YAC) clones. Nucleic Acids Res. 18: 2887-2890.

Sealey, P. G., Whittaker, P. A., and Southern, E. M. (1985). Removal

of repeated sequences from hybridisation probes. Nucleic Acids Res. 13: 1905-1922.

Soininen, R., Huotari, M., Ganguly, A., Prockop, D. J., and Tryggva- son, K. (1989). Structural organization of the gene for the a-1 chain of human type IV collagen. J. Biol. Chem. 264: 13,565-13,571.

Soininen, R., Huotari, M., Hostikka, S. L., Prockop, D. J., and Trygg- vason, K. (1988). The structural genes for a l and a2 chains of hu- man type IV collagen are divergently encoded on opposite DNA strands and have an overlapping promoter region. J. Biol. Chem. 263: 17,217-17,220.

Southern, E. M. (1975). Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98: 503- 517.

Vetrie, D., Flinter, F., Bobrow, M., and Harris, A. (1992a). Long-range mapping of the gene for the human a5(IV) collagen chain at Xq22- q23. Genomics 12: 130-138.

Vetrie, D., Boye, E., Flinter, F., Bobrow, M., and Harris, A. (1992b). DNA rearrangements in the a5(IV) collagen gene (COL4A5) of indi- viduals with Alport syndrome: Further refinement using pulsed- field gel electrophoresis. Genomics 14.

Zhou, J., Barker, D. F., Hostikka, S. L., Gregory, M. C., Atkin, C. L., and Tryggvason, K. (1991a). Single base mutation in a5(IV) colla- gen chain gene converting a conserved cysteine to serine in Alport syndrome. Genomics 9: 10-18.

Zhou, J., Hostikka, S. L., Chow, L. T., and Tryggvason, K. (1991b). Characterization of the 3' half of the human type IV collagen a5 gene that is affected in the Alport syndrome. Genomics 9: 1-9.