Biochimica et Biophysica Acta 1843 (2014) 2122–2128

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r .com/ locate /bbamcr

Heparanase is a key player in renal fibrosis by regulating TGF-βexpression and activity

Valentina Masola a,b, Gianluigi Zaza a, Maria Francesca Secchi b, Giovanni Gambaro c,Antonio Lupo a, Maurizio Onisto b,⁎a Renal Unit, Department of Medicine, University-Hospital of Verona, Italyb Department of Biomedical Sciences, University of Padova, Italyc Division of Nephrology and Dialysis, Columbus-Gemelli Hospital, Catholic University, School of Medicine, Rome, Italy

Abbreviations: AGE, advanced glycosylation and prmuscle actin; EMT, epithelial–mesenchymal transition; FNMMPs, matrix metalloproteinase; TGF-β, transforming gro⁎ Corresponding author at: Department of Biomedical

Viale G. Colombo, 3, I-35121-Padova, Italy. Tel.: +39 049E-mail addresses: valentina.masola@unipd.it (V. Maso

(G. Zaza), mfrancesca.secchi@libero.it (M.F. Secchi), giova(G. Gambaro), antonio.lupo@univr.it (A. Lupo), maurizio.o

http://dx.doi.org/10.1016/j.bbamcr.2014.06.0050167-4889/© 2014 Elsevier B.V. All rights reserved.

a b s t r a c t

a r t i c l e i n f o

Article history:Received 18 February 2014Received in revised form 14 May 2014Accepted 9 June 2014Available online 15 June 2014

Keywords:Epithelial–mesenchymal transitionHeparanaseRenal fibrosisTGF-β

Epithelial–mesenchymal transition (EMT) of tubular cells is one of themechanisms which contribute to renal fi-brosis and transforming growth factor-β (TGF-β) is one of themain triggers. Heparanase (HPSE) is an endo-β-D-glucuronidase that cleaves heparan-sulfate thus regulating the bioavailability of growth factors (FGF-2, TGF-β).HPSE controls FGF-2-induced EMT in tubular cells and is necessary for the development of diabetic nephropathyin mice.The aim of this study was to investigate whether HPSE can modulate the expression and the effects of TGF-β intubular cells.First we proved that the lack of HPSE or its inhibition prevents the increased synthesis of TGF-β by tubular cells inresponse to pro-fibrotic stimuli such as FGF-2, advanced glycosylation end products (AGE) and albumin overload.Second, since TGF-βmay derive from sources different from tubular cells, we investigated whether HPSEmodu-lates tubular cell response to exogenous TGF-β. HPSE does not prevent EMT induced by TGF-β although it slowsits onset; indeed in HPSE-silenced cells the acquisition of a mesenchymal phenotype does not develop as quicklyas inwt cells. Additionally, TGF-β induces an autocrine loop to sustain its signal, whereas the lack of HPSE partial-ly interferes with this autocrine loop.Overall these data confirm that HPSE is a key player in renal fibrosis since it interacts with the regulation and theeffects of TGF-β. HPSE is needed for pathological TGF-β overexpression in response to pro-fibrotic factors. Fur-thermore, HPSEmodulates TGF-β-induced EMT: the lack of HPSE delays tubular cell transdifferentiation, and im-pairs the TGF-β autocrine loop.

© 2014 Elsevier B.V. All rights reserved.

1. Introduction

Multiple-drug therapy has led, over the years, to a significantslowing of chronic kidney disease progression towards end-stagerenal disease, but we are still far from the development of therapeuticinterventions able to stop this process. Clinical-pathological studieshave clearly shown that fibrosis is the common, final event of a broadrange of kidney diseases whatever their etiology. In the progression to-ward end-stage renal disease (ESRD), the majority of pathogenic

oducts; α-SMA, alpha-smooth,fibronectin; HPSE, heparanase;wth factor-β; VIM, vimentinSciences, University of Padova,8276093.la), gianluigi.zaza@univr.itnni.gambaro@rm.unicatt.itnisto@unipd.it (M. Onisto).

mechanisms underlying renal fibrosis arise in the tubular compartment[1]. Actually, several chronic kidney diseases are characterized by pro-gressive tubule-interstitial fibrosis as evidenced by accumulation of fi-broblasts and increase of interstitial matrix [2]. This leads to organfailure and thus dialysis or organ transplantation is required [1]Among the causes of chronic renal failure, diabetic nephropathy is oneof the most common in developed countries [3]. Damage to the renaltissues caused by diabetes is due to the high concentration of glucose,the products of advanced glycation and proteinuria.

A key role in tubulo-interstitial fibrosis is the tubular epithelial-to-mesenchymal transition (EMT), or transdifferentiation of tubular epi-thelial cells into myofibroblasts, [4] which are the cells responsible forthe secretion and accumulation of extracellular matrix components:collagens, fibronectin (FN) and laminin [5].

The EMT implies the loss of epithelialmarkers, such as epithelial (E)-cadherin and zona occludence-1, and the expression of proteins and bi-ological features associated with a mesenchymal phenotype. Epithelialcells in transition become mobile, and vimentin (VIM) and alpha-smoothmuscle actin (α-SMA) are up-regulated. Following cytoskeleton

2123V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

remodeling, release of matrix metalloproteinases (MMPs) and tubularbasement membrane disruption, cells with an acquired myofibroblastsprofile develop the ability to migrate into the interstitium [6].

In chronic kidney disease, different stresses such as proteinuria, highglucose, advanced glycosylation end products (AGE) or hypoxia inducetubular epithelial cells to release cytokines and chemokines. These mol-ecules recruit macrophages and circulating lymphocytes which triggeran immune response and the release of others mediators such astransforming growth factor-β (TGF-β), epidermal growth factor and fi-broblast growth factor-2 (FGF-2) [7]. All these growth factors elicit EMTin tubular cells [8–10]. In diabetic nephropathy (DN), glycated (AGE)and naïve proteins filtered through damaged glomeruli are also ableto induce EMT of proximal tubular cells [11,12].

HPSE is an endo-β-D-glucuronidase that cleaves the beta-(1,4)-gly-cosidic bond between glucuronic acid and glucosamine residues in hep-aran sulfate (HS) chains; it is expressed by several cell types and tissueswhere it participates in ECM remodeling and degradation, and in theregulation of the release of HS-bonded molecules from ECM storages,such as growth factors, chemokines, cytokines, and enzymes involvedin inflammation, wound healing and tumor invasion [13]. Evidencefrom previous literature supports the hypothesis that HPSE, which isoverexpressed by glomerular and tubular cells in diabetes, is involvedin the pathogenesis of renal proteinuric disorders [14,15].

In tubular cells, HPSE is a target gene of the DN mediators, albuminand advanced glycation end-product (AGE)[16] and experimental find-ings show that a relationship exists betweenHPSE and FGF-2 [15–18]. Inparticular, we have previously demonstrated that HPSE regulatessyndecan-1, a transmembrane HS proteoglycan that controls FGF-2 sig-naling [19]. Moreover, we have provided evidence that HPSE is specifi-cally involved in the establishment of tubular fibrosis being necessaryfor the FGF-2 induced EMT of tubular cells [20]. Furthermore, FGF-2 in-duces an HPSE-dependent autocrine loop to sustain its signal [20],which is inhibited by heparins [21]. Interestingly, heparins favorably af-fect the development and progression of DN [22] and are efficient HPSEinhibitors [23].

That HPSE plays a crucial role in the pathogenesis of DN is highlight-ed by the importance of HPSE in the development of DN in astreptozotocin-induced diabetes model, where the HPSE gene-KO pro-tects mice from developing DN. In particular, HPSE-KOmice did not de-velop proteinuria, mesangial matrix expansion, and tubulo-interstitialfibrosis. Confirming such a role, the inhibition of HPSE in wt mice by aspecific inhibitor resulted in decrease of proteinuria [24]. Notably, in di-abetic HPSE-KO-mice renal TGF-β, the most pro-fibrotic growth factorin the kidneywhich is considered to play a pivotal role in the pathogen-esis of DN did not increase at odds with naïve diabetic animals.

In view of the role of EMT in tubular cells and TGF-β in the progres-sive accumulation of extracellular matrix in renal fibrosis, and the criti-cal role of HPSE in EMT [20] and TGF-β expression [24] we haveinvestigated whether TGF-β, similarly to FGF-2 [20] has a role in theHPSE-mediated control of EMT.

2. Methods

2.1. Cell cultures and treatments

Two different cell lines were used: 1) HK2 (human kidney 2), ahuman renal proximal tubular cell line; and 2) a stably HPSE-silencedHK2 cell line obtained by transfection with shRNA plasmid targetinghuman HPSE as recently described elsewhere [19].

Both cell lines were grown in DMEM-F12 (EuroClone) (17.5 mMglucose) supplemented with 10% fetal bovine serum (BiochromAG), 2 mM L-glutamine, penicillin (100 U/ml) and streptomycin(100 μg/ml). Cells were cultured at 37 °C in a 5% CO2 water-saturated atmosphere to subconfluence and starved for 24 h in aserum-free medium. Thereafter they were cultured for a further 6,24 or 48 h in a serum-free medium in the presence of 20 ng/ml

TGF-β1 (BD Bioscience), or 100 μg/ml BSA (Sigma), or 100 μg/ml ofglycated albumin (AGE) (obtained as described [19]), or 10 ng/ml FGF-2(BD Bioscience) or 50 μg/ml low molecular weight heparin (LMWH).

2.2. Gene expression analysis

Total RNA was extracted from the cell monolayer using the “Trizol”reagent (Invitrogen), in compliance with the manufacturer's instruc-tions. Yield and purity were checked using the Nanodrop (EuroClone)and total RNA from each sample was reverse transcribed into cDNAusing SuperScript II Reverse Transcriptase (Invitrogen). Real-time PCRwas performed on an ABI-Prism 7500 using Power SYBR Green MasterMix 2X (Applied Biosystems). To quantify gene expression the compar-ative Ct method (ΔΔ Ct) was used and the relative quantification (RQ)was calculated as 2−ΔΔCt. The presence of non-specific amplificationproducts was excluded by melting curve analysis. A quantitative analy-sis was performed to evaluate expression of α-SMA, FN, VIM, MMP-9,and HPSE and normalized to GAPDH. The forward and reverse primersequences were: α-SMA: f-GAAGAAGAGGACAGCACTG, r-TCCCATTCCCACCATCAC; FN: f-GTGTGTTGGGAATGGTCGTG, r-GACGCTTGTGGAATGTGTCG; VIM: f-AAAACACCCTGCAATCTTTCAGA, r-CACTTTGCGTTCAAGGTCAAGAC; MMP-9: f-CCTGGAGACCTGAGAACCAATC, r-CCACCCGAGTGTAACCATAGC; HPSE: f-ATTTGAATGGACGGACTGC, r-GTTTCTCCTAACCAGACCTTC; TGF-β1: f-CGTGGAGCTGTACCAGAAAT, r- GATAACCACTCTGGCGAGTC; GAPDH: f- ACACCCACTCCTCCACCTTT, r-TCCACCACCCTGTTGCTGTA; HPSE: f-ATTTGAATGGACGGACTGC r—GTTTCTCCTAACCAGACCTTC [19].

2.3. Immunofluorescence for α-SMA, VIM and FN.

Wt and HPSE-silenced cells were seeded in 22-mm glass dishes andcultured to subconfluence, serum-starved for 24 h, and then incubatedwith or without the different treatments for 48 h to analyze α-SMA,VIM and FN protein expression. Cells were fixed in 4% paraformalde-hyde and permeabilized in PBS+ 0.2% Triton-X100. Cells were incubat-ed with primary antibodies for α-SMA (mouse anti-α-smooth muscleactin, 1A4, Sigma), VIM (Monoclonal Mouse Anti-Vimentin, Clone V9,Dako) and FN (Anti-Fibronectin antibody [IST-9] ab6328, Abcam) over-night at 4 °C in PBS with 1% BSA, then washed three times for 5 min/each with PBS before incubating them for 1 h at 37 °C with the second-ary antibody (goat anti-mouse IgG-FITC; Millipore) in PBS with 1% BSA.Nuclei were counterstainedwith Hoechst 33258. Images were acquiredby confocal microscope LeicaSP5.

2.4. Zymography

MMPs activity in cells conditioned media was assessed by gelatinsubstrate zymography. Conditionedmediawere prepared by incubatingsubconfluent cells in a serum-free medium for 24 h, then with or with-out 20 ng/ml TGF-β1 for a further 24, 48 or 72 h. Zymography was car-ried out using standard procedure [25]. Equal amounts of conditionedmedia were resolved in a non-reducing sample buffer on 10% SDS-PAGE gels copolymerized with 0.1% gelatin. After electrophoresis, thegels were washed twice for 30 min/each in 2.5% Triton X-100 at roomtemperature to remove SDS, then equilibrated for 30min in collagenasebuffer (50 mM Tris, 200 mMNaCl, 5 mM CaCl2 and 0.02% Triton X-100,pH 7.4), and finally incubated overnightwith fresh collagenase buffer at37 °C. After incubation, gels were stained in 0.1% Comassie Brilliant BlueR-250 30% MetOH/10% acetic acid for 1 h and destained in 30% MetOH/10% acetic acid. Digestion bands were analyzed using ImageJ software(http://rsb.info.nih.gov/ij/).

2.5. TGF-β1 ELISA assay

The release of TGF-β1 in the conditioned media of wt and HPSE-silenced tubular cells was measured by an ELISA (RAB0460, Sigma-

2124 V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

Aldrich) following themanufacturer's instructions. Briefly, 100 μl of 48hconditionedmedium of wt and HPSE-silenced cells treated or untreatedwith 20 ng/ml TGF-β1, or 100 μg/ml BSA, or 100 μg/ml of AGE, or10 ng/ml FGF-2 was added to a well plate covered with an antibodyanti-TGF-β1. To the plate was also added serial dilution of TGF-β1 stan-dards. The plate was then incubated overnight at 4 °Cwith gentle shak-ing. Subsequently, the platewaswashed four timeswith 1×washbufferand then 100 μl of 1× biotinilated antibody was added to each well andincubated at room temperature for 1 h. After four washes, 100 μl of TMBOne-Step Substrate Reagent was added to each well and kept 30 min atroom temperature in the dark. The colorimetric reaction was stoppedwith 100 μl of Stop Solution. Absorbance was immediately read at450 nm. The TGF-β1 amount in each sample was calculated by plottingits O.D. value on the TGF-β1 standard curve. Each sample was tested intriplicate.

Fig. 2. TGF-β release in the medium. An ELISA assay was used to quantify the release ofTGF-β1 in the conditioned media of wt and HPSE-silenced tubular cells treated for 48 hwith BSA, AGE, and FGF-2. The results represent the mean ± SD of two independent ex-periments performed in triplicate (*p b 0.05, **p b 0.001 vs wt untreated).

2.6. Statistics

Standard deviations and means of the real-time PCR data were cal-culated with Rest2009 software. Differences between wt and HPSE-silenced cells, or between treated and untreated cells, were comparedusing Student's test. A p value≤0.05 was set as the level of significancefor all tests.

3. Results

3.1. Role of HPSE on TGF-β induction by pro-fibrotic factors

Several pieces of evidence highlight the fact that heparanase cancontrol the development of EMT in tubular cells and thus regulate theprogression of fibrosis [20,24]. HPSE resulted up-regulated in tubularepithelial cells in response to several pro-fibrotic factors (albumin(BSA) and glycated albumin (AGE) and FGF-2) which are typically in-creased at the onset of DN [19,20]. Moreover, Jil N. et al. provided evi-dence that the lack of HPSE may regulate the expression of TGF-β inthe setting of diabetic nephropathy [24].

Since TGF-β has a central role in the pathology of proximal tubularcells we investigatedwhether HPSE is involved in TGF-β overexpressionin response to pro-fibrotic factors. We treated wt and HPSE-silencedcells with BSA, AGE and FGF-2 and then we analyzed TGF-β expressionat 6, 24 and48h. The 6 h treatmentwith albumin, AGE and FGF-2 result-ed in a significant increase of TGF-β gene expression inwt cells. InHPSE-silenced tubular cells the treatment with albumin, AGE and FGF-2 didnot increase TGF-β expression even at longer times (Fig. 1).

Fig. 1. Relative expression of TGF-β. Gene expression levels of TGF-β normalized to GAPDHwereGene expression levels were referred to un-treated wt and HPSE-silenced cells set equal to onelicate (**p b 0.001 vs wt untreated).

Similarly, the pro-fibrotic factors albumin, AGE and FGF-2 inducedthe release of TGF-β in the conditionedmedium (48 h serum freemedi-um) only in wt tubular cells (Fig. 2).

Since the results showed that the lack of HPSE prevents the increaseof TGF-β expression and secretion, and because HPSE can represent apharmacological target, the effect of the HPSE-inhibition by LMWHwas investigated. Wt tubular cells were treated with BSA, AGE andFGF-2 with or without LMWH and TGF-β expression was assessed.Gene expression analysis showed that LMWH did not influence basalTGF-β but completely prevented its up-regulation induced by pro-fibrotic factors (Fig. 3).

3.2. Effects of TGF-β on mesenchymal-associated markers

At the onset of renal fibrosis, tubular cells are not the only source ofTGF-β as it can also be produced by endothelial and immune cells [3].Since HPSE is able to regulate the EMT of tubular cells induced by FGF-2 [20] we investigated whether HPSE modulates tubular cell responseto exogenous TGF-β.

Following 6, 24 and 48 h incubation of wt andHPSE-silenced tubularcells with TGF-β, the gene expression of EMT associated markers (α-SMA, VIM, FN and MMP9) was evaluated.

In wt cells TGF-β induced an early up-regulation of all the abovegenes from the 6-h point, while the effect in HPSE silenced cells waslater, starting from the 24th hour or even later for VIM (Fig. 4A, B, C, D).

assessed inwt andHPSE-silenced cells treated for 6, 24 and 48hwith BSA, AGE and FGF-2.. The results represent themean± SD of two independent experiments performed in trip-

Fig. 3. TGF-β expression in LMWH-treated cells. Gene expression level of TGF-β normal-ized to GAPDH was assessed in wt cells treated for 6 h with BSA, AGE and FGF-2 in thepresence or not of LMWH. Gene expression levels were referred to un-treated wt cellsset equal to one. The results represent the mean ± SD of two independent experimentsperformed in triplicate (**p b 0.001 vs wt untreated).

Fig. 4. Relative expression of α-SMA, VIM, FN and MMP9. Gene expression levels of α-SMA (A)HPSE-silenced cells treated for 6, 24 and 48 hwith TGF-β.α-SMA, VIM, FN andMMP9 gene exprgene expression levels were referred to un-treated wt cells set equal to one. The results represeb 0.001 vs wt untreated).

2125V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

It had previously been shown that FGF-2, a trigger of EMT in tubularcells, also sustains its autocrine loop by up-regulating HPSE. Thus, weanalyzed whether TGF-β regulates HPSE expression in tubular cells. Asexpected, and previously reported, HPSE-silenced cells displayed a sig-nificant HPSE reduction [19]. Gene expression analysis showed thatboth in wt and HPSE-silenced cells TGF-β did not modify HPSE expres-sion levels (Fig. 4E).

Moreover, after 48 h of incubation of wt and HPSE-silenced tubularcells with TGF-β, protein amount of EMT associated markers (α-SMA,FN and VIM) was evaluated by immunofluorescence. Results showedthat all three markers (α-SMA, FN and VIM) were clearly up-regulatedboth in wt and HPSE-silenced cells treated with TGF-β (Fig. 5).

The evaluation of MMP activity in serum free conditioned media ofwt and HPSE-silenced cells treated with TGF-β for 24,48 and 72 h re-vealed that, in wt tubular cells, TGF-β increases the release of activeMMP9 progressively, from 24 to 72 h. At 72 h, TGF-β induced a four-fold increase of active MMP9 in comparison with wt untreated cells. InHPSE-silenced cells, TGF-β increased the release of active MMP9 after48 and 72 h of treatment but not at 24 h. (Fig. 6).

, VIM (B), FN (C) MMP9 (D) and HPSE (E) normalized to GAPDHwere assessed in wt andession levelswere referred to un-treatedwt andHPSE-silenced cells set equal to one. HPSEnt themean ± SD of two independent experiments performed in triplicate (*p b 0.05, **p

Fig. 5. α-SMA, VIM and FN protein expression after TGF-β treatment. Representative im-ages of one of two immunostaining experiments for α-SMA, VIM and FN in wt andHPSE-silenced cells, treated for 48 h with or without TGF-β.

2126 V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

3.3. TGF-β autocrine loop

TGF-β produces an autocrine loop to sustain its signal (andEMT) [3];thus we hypothesized that the delayed response of HPSE-silenced cellsto TGF-β could be due to alterations in this feedback.We analyzed TGF-β gene expression inwt andHPSE-silenced cells treatedwith TGF-β. Thetreatment induced a rapid significant increase of the TGF-β gene expres-sion in wt HK2 cells and this up-regulation lasted over time. In HPSE-silenced cells TGF-β basal gene expression level was comparable to wtcells, and incubation with TGF-β induced only a delayed and transientoverexpression of the TGF-β gene (Fig. 7).

4. Discussion

The shrunken kidney is the end stage ofmany kidney diseases. The ir-reversible loss of kidney function prevents the body from eliminatingmuch of the waste and therefore involves the need for dialysis or organtransplantation. Among the causes of chronic renal failure, diabetic ne-phropathy is one of the most common in developed countries [3]. Thedamage to the renal tissues caused by diabetes is due to the high concen-tration of glucose, the products of advanced glycation and proteinuria.

Regardless of etiology, the main mechanism responsible for chronicrenal failure is tubulo-interstitial fibrosis, which is the process of pro-gressive scarring of the interstitial space caused by myofibroblasts.These α-SMA positive cells secrete large amounts of extracellular ma-trix and have contractile properties [1]. Given the incidence of chronickidney diseases potentially at risk of ESRD and the lack of effective ther-apeutic methods able to prevent it, studies aimed at understanding themolecular and biological basis of tubulo-interstitial fibrosis are of primeimportance.

A mechanism which appears to contribute to the increase ofmyofibroblasts in the interstitium during renal fibrosis is the epithelial–mesenchymal transition of proximal tubular cells [5]. These cells losetheir identity as epithelial cells and differentiate into myofibroblasts.

Among the pro-fibrotic stimuli that activate the fibroblasts intomyofibroblasts, FGF-2 and TGF-β are main inducers of EMT of proximaltubule epithelial cells [9,26]. Studies have revealed a role of the enzymeHPSE in regulating the EMT induced by these pro-fibrotic growth fac-tors. Indeed, tubular epithelial cells silenced for HPSE, do not undergoEMT induced by FGF-2 [20]. Furthermore, in the HPSE knock-outmouse no increase of TGF-β occurs in the kidney when diabetic is in-duced [24].

Given the cardinal role of TGF-β in triggering EMT and the associatedfibrosis, the present study aimed at understanding whether HPSE is aregulator element of this growth factor. In-vitro analysis shows thatthe absence of HPSE prevents the increased synthesis of TGF-β by tubu-lar cells in response to pro-fibrotic stimuli such as FGF-2, AGE and BSA.This finding is similar to the observation that in diabetic HPSE ko micerenal TGF-β is not overexpressed [24]. Moreover, the lack of HPSEdoes not prevent EMT induced by TGF-β although slowing the onset.As a consequence of these two effects, a major global role of HPSEcould be expected in the regulation of EMT by TGF-β.

Hyperglycemia, proteinuria, and AGEs are the mainmediators of tu-bular damage and strong inducers of tubulo-interstitial fibrosis in dia-betic nephropathy [27]. The in vivo exposure to AGE and to highconcentrations of glucose and albumin filtered by the glomeruli inducesthe over-production of TGF-β by proximal tubule cells. Even cytokinesand growth factors such as FGF-2, released by inflammatory cells, stim-ulate an increased expression of TGF-β in the tubular cells.

The capacity of these stimuli to increase the production of TGF-βwasconfirmed in wt tubular cells. In cells lacking HPSE, however, BSA, AGEand FGF-2 did not modify the expression of TGF-β. That it was the lackof HPSE which prevented the increase in TGF-β overexpression is prov-en by the treatmentwith lowmolecularweight heparin (anHPSE inhib-itor) after which the over-expression of TGF-βwas prevented followingstimulation with BSA, AGE and FGF-2.

Fig. 6.MMP9activity. Above, a representative gelatin zymographydisplayingMMP9digestion bands produced by serum-freemediumofwt andHPSE-silencedHK2 cells cultured for 24, 48 and72 h with TGF-β. Below, densitometric analysis of MMP9 digestion bands expressed as a percentage of untreated wt and HPSE-silence cells respectively. Results represent the mean ± SD ofthree independent experiments performed in triplicate (*p b 0.05, **p b 0.001 vs wt untreated).

2127V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

HPSE, therefore, seems to be required for the increase of TGF-β in tu-bular epithelial cells in response to pro-fibrotic stimuli. These data givean explanation at the molecular level of the fact that the HPSE-ko-mouse does overexpress TGF–β and possibly also of the fact that itdoes not develop diabetic nephropathy [24].

At the onset of renal fibrosis, TGF-β is produced by several cell typessuch as endothelial and immune cells [3]. Since HPSE is able to regulatethe EMT of tubular cells induced by FGF-2 [20] we hypothesized thatHPSE could modulate tubular cell response to exogenous TGF-β.

The phenotypical change distinctive of EMT is characterized by theincrease in specific markers of mesenchymal cells such as VIM, α-SMAand FN which is indeed expressed in wt tubular cells when stimulatedwith TGF-β after a few hours of treatment, suggesting a rapid responseof the cells to the stimulus. These data confirm that TGF-β is a potent in-ducer of EMT. The expression of thesemarkers was also increased in theabsence of HPSE, but not as rapidly as inwt cells suggesting that the lackof HPSE may, in some way, hinder the activity of TGF-β and interferewith the activation or operation of its signaling pathway.

Fig. 7. Relative expression of TGF-β quantified by real-time PCR and normalized toGAPDH. Gene expression levels of TGF-β normalized to GAPDH were assessed in wt andHPSE-silenced cells treated for 6, 24 and 48 hwith TGF-β. Gene expression levelswere re-ferred to un-treatedwt and HPSE-silenced cells set equal to one. The results represent themean ± SD of two independent experiments performed in triplicate (**p b 0.001 vs wtuntreated).

During tubulo-interstitial fibrosis, TGF-β induces an autocrine loopthat amplifies the effects of this growth factor. [26]. Present results con-firm that this autocrine loop is activated in wt tubular cells stimulatedwith TGF-β. Similarly to the induction of mesenchymal markers ofEMT, the lack of HPSE in tubular cells did not prevent the TGF-β from ac-tivating its transcription but caused a delay. Again this suggests thatHPSE can support the TGF-β in rapidly activating the transcription ofits target genes. Moreover, the duration of activation of the loop seemsto be influenced by HPSE. In the presence of HPSE, in fact, the expressionof TGF-βwasmaintained significantly elevated over timewhile in its ab-sence it quickly returned to baseline values. This decreasing trend thatoccurs in silenced cells was not observed for the mesenchymal markers.One possible explanation is the fact that over-expression of mesenchy-mal markers is also supported by several transcription factors whose ex-pression is activated by TGF-β itself [28].

Another well-known effect of TGF-β is the induction of MMPs, par-ticularly MMP-9, by the epithelial cells. The activity of MMP-9 involvesthe degradation of the tubular basement membrane thus facilitatingcell migration [5]. MMPs also activate the latent form of TGF-β anchoredto the matrix, one more example by which TGF-β sustains its signalingpathway [29].

In accordance with the foregoing considerations, the tubular cellstreated with TGF-β increased the expression, release and activity ofMMP-9. The trend of gene expression and extracellular activity ofMMP-9 are comparable. In fact, during TGF-β treatment, wt tubularcells expressed a high amount of MMP-9 which remained high overtime. MMP-9 was secreted and its progressive accumulation in the cul-ture mediumwas demonstrated by zymographyc analysis. The analysisof the MMP activity reconfirmed that HPSE-silenced cells release lessMMP-9 compared with wt tubular cells [20]. However, the lack ofHPSE did not prevent the TGF-β-induced increase ofMMP-9 expression.Indeed, the expression levels of MMP-9 in HPSE-silenced cells reachedlevels comparable to those of wt cells but such an increase was delayed.Considering that MMP-9 is a target gene of TGF-β, this result supportsthe hypothesis that HPSE facilitates the TGF-β in rapidly exerting its bi-ological activities.

The morphological and phenotypical changes of EMT induced byTGF-β involve the loss of cell–cell junctional complexes and reorganiza-tion of actin fibers in stressfibers ensures that the tubular epithelial cells

2128 V. Masola et al. / Biochimica et Biophysica Acta 1843 (2014) 2122–2128

acquire a mesenchymal phenotype and an increase in themigratory ca-pacity of tubular cells which, thanks to the degradation of the tubularbasement membrane mediated by MMP-9, can move into the intersti-tium [30].

Several hypotheses, which have to be confirmed with future exper-iments, may explain the different response of thewt and HPSE-silencedcells to TGF-β: 1) In cells silenced for HPSE, heparan sulfate turnover iscompromised and the expression of syndecan-1, a cell surface proteo-glycan, is increased [19]. The increased amount of heparan sulfate ex-posed on the cell surface could sequester TGF-β and delay and/ormodulate its interaction with receptors. 2) TGF-β induces EMT in tubu-lar cells through the activation of SMAD-dependent and some SMAD-independent pathways [31]. Previous studies [19] have shown thatthe lack of HPSE in tubular epithelial cells involves an abnormal activa-tion of the PI3K/Akt patyhway in response to FGF-2. This suggests thateven one of the TGF-β signaling pathwaysmay be altered in the absenceof HPSE. 3) The absence of HPSE may influence the expression of theproteoglycan β-glycan that acts as a co-receptor of the TGF-β. This hy-pothesis is based on the fact that the expression of another membraneheparan-sulphate proteoglycan, syndecan-1, is regulated by HPSE bothin tubular cells and in other cell models [32].

5. Conclusions

Overall, these data confirm that heparanase is an important player inrenal fibrosis: A) HPSEmodulates TGF-β induced EMT, in particular, thelack of HPSE delays tubular cell transdifferentiation and impairs theTGF-β autocrine loop and B) HPSE is needed for the pathological TGF-β overexpression in response to pro-fibrotic factors such as overloadof albumin, AGE and FGF-2.

Given the incidence of chronic renal failure and the need for effectivetreatments, these findings put HPSE forward as a potential and impor-tant drug target in the treatment of kidney disease and renal fibrosis.The understanding of the molecular mechanisms by which HPSEcontrols the EMT in renal tubular cells is therefore of fundamentalimportance.

Altogether, these data confirm that strategies aimed at inhibitingheparanase could be a useful tool in controlling several mechanismsleading to organ fibrosis.

Acknowledgments

This work was supported by Padova University grant (60A06-7003/13) and by Laboratorios Farmacéuticos Rovi S.A., Madrid, Spain (“GrantAward for Biomedical Research”).

References

[1] T.D. Hewitson, Renal tubulointerstitial fibrosis: common but never simple, Am. J.Physiol. Renal Physiol. 296 (6) (Jun 2009) F1239–F1244.

[2] R.M. Mason, N.A. Wahab, Extracellular matrix metabolism in diabetic nephropathy,J. Am. Soc. Nephrol. 14 (5) (May 2003) 1358–1373.

[3] K. Kanasaki, G. Taduri, D. Koya, Diabetic nephropathy: the role of inflammation in fi-broblast activation and kidneyfibrosis, Front. Endocrinol. (Lausanne) 4 (Feb 6 2013) 7.

[4] S. Piera-Velazquez, Z. Li, S.A. Jimenez, Role of endothelial-mesenchymal transition(EndoMT) in the pathogenesis of fibrotic disorders, Am. J. Pathol. 179 (3) (Sep2011) 1074–1080.

[5] H.Y. Lan, Tubular epithelial-myofibroblast transdifferentiation mechanisms in prox-imal tubule cells, Curr. Opin. Nephrol. Hypertens. 12 (1) (Jan 2003) 25–29.

[6] A. Purushothaman, L. Chen, Y. Yang, R.D. Sanderson, Heparanase stimulation of pro-tease expression implicates it as a master regulator of the aggressive tumor pheno-type in myeloma, J. Biol. Chem. 283 (47) (Nov 21 2008) 32628–32636.

[7] P. Boor, J. Floege, Chronic kidney disease growth factors in renal fibrosis, Clin. Exp.Pharmacol. Physiol. 38 (7) (2011) 441–450.

[8] C.E. Hills, P.E. Squires, The role of TGF-β and epithelial-to mesenchymal transition indiabetic nephropathy, Cytokine Growth Factor Rev. 22 (3) (Jun 2011) 131–139.

[9] F. Strutz, M. Zeisberg, F.N. Ziyadeh, C.Q. Yang, R. Kalluri, G.A. Müller, E.G. Neilson,Role of basic fibroblast growth factor-2 in epithelial–mesenchymal transformation,Kidney Int. 61 (5) (May 2002) 1714–1728.

[10] Y.C. Tian, Y.C. Chen, C.T. Chang, C.C. Hung, M.S. Wu, A. Phillips, C.W. Yang, Epidermalgrowth factor and transforming growth factor-beta1 enhance HK-2 cell migrationthrough a synergistic increase of matrix metalloproteinase and sustained activationof ERK signaling pathway, Exp. Cell Res. 313 (11) (Jul 1 2007) 2367–2377 (Epub2007 Mar 30).

[11] S. Ge, R. Zeng, Y. Luo, L. Liu, H. Wei, J. Zhang, H. Zhou, G. Xu, Role of protein kinase Cin advanced glycation end products-induced epithelial–mesenchymal transition inrenal proximal tubular epithelial cells, J. Huazhong Univ. Sci. Technolog. Med. Sci.29 (3) (Jun 2009) 281–285.

[12] J. Ibrini, S. Fadel, R.S. Chana, N. Brunskill, B. Wagner, T.S. Johnson, A.M. El Nahas,Albumin-induced epithelial mesenchymal transformation, Nephron Exp. Nephrol.120 (3) (2012) e91–e102.

[13] N. Ilan, M. Elkin, I. Vlodavsky, Regulation, function and clinical significance ofheparanase in cancer metastasis and angiogenesis, Int. J. Biochem. Cell Biol. 38(12) (2006) 2018–2039.

[14] M. Garsen, A.L. Rops, T.J. Rabelink, J.H. Berden, J. van der Vlag, The role of heparanaseand the endothelial glycocalyx in the development of proteinuria, Nephrol DialTransplant. 29 (1) (2014) 49–55.

[15] M.J. van den Hoven, A.L. Rops, I. Vlodavsky, V. Levidiotis, J.H. Berden, J. van der Vlag,Heparanase in glomerular diseases, Kidney Int. 72 (5) (Sep 2007) 543–548.

[16] V. Masola, C. Maran, E. Tassone, A. Zin, A. Rosolen, M. Onisto, Heparanase activity inalveolar and embryonal rhabdomyosarcoma: implications for tumor invasion, BMCCancer 9 (Aug 28 2009) 304.

[17] F. Zong, E. Fthenou, N. Wolmer, P. Hollósi, I. Kovalszky, L. Szilák, C. Mogler, G.Nilsonne, G. Tzanakakis, K. Dobra, Syndecan-1 and FGF-2, but not FGF receptor-1,share a common transport route and co-localize with heparanase in the nuclei ofmesenchymal tumor cells, PLoS ONE 4 (10) (Oct 5 2009) e7346.

[18] J. Reiland, D. Kempf, M. Roy, Y. Denkins, D. Marchetti, FGF2 binding, signaling, andangiogenesis are modulated by heparanase in metastatic melanoma cells, Neoplasia8 (7) (Jul 2006) 596–606.

[19] V. Masola, G. Gambaro, E. Tibaldi, M. Onisto, C. Abaterusso, A. Lupo, Regulation ofheparanase by albumin and advanced glycation end products in proximal tubularcells, Biochim. Biophys. Acta 1813 (8) (Aug 2011) 1475–1482.

[20] V.Masola, G. Gambaro, E. Tibaldi, A.M. Brunati, A. Gastaldello, A. D'Angelo, M. Onisto,A. Lupo, Heparanase and syndecan-1 interplay orchestrates fibroblast growthfactor-2-induced epithelial–mesenchymal transition in renal tubular cells, J. Biol.Chem. 287 (2) (Jan 6 2012) 1478–1488.

[21] V. Masola, M. Onisto, G. Zaza, A. Lupo, G. Gambaro, A new mechanism of action ofsulodexide in diabetic nephropathy: inhibits heparanase-1 and prevents FGF-2-induced renal epithelial–mesenchymal transition, J. Transl. Med. 10 (Oct 24 2012)213.

[22] G. Gambaro, F.J. van der Woude, Glycosaminoglycans: use in treatment of diabeticnephropathy, J. Am. Soc. Nephrol. 11 (2) (Feb 2000) 359–368.

[23] V. Ferro, E. Hammond, J.K. Fairweather, The development of inhibitors ofheparanase, a key enzyme involved in tumor metastasis, angiogenesis and inflam-mation, Mini Rev. Med. Chem. 4 (6) (Aug 2004) 693–702.

[24] N. Gil, R. Goldberg, T. Neuman, M. Garsen, E. Zcharia, A.M. Rubinstein, T. vanKuppevelt, A. Meirovitz, C. Pisano, J.P. Li, J. van der Vlag, I. Vlodavsky, M. Elkin,Heparanase is essential for the development of diabetic nephropathy in mice, Dia-betes 61 (1) (Jan 2012) 208–216.

[25] J. Vandooren, N. Geurts, E. Martens, P.E. Van den Steen, G. Opdenakker, Zymographymethods for visualizing hydrolytic enzymes, Nat. Methods 10 (3) (Mar 2013)211–220.

[26] H.Y. Lan, Diverse roles of TGF-β/Smads in renal fibrosis and inflammation, Int. J. Biol.Sci. 7 (7) (2011) 1056–1067.

[27] C.E. Hills, P.E. Squires, TGF-beta1-induced epithelial-to-mesenchymal transition andtherapeutic intervention in diabetic nephropathy, Am. J. Nephrol. 31 (1) (2010)68–74.

[28] J. Xu, S. Lamouille, R. Derynck, TGF-beta-induced epithelial to mesenchymal transi-tion, Cell Res. 19 (2) (Feb 2009) 156–172.

[29] H. Hayashi, T. Sakai, Biological significance of local TGF-β activation in liver diseases,Front. Physiol. 3 (Feb 6 2012) 12.

[30] J. Yang, Y. Liu, Dissection of key events in tubular epithelial to myofibroblast transi-tion and its implications in renal interstitial fibrosis, Am. J. Pathol. 159 (4) (Oct2001) 1465–1475.

[31] Y.E. Zhang, Non-Smad pathways in TGF-beta signaling, Cell Res. 19 (1) (Jan 2009)128–139.

[32] V.C. Ramani, A. Purushothaman, M.D. Stewart, C.A. Thompson, I. Vlodavsky, J.L. Au,R.D. Sanderson, The heparanase/syndecan-1 axis in cancer: mechanisms and thera-pies, FEBS J. 280 (10) (May 2013) 2294–2306.