Cellular Signalling 25 (2013) 2797–2804

Contents lists available at ScienceDirect

Cellular Signalling

j ourna l homepage: www.e lsev ie r .com/ locate /ce l l s ig

Bcl-3, induced by Tax and HTLV-1, inhibits NF-κB activation andpromotes autophagy

Jinheng Wang a, Zhiguo Niu a, Ying Shi b, Cai Gao a, Xia Wang a, Jingxian Han a, Junying Li a, Zhitao Gao a,Xiaofei Zhu a, Xiangfeng Song a, Zhihai Qin c,⁎, Hui Wang a,⁎⁎a Research Center for Immunology, Department of Laboratory Medicine, Xinxiang Medical University, Xinxiang 453003, Henan Province, PR Chinab Department of Clinical Laboratory, The Third Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, Henan Province, PR Chinac Protein & Peptide Pharmaceutical Laboratory, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, PR China

⁎ Corresponding author. Tel.: +86 10 64888570.⁎⁎ Corresponding author. Tel./fax: +86 373 3029203.

E-mail addresses: zhihai@ibp.ac.cn (Z. Qin), wanghui@

0898-6568/$ – see front matter © 2013 Elsevier Inc. All rihttp://dx.doi.org/10.1016/j.cellsig.2013.09.010

a b s t r a c t

a r t i c l e i n f o

Article history:Received 30 August 2013Accepted 6 September 2013Available online 14 September 2013

Keywords:HTLV-1TaxBcl-3NF-κB activationAutophagy

The human T cell leukemia virus type 1 (HTLV-1) is a complex human retrovirus that causes an aggressive leu-kemia known as adult T cell leukemia (ATL). The HTLV-1-encoded oncoprotein Tax induces persistent activationof the nuclear factor-κB (NF-κB) pathway, which is perceived as the primary cause of ATL. Bcl-3, amember of theNF-κB inhibitor (IκB) family, is highly expressed inmanyHTLV-1-infected T cell lines and ATL cells. However, therole of Bcl-3 in Tax-induced NF-κB activation has not been fully elucidated. Here, we show that Tax induces Bcl-3expression, which in turn negatively regulates the Tax-induced NF-κB activation. Interestingly, both Bcl-3 up-regulation and NF-κB inhibition promote the autophagy process in HTLV-1-infected cells. Consistent with this,over-expression of Bcl-3 also results in enhancement of rapamycin-, pifithrin-α- or starvation-induced autoph-agy in control cells. Together, these data demonstrate that Bcl-3 acts as a negative regulator of NF-κB activationand promotes autophagy in HTLV-1-infected cells.

© 2013 Elsevier Inc. All rights reserved.

1. Introduction

The human T cell leukemia virus type 1 (HTLV-1) is an etiologicagent of adult T cell leukemia (ATL), an aggressive and fatal malignancyofmature CD4+ T lymphocytes. HTLV-1 encodes a number of regulatoryproteins that participate in HTLV-1 replication and viral transformation.As a key viral protein in HTLV-1-mediated oncogenesis, Tax promotesmalignant transformation through activation of nuclear factor-κB (NF-κB) [1]. Tax modulates expression of many cellular genes associatedwith cell cycle progression, immune and inflammatory responses, apo-ptosis, and other biological processes through the activation of the NF-κB pathway [2–4]. Tax connects activated kinases to the IκB kinase(IKK) complex and promotes the phosphorylation of IKKα and IKKβ,leading to the phosphorylation and subsequent proteasomal degrada-tion of IκBα protein [5]. With the degradation of IκBα, cytoplasmicNF-κB complexes disassociate from the inhibitors and enter into the nu-cleus, and Tax links NF-κB co-activators to enhance the transcription ofNF-κB-dependent cellular genes [6].

Oncoprotein Bcl-3 (B-cell chronic leukemia protein 3) is a memberof the IκB family of NF-κB inhibitors [7]. Itwas initially identified as a pu-tative proto-oncoprotein in B-cell lymphocytic leukemia [8]. Data sug-gest that Bcl-3 overexpression is sufficient to enhance tumorigenicpotential in many cell types, including T cells [9,10]. Bcl-3 is specifically

xxmu.edu.cn (H. Wang).

ghts reserved.

associated with homodimers of p50 and p52 [11] and functions as a co-activator through two cooperating transactivation domains to regulatetranscription of a subset of NF-κB-dependent genes [12–14]. Somewhatsurprisingly, Bcl-3 was also reported to directly inhibit transcription atcertain NF-κB-dependent promoters [13,15–17]. Recent reports [18]have shown that Bcl-3 increases p50 homodimer binding to NF-κBsites without causing co-activation. Bcl-3 could either activate or re-press the transcription of its target genes, but the effect of Bcl-3 onNF-κB pathway in HTLV-1-infected cells is unclear.

Autophagy is a lysosomal process that allows for the bulk degrada-tion of long-lived proteins and organelles [19]. It is associated withregulation of several important processes including cell survival, differ-entiation, immune responses, and inflammation [20–22]. Autophagy isinvolved in p100 processing and regulation of NF-κB activity [23] anda recent report has revealed that IκBα is also a degradation target of au-tophagy. Upon stimulation with TNF-α, IκBα is cleared through the au-tophagic pathway at later phases, leading to persistently active NF-κB[24]. Blocking autophagy prevents bortezomib-induced NF-κB activa-tion in lymphoma cells by reducing IκBα degradation [25]. A newstudy shows that the autophagy is required for NF-κB activation [26],indicating a critical role of autophagy in the NF-κB pathway. Althoughautophagy affects NF-κB pathway in several ways, several innovativestudies demonstrate the regulation of autophagy by NF-κB activation.TNF-α-induced activation of NF-κB represses autophagy inmany cancercell lines, and inactivation of NF-κB triggers its reactivation [27,28].NF-κB inhibition enhances starvation-induced autophagy [29], and theNF-κB pathway regulates the autophagy-related genes Beclin-1 [30] and

2798 J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

promotes deubiquitination of Beclin-1 protein [31]. Elevated Bcl-3 levelswere found inmany HTLV-1-infected T cell lines and ATL cells [32]. As animportant and complex regulator of NF-κB pathway, Bcl-3 may also reg-ulate autophagy. Although several Bcl-3 functions have been established,a role for Tax-induced Bcl-3 in NF-κB activation and autophagy in HTLV-1-infected cells remains poorly understood.

We observed elevated Bcl-3 expression in HTLV-1-infected cells andidentified Bcl-3 as a negative regulator of the NF-κB pathway and a pos-itive modulator of autophagy. Our report defined the roles for Bcl-3 inNF-κB activation and autophagy in HTLV-1-infected cells. This expandsour understanding of Tax-induced Bcl-3 in HTLV-1-infected cells andof the contributions of Bcl-3 to ATL development. We highlighted ther-apeutic potential of Bcl-3 as it inhibits the NF-κB activation efficiently,and the latter is required for the transformation of HTLV-1-infectedcells.

2. Materials and methods

2.1. Antibodies and reagents

Anti-Beclin-1 (bs-1353R) and anti-LC3B (L7543) rabbit polyclonalantibodies (pAbs) were purchased from Bioss and Sigma, respectively.Antibodies against β-tubulin (BS1482M) and lamin A (BS3774) werepurchased from Bioworld Technology. Antibodies against IKBα(4814S), P-IKBα (Ser32) (2859S), p65 (C22B4), and P-p65 (8242S)were purchased from Cell Signaling Technology. Anti-Bcl-3 rabbit pAb(sc-185) and anti-Tax mouse monoclonal antibody (mAb, sc-57872)were purchased from Santa Cruz Biotechnology. The anti-β-actinmouse mAb (TA-09), as well as the following immunoglobulin G (IgG)reagents: horseradish peroxidase-linked goat anti-mouse (ZB-2305),goat anti-rabbit (ZB-2301), and the FITC-conjugated goat anti-rabbit(ZF-0311), were purchased from Zhongshan Goldenbridge Biotechnolo-gy. Bay 11-7082 (S1523), rapamycin (S1842) and pifithrin-α (S1816)were purchased fromBeyotime. 5-(and-6)-Carboxyfluorescein diacetate,succinimidyl ester (CFSE) (C1157) was purchased from Invitrogen.

2.2. Cell culture and transfection

The human T leukemia cell line Jurkat, HTLV-1-infected T cell linesMT2 and MT4, and the human cervical carcinoma cell line Hela weremaintained in RPMI-1640 medium supplemented with 10–15% heat-inactivated fetal bovine serum, glutamine, and antibiotics at 37 °C in5% CO2. The transfections were performed using the Tfx-50 transfectionreagent (Promega, E1811) following the manufacturer's instruction.

2.3. Plasmid construction

To construct a plasmid expressing full-length Bcl-3without a tag,the cDNA of Bcl-3 was subcloned from pCMV-entry-Bcl-3 (Origene,RC209116) into the EcoR I and Xho I sites of the pcDNA3.0 vectorusing the following primers: 5′-cgggaattcGTCGACTGGATCCGGTACC-3′and 5′-aaactcgagTCAGCTGCCTCCT GGAGCTGG-3′. pNF-κB-luc plasmidswere kindly provided by Haojiang Luan (National Institute of MentalHealth, NIH), and pCMV-Bam-Tax and pCMV-Bam plasmids were kind-ly provided by Shoji Yamaoka (Tokyo Medical and Dental University).HTLV LTR reporter plasmid was kindly provided by Gutian Xiao(University of Pittsburgh), and pCMV-M22 and pCMV-M47 plasmidswere kindly provided by Professor Edward Harhaj (University ofMiami).

2.4. RT-PCR and qRT-PCR analyses

Total RNAwas prepared with TRIZOL regent and cDNAwas generat-ed with Omniscript RT Kit (Qiagen, 205110), followed by polymerasechain reaction (PCR) and real-time PCR assays. cDNA of TaxN andTaxP cells was examined for their expression of HTLV-1 tax genes by

RT-PCR. Relative quantification of Bcl-3 mRNA levels was performedby real-time PCR. Primer pairs were as follows: Tax, forward 5′-CAGGGTTTGGACAGAGTCTT, reverse 5′-GATAAGGAACTGTAGAGCTG;human ACTB, forward 5′-TGACGGGGTCACCCACACTGTGCCCATCTA, re-verse 5′-CTAGAAGCATTGCGGACGATGGAGGG; human Bcl-3 (for real-time PCR), forward 5′-GAAAACAACAGCCTTAGCATGGT, reverse 5′-CTGCGGAGTACATT TGCG; human β-actin (for real-time PCR), forward5′-CACAAACCCTCCACAGCC, reverse 5′- CCTGAGTCAGGTTATGAGGACC;human GAPDH (for real-time PCR), forward 5′-TCAACAGCGACACCCACTCC, reverse 5′-TGAGGTCCACCACCCTG TTG; HTLV-1 gag (forreal-time PCR), forward 5′-TATGCAGACCATCCGGCTTG, reverse 5′-TTGTTGGCTTGGACACGGAG.

2.5. Luciferase reporter assay

Cellswere transfectedusing pNF-κB-luc plasmids, and enzymatic ac-tivities assayed in cell extracts at 48 h post-transfection using the Lucif-erase Assay System (Promega, E1500) and 20/20n Luminometer(Turner BioSystems) according to the manufacturer's instructions. Theluciferase activity was expressed as the fold over the relevant controlof each experiment. All reporter assays were performed in triplicateand repeated in three independent experiments.

2.6. Immunofluorescence

The cells were harvested and fixed with chilled 95% ethanol. Fixedcellswere blockedwith TBS containing 5% BSA andwashedwith TBS con-taining 0.1% Triton X-100. Cells were incubated overnight with TBS con-taining anti-Bcl-3 rabbit pAb at 4 °C followed by washing with TBScontaining 0.1% Triton X-100 and incubated with TBS containing FITC-conjugated goat anti-rabbit IgG. Nuclei were stained with 10 μg/mlDAPI. Finally, cells were observed using an Olympus FluoView™ FV1000confocal microscope. Cells transduced with LC3B-GFP (Invitrogen,P36235)were treatedwith the indicated regents or transfectedwithplas-mids for the times indicated and incubated in Hoechst 33342 (10 μg/ml)for another 10 min. Images were collected on a laser scanning confocalmicroscope FV1000 (Olympus) and processed with FV10-ASW1.6 Olym-pus software.

2.7. Western blot analysis

Whole cell lysates were extracted from cells suspended in radio im-mune precipitation buffer supplemented with 1 mM PMSF (Beyotime,ST506), and cytoplasmic and nuclear extracts were obtained using theCytoplasmic and Nuclear Extract kit (Beyotime, P0028) according tothe manufacturer's instructions. Western blot was performed as previ-ously described [33]. Briefly, lysates were resolved by SDS-PAGE andtransferred to nitrocellulose membranes. The blots were incubatedwith the appropriate primary antibody after a blocking step and thenexposed to the appropriate horseradish peroxidase-conjugated secondantibody. Bands on the membrane were visualized and captured usingECL reagent (Beyotime, P0081) and X-ray film, respectively.

2.8. Microarray data

All microarray data have been deposited in the NCBI's Gene Ex-pression Omnibus and are accessible through GEO Series accessionnumber GSE39601 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE39601).

2.9. Data analysis

Statistical significance for the luciferase reporter assays was deter-mined using the Student's t-test or one-way ANOVA, and a p value ofb0.05 was regarded as statistically significant.

Fig. 1. Bcl-3 expression and nuclear translocation are induced by Tax. (A) Tax expression in TaxP cells was confirmed using RT-PCR and Western blot. (B) TaxN and TaxP cells weretransfected with pNF-κB-luc reporter plasmids and cell lysates were extracted for the luciferase activity assay. The results from three independent experiments are shown asmeans ± SD. (C) Bcl-3 expression in TaxN, TaxP and MT2 cells was detected by Western blot. (D) mRNA expression of Bcl-3 was measured using qRT-PCR. (E) Subcellular localizationsof Bcl-3 (green) in the TaxN and TaxP cellswere visualizedwith anti-Bcl-3 and FITC-conjugated anti-rabbit IgG. Thenucleiwere stainedwithDAPI (blue). (F) Cytoplasmic and nuclear Bcl-3expressions in TaxN and TaxP cells were measured usingWestern blot. Analyses of lamin A and β-tubulin proteins were included as a loading control of cytoplasmic and nuclear extractsrespectively.

Table 2Genes downregulated more than 2-fold in the presence of Tax.

UniGene_ID CGAP_Gene_Symbol Fold change(TaxP/TaxN)

Chromosomemap position

172130 MGC87693 2.79 11q12.2117367 SLC22A1 2.69 6q26120228 DDN 2.62 12q13.12129780 TNFRSF4 2.57 1p362545702 LOC201475 2.54 18p11.22127273 LIMS2 2.47 2q14.34890 UBE2E3 2.40 2q32.112256 MID2 2.39 Xq22167218 BARX2 2.39 11q25212296 ITGA6 2.38 2q31.1535162 LOC153095 2.33 5q31.398785 KSP37 2.31 4p16534397 HIST2H4 2.26 1q21242889 AKT1S1 2.25 19q13.33380412 RG9MTD2 2.23 4q2346423 HIST1H4C 2.21 6p21.3138701 TCRIM 2.22 3q13528667 RORC 2.19 1q21159366 MGC19604 2.18 19p13.2

2799J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

3. Results

3.1. Tax induces Bcl-3 expression and nuclear translocation

To investigate the role of Tax in carcinogenesis, a Tax-positivesubline of Jurkat (TaxP) cells stably expressing Tax and a Tax-negativesubline (TaxN) cells was established (Fig. 1A). The presence of Tax sig-nificantly increased NF-κB reporter activity in TaxP cells, as measuredby luciferase assay (Fig. 1B).

To examine gene expression changes resulting from Tax expression,we conducted microarray analysis. From over 10,000 genes, approxi-mately 48 changed more than 2-fold upon Tax expression. Of these,10 genes associatedwith cell development, differentiation, proliferationand oncogenesis were upregulated in the presence of Tax (Table 1),whereas 38 were downregulated (Table 2).

Interestingly, Bcl-3 was upregulated by Tax, as verified by quantita-tive RT-PCR (qRT-PCR) and Western blot analysis (Fig. 1C and D).Highest Bcl-3 expression was detected in the HLTV-1-infected cell lineMT2 (Fig. 1C and D). More interestingly, increased expression and nu-clear translocation of Bcl-3 were observed in TaxP cells assayed by

Table 1Genes upregulated more than 2-fold in the presence of Tax.

UniGene_ID CGAP_Gene_Symbol Fold change(TaxP/TaxN)

Chromosomemap position

6580 FLJ35348 2.80 9q34924 CRYM 2.67 16p13.11–p12.3112921 UNC13C 2.41 15q21.331210 BCL3 2.20 19q13.1–q13.2326035 EGR1 2.19 5q31.179022 GEM 2.18 8q13–q21159523 CRTAM 2.16 11q22–q23211823 EIF4E2 2.13 2q37.19572 ADCY5 2.02 3q13.2–q21382188 ART1 2.01 11p15

438583 FLJ10613 2.17 Xp11.2291564 KNDC1 2.16 10q26.3211751 KIAA1446 2.16 14q32.2468486 FLJ46838 2.15 2p16.3131818 CORO1B 2.15 11q13.2534574 FLJ12595 2.13 5q12.154838 KIAA1772 2.10 18q11.1–q11.2366546 MAP2K2 2.10 19p13.3158966 LOC286260 2.09 9q34.3374353 DKFZP566N034 2.09 2q21.3660551 MGC2494 2.08 16p13.3409202 JAG1 2.07 20p12.1–p11.23208219 OCSP 2.06 17q25.3170141 LOC399951 2.05 11q23.1490003 NRF1 2.05 7q32271277 RGMA 2.04 15q26.126213 DNTTIP1 2.03 20q13.12155071 C20orf46 2.02 20p1389627 PTPRG 2.01 3p21–p14

Fig. 2.NF-κB activation and Bcl-3 transcription were induced by HTLV-1 infection. (A) Jurkat andMT2 cells were co-cultured and indicated with arrows. The size of MT2 cell is more thantwice that of Jurkat. Jurkat cells were tansfectedwith pNF-κB-luc (B) or Bcl-3-luc (C) reporter plasmids for 24 h and thenwere co-culturedwith different amounts of MT2 cells for another24 h. Cell lysates were extracted for the luciferase activity assay after co-culture. The results from three independent experiments are shown as means ± SD. Single, double, and tripleasterisks indicate p b 0.05, p b 0.01, and p b 0.001, respectively. (D) Jurkat cells were labeled by fluorescent dye CFSE and co-cultured with different amounts of MT2 cells. After theco-culture, the CFSE positive Jurkat cells were collected using FACS screening for RT-PCR andWestern blot (WB) analysis. (E) After co-culturewithMT2 cells, HTLV-1-encoded Tax proteinand HTLV-1 gag expression in Jurkat cells were measured using Western blot and qRT-PCR analysis, respectively.

Fig. 3. Bay 11-7082 inhibits Bcl-3 expression. TaxN and TaxP cells were transfected withpNF-κB-luc (A) or Bcl-3-luc (B) reporter plasmids for 24 h and then treated with or with-out Bay 11-7082 (5 μM) for another 12 h. The cell lysateswere extracted for the luciferaseactivity assay. The results from three independent experiments are shown asmeans ± SD.Single, double, and triple asterisks indicate p b 0.05, p b 0.01, and p b 0.001, respectively.(B)Whole cell lysateswere extracted fromTaxP cells treatedwith orwithout Bay 11-7082and assessed byWestern blot for Bcl-3. Analysis of β-actin protein was included as a load-ing control.

2800 J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

immunofluorescence (Fig. 1E) andWestern blot (Fig. 1F). Taken togeth-er, these data indicate that Bcl-3 expression is enhanced by Tax, and thatTax induces Bcl-3 nuclear translocation.

3.2. HTLV-1 infection activates NF-κB pathway and Bcl-3 transcription

It has been reported that HTLV-1-infected cells form a virologicalsynapse with uninfected cells and the virus transmits to uninfectedcells [34]. We co-cultured Jurkat (HTLV-1-uninfected T cell line) andMT2 (HTLV-1-infected cell line) cells and observed the cell contact be-tween them (Fig. 2A). Luciferase assaywas used to evaluate the efficien-cy of viral transmission after the co-culture of Jurkat and MT2 cells.Jurkat cells transfected with pNF-κB-luc reporter plasmids were co-cultured with different amounts of MT2 cells and the luciferase activitywas measured. As the ratio of MT2 cells in co-culture increased, NF-κBactivity in Jurkat cells was gradually enhanced (Fig. 2B). Elevated Bcl-3transcriptional activity was also observed when cells were infected byco-culture (Fig. 2C). To confirm infection, Jurkat cells were labeledwith CFSE and CFSE-positive cells were screened by flow cytometryafter co-culture (Fig. 2D). The HTLV-1 gag, a viral matrix gene, and Taxprotein expression were detected in screened Jurkat cells using qRT-PCR and Western blot analysis respectively (Fig. 2E), indicating thatthese cells were infected by HTLV-1 virus. Correspondingly, the HTLV-1 gag and Tax expressions in infected Jurkat cells increased when cul-tured with more MT2 cells. Our data suggest that HTLV-1 infection in-creases NF-κB activation and Bcl-3 transcriptional activity.

3.3. NF-κB inhibition inhibits Bcl-3 expression

It has been reported that Bcl-3 is elevated by Tax through the activa-tion of NF-κB [10] and PI3K–Akt [32] pathways. We also show thatHTLV-1 infection activated NF-κB pathway and promotes Bcl-3 expres-sion at transcriptional and protein levels. We then used a NF-κB path-way inhibitor, Bay 11-7082, to evaluate the importance of the NF-κBpathway on Tax-induced Bcl-3 activation and expression. The inhibitorBay 11-7082 inhibited NF-κB activation in TaxN and TaxP cells (Fig. 3A),

but Tax-induced Bcl-3 activation and expression were also suppressed(Fig. 3B). These data confirm that Tax-induced Bcl-3 expression requiresNF-κB activation.

2801J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

3.4. Bcl-3 expression reduces Tax-activated transcription from NF-κB sitesand HTLV-1 LTR

Bcl-3 physically interactswith Tax andmay affect Tax function. As anIκB family member, Bcl-3 also functions in the NF-κB pathway. Weperformed luciferase assays to measure the effects of Bcl-3 expressionon wild-type Tax- and mutant Tax-induced transcriptional activationfrom NF-κB and HTLV-1 LTR. Hela cells were co-transfected with ex-pression plasmids encoding Bcl-3 and wild-type Tax or Tax mutants(M22 and M47), together with the pNF-κB-luc reporter plasmid.Fig. 4A shows that Bcl-3 potently suppressed Tax-induced NF-κB activa-tion. Similarly, Bcl-3 dramatically inhibited the NF-κB-dependent tran-scription in the absence of Tax or in the presence of Tax mutants.Interestingly, Bcl-3 repressed the NF-κB activation upon the TaxmutantM22 induction, even though M22 is unable to activate NF-κB.

Tax plays a principal role in activating transcription from theHTLV-1LTR, so we examined the consequences of Bcl-3 expression on the Tax-dependent transcription from the LTR. Bcl-3 expression significantlyinhibited transcriptional activation from LTR induced by Tax and mu-tants (Fig. 4B). As expected, activation of transcription from NF-κBsites and the LTR was repressed by Bcl-3 expression in HTLV-1-infected MT2 cells (Fig. 4C and D).

Fig. 4.Bcl-3 inhibits Tax-induced transcription fromNF-κB and LTR.Human cervical carcinomaHluc (A) or LTR-luc (B) reporter plasmids in thepresence of Tax or TaxmutantsM22 andM47. The1-infected MT2 cells were transfected with pNF-κB-luc (C) or LTR-luc (D) reporter plasmids anactivity assay at 48 h post-transfection.Western blot was performed to confirm the expression othree independent experiments are shown as means ± SD. Single, double, and triple asterisks

3.5. Inhibition of NF-κB pathway promotes autophagy inHTLV-1-infected cells

Autophagy is involved in many cellular functions regulated by theNF-κB signaling pathway. TNF-dependent activation of NF-κB repressesautophagy and blockage of NF-κB pathway trigger reactivation [27]. NF-κB pathway is persistently activated by Tax in HTLV-1-infected cells andautophagy might be repressed by such activation. To examine the roleof Tax-induced NF-κB activation on autophagy, we analyzed changesin autophagy in HTLV-1-infected cells following treatment with theNF-κB pathway inhibitor, Bay 11-7082 (Fig. 5A and B). IncreasedLC3B-GFP aggregations were observed within 4 h of the Bay 11-7082 treatment, whereas aggregations returned to baseline after12 h (Fig. 5A and B). Bay 11-7082 inhibits IκBα phosphorylation,subsequently leading to inhibition of p65 phosphorylation (Fig. 5Cand D) and NF-κB activity. An elevated ratio of LC3-II/LC3-I in MT2and MT4 cells (Fig. 5C and D) was observed after Bay 11-7082 treat-ment for 4 h but decreased after 12 h. Beclin-1, the first mammalianprotein shown to play a critical role in the initiation of autophagy[35], did not change in the presence of Bay 11-7082. These data dem-onstrate negative regulation of autophagy by Tax-induced NF-κB ac-tivation in HTLV-1-infected cells.

ela cellswere transfected using Bcl-3-expressing plasmids (pcDNA3.0-Bcl-3) and pNF-κB-cell lysateswere extracted for the luciferase activity assay at 48 h post-transfection.HTLV-d indicated amounts of pcDNA3.0-Bcl-3. The cell lysates were extracted for the luciferasef transfected and control (β-actin) protein using the indicated antibodies. The results fromindicate p b 0.05, p b 0.01, and p b 0.001, respectively.

Fig. 5. Bay 11-7082 promotes autophagy inHTLV-1-infected cells. (A)MT2 andMT4 cells were transducedwith LC3B-GFP (Invitrogen) for 24 h and then treatedwith Bay 11-7082 (2 μM)for indicated times, followed by immunofluorescence microscopy assessments of LC3B-GFP puncta formation. Representative images are shown in (A) and the number of GFP-LC3B vac-uoles per cell (mean ± s.e.m, n = 10–20 cells) is depicted in (B).White arrows indicate the LC3B-GFP aggregations. MT2 (C) andMT4 (D) cells were treatedwith Bay 11-7082 (2 μM) forindicated times, followed by Western blot to assess the changes of autophagy-related proteins, Beclin-1 and LC3, and the phosphorylation levels of p65 and IKBα.

2802 J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

3.6. Bcl-3 expression stimulates autophagy

Bcl-3 acts as a negative regulator of transcription from the NF-κBsites and HTLV-1 LTR (Fig. 4), and the observation that NF-κB inhibitionpromotes autophagy raised the question as to whether Bcl-3 might af-fect autophagy. We measured the formation of LC3B-GFP aggregationupon the overexpression of Tax or Bcl-3 singly or in combination inHela cells (Fig. 6A and B). Both Tax and Bcl-3 expression inducesLC3B-GFP aggregation, whereas aggregation did not further increasein the presence of Tax and Bcl-3. Similar results were obtained usingWestern blot analysis (Fig. 6C). We next performed Western blot anal-ysis to examine the effect of Bcl-3 overexpression on autophagy initiat-ed by certain inducers, including rapamycin, pifithrin-α, and starvation.Hela cells transfected with empty vector or Bcl-3-expressing plasmidswere exposed to autophagy inducers, and the ratio of LC3-II/LC3-I wasmeasured. Overexpression of Bcl-3 enhanced rapamycin-, pifithrin-α-and starvation-induced autophagy in Hela cells (Fig. 6D) and Beclin-1expression was likely decreased (Fig. 6D). Since Bcl-3 represses NF-κBactivation in HTLV-1-infected cells, we next examined the impact ofBcl-3 overexpression on autophagy-related proteins in these cells(Fig. 6E). Overexpression of Bcl-3 induced autophagy in MT2 cells andrapamycin- and pifithrin-α-induced autophagy were enhanced by in-creased Bcl-3 expression, whereas starvation-induced autophagy de-creased unexpectedly.

4. Discussion

Bcl-3 acts as a multifaceted modulator of NF-κB activity and isexpressed at high levels in many HTLV-1-infected T cell lines and ATLcells [32]. Our current study demonstrates that Bcl-3 inhibits NF-κBactivity andpromotes autophagy inHTLV-1-infected cells. NF-κB activa-tion induced by Tax and HTLV-1 infection is also involved in Bcl-3 up-regulation, which represses the NF-κB activity in a negative feedbackloop. In addition, inhibitor of NF-κB pathway and Tax or Bcl-3 re-expression led to autophagy, and the latter enhances induction ofautophagy caused by certain inducers.

ATL is a fatal malignancy caused by HTLV-1 infection and the malig-nant progression is not fully understood. The HTLV-1 encoded proteinTax is thought to induce Bcl-3 expression [32]. Bcl-3 is a member ofthe NF-κB pathway and persistent NF-κB activation is perceived as theprimary cause of HTLV-1-associated diseases, but its roles in HTLV-1-infected cells remain unclear. Autophagy is an important process forregulating cell survival, differentiation and other biological functionsand has a close relationship with NF-κB signaling pathway [36].However, the regulation and function of autophagy have not beenfully investigated inHTLV-1-infected cells, where theNF-κB is highly ac-tivated. Many reports have demonstrated the pleiotropic roles of Bcl-3in NF-κB activation [33,37] and the complex interplay between NF-κBsignaling pathway and autophagy, which suggests a connection be-tween Bcl-3 and these two biologic processes in HTLV-1-infected cells.

Microarray analyses suggest that a large number of cellular genes in-cluding growth factors and their receptors, cytokines, transcriptionfactors and other functional molecules are regulated in Tax-expressingcells [38–41]. Our microarray analysis showed that Bcl-3 wasupregulated more than 2-fold by Tax. Similarly, Hishiki et al. reportedthat Bcl-3 mRNA is constitutively expressed in HTLV-1 infected celllines [42]. In addition, Kim et al. have demonstrated that Tax transcrip-tionally upregulates Bcl-3 expression through an intronic enhancer ele-ment and the activation of the NF-κB pathway [10]. Tax is not the onlyinducer of Bcl-3 expression as the Bcl-3 expression is extremely higherin HTLV-1-infected cells than that in Tax-expressing cells (Fig. 1C andD).We also observed that Tax increased the Bcl-3 distribution in the cy-toplasm and nucleus, especially in the nucleus, indicating that Bcl-3functions as a nuclear factor after the induction by Tax. HTLV-1 trans-mission is achieved mainly by cell-to-cell commutation and requirescell contacts [34]. Biofilm-like extracellular viral assemblies at virologi-cal synapses rapidly adhere to other cells upon contact, allowing the in-fection of target cells [43]. The virological synapses and cell contactsbetween HTLV-1-infected and uninfected cells were clearly observedupon microscopic examination (Fig. 2A). These contacts promote thetransmission of viruses to un-infected cells, inducing Bcl-3 transcrip-tional activity. Data supporting the participation of NF-κB pathway in

Fig. 6. Bcl-3 expression stimulates autophagy. (A) Hela cells were transfectedwith empty vector or pCMV-Bam-Tax (Tax) or pcDNA3.0-Bcl-3 (Bcl-3) or the combination of Tax- and Bcl-3-expressing plasmids (Tax + Bcl-3) for 24 h and then transduced with LC3B-GFP for another 24 h. Immunofluorescence microscopy was performed to observe the LC3B-GFP puncta for-mation. Representative images are shown in (A) and the number of GFP-LC3B vacuoles per cell (mean ± s.e.m., n = 10–20 cells) is depicted in (B). (C)Whole cell lysates were extractedfromHela cells transfectedwith empty vector or pCMV-Bam-Tax (Tax) or pcDNA3.0-Bcl-3 (Bcl-3) or the combination of Tax- and Bcl-3-expressing plasmids and assessed byWestern blotfor Bcl-3, Tax and LC3. Analysis of β-actin protein was included as a loading control. (D) Hela cells were transfected with empty vector or pcDNA3.0-Bcl-3 for 36 h and then exposed toautophagy inducers, rapamycin (1 μM), pifithrin-α (30 μM), and starvation for the indicated time, followed by Western blot for the determination of the indicated proteins. (E) MT2cells were transfected with empty vector or pcDNA3.0-Bcl-3 for 36 h and then exposed to autophagy inducers for 4 h, followed by Western blot for the determination of the indicatedproteins. (F) The hypothetical links among Bcl-3, NF-κB activation and autophagy in HTLV-1-infected cells.

2803J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

Bcl-3 regulation remain incomplete, although the pathway involved inthe regulation of Bcl-3 by Tax has been verified using luciferase reporterassays [10]. Our current data confirmed the positive role of NF-κB path-way in the regulation of Bcl-3. There are compelling evidences that Bcl-3plays both positive and negative roles in NF-κB activation through dif-ferential recruitment of co-activators and co-repressors [37]. Our studyrevealed a regulatory role for Bcl-3 in NF-κB activation in the presenceof Tax or its mutants and in HTLV-1-infected cells. Bcl-3 also acts as anegative regulator of transcription from LTR, TxRE, and CRE through

interactions with TORC3 [42]. These negative regulatory roles revealthe anti-viral potential of Bcl-3 in HTLV-1-infected cells.

The negative regulation of autophagy has been reported in studiesshowing that NF-κB activation represses autophagy in Ewing's sarcoma,breast, and leukemia cancer cell lines [27,28] and that inhibition of NF-κBactivity enhances starvation-induced autophagy [36]. Many studies alsoshow that Bay 11-7082, an NF-κB inhibitor, reduces the starvation-induced formation of GFP-LC3 puncta by more than 65% [44] and de-creases Beclin-1 in activated murine T lymphocytes [30]. Our results

2804 J. Wang et al. / Cellular Signalling 25 (2013) 2797–2804

showed that Bay 11-7082 does not inhibit but instead promotesautophagy in HTLV-1-infected cells, where as Beclin-1 expression isnot changed after treatment. This suggests that Tax-induced persistentNF-κB activation may contribute to the inhibition of HTLV-1 infection-induced autophagy (Fig. 6F). However, return of autophagy to its previ-ous level while the NF-κB pathway is still inactive suggests that otherNF-κB-independent mechanisms are involved in the recover process.

These results show that NF-κB activation may inhibit autophagy inHTLV-1-infected cells, whereas the NF-κB pathway activator, Tax, in-duces the autophagy alone in Hela cells. Coincidentally, IKKs regulatecanonical autophagy in a NF-κB-independent manner [44] and couldbe directly activated by Tax [45,46]. Thus, Tax-induced autophagymay correlate with the activation of the IKK complex in HTLV-1-infected cells (Fig. 6F). A recent study suggests that HTLV-1 infectionand Tax expression increases autophagosome accumulation through in-hibition of lysosomal degradation [47], consistentwith our results. Bcl-3expression also stimulates autophagy in the absence or presence of Tax.Interestingly, Beclin-1 is decreased slightly after Bcl-3 overexpression inHela cells (Fig. 6D), whereas there is no obvious change in HTLV-1-infected cells after Bcl-3 re-expression (Fig. 6E). Since Beclin-1 is a targetgene of NF-κB pathway [31], Bcl-3 may inhibit its expression throughsuppression of NF-κB in Hela cells. InHTLV-1-infected cells, NF-κB path-way is highly activated by viral proteins and Tax may induce Beclin-1expression in a NF-κB-independent way. Considering that Bcl-3 is apleiotropic regulator of NF-κB pathway, the autophagy induced byBcl-3 is at least partly dependent on the inhibition of NF-κB activation(Fig. 6F). It is unclear how Bcl-3 decreased starvation-induced autopha-gy in HTLV-infected cells, although it appears that Bcl-3 acts as apositive regulator in Hela cells under starvation conditions.

Autophagy is induced in response to pathogen-associatedmolecularpatterns, DNA damage and other stressful conditions [36]. Correspond-ingly, HTLV-1 infection induces autophagy [47] and viral protein Taxpromotes the autophagy (Fig. 6A). Our findings suggest a negative reg-ulatory function for Bcl-3 in NF-κB activation and the promotion ofautophagy in HTLV-1-infected cells, making Bcl-3 a mediator betweenNF-κB signaling pathway and autophagy. One question that remainsto be investigated is the understanding of a mechanism involved inBcl-3-induced autophagy.

In summary, these studies have important implications for the rela-tionship between NF-κB pathway and autophagy in HTLV-1 pathogene-sis. Elevated Bcl-3 expression induced by Tax and HTLV-1 virus wasconfirmed systemically and a negative feedback loop between Tax-induced NF-κB activation and Bcl-3 was discovered. Negative andpositive regulatory roles of Bcl-3 in the two crucial processes, NF-κBpathway and autophagy, were revealed. In addition, Tax-induced NF-κB activation negatively regulates autophagy whereas Tax stimulatesit. These results suggest that autophagy mechanisms in HTLV-1-infected cells are complex. The present study also revealed a novel func-tion of Bcl-3 in autophagy and the complex connections among Bcl-3,NF-κB activation, and autophagy. The negative regulatory role in Tax-induced NF-κB activation and the positive regulation of autophagymake Bcl-3 a potential therapeutic target for HTLV-1 infection and ATL.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

We are most grateful to Ms. Wen Zhang and Mr. Jiqiang Guo for thetechnical assistance. We thank all laboratory staff members for the crit-ical reading of the manuscript. We thank Professor Wancai Yang for

reading themanuscript andmaking suggestions for revision. The currentwork was supported by grants from the National Natural Science Foun-dation of China (Grant nos. 30972755 and 81273241).

References

[1] S.C. Sun, J. Elwood, C. Beraud, W.C. Greene, Mol. Cell. Biol. 14 (1994) 7377–7384.[2] E. Harhaj, N. Harhaj, IUBMB Life 57 (2005) 83–91.[3] J. Shvarzbeyn, M. Huleihel, Antiviral Res. 90 (2011) 108–115.[4] J. Yasunaga, F.C. Lin, X. Lu, K.T. Jeang, J. Virol. 85 (2011) 6212–6219.[5] D.Y. Jin, V. Giordano, K.V. Kibler, H. Nakano, K.T. Jeang, J. Biol. Chem. 274 (1999)

17402–17405.[6] I. Azran, K.-T. Jeang, M. Aboud, Oncogene 24 (2005) 4521–4530.[7] F. Michel, M. Soler-Lopez, C. Petosa, P. Cramer, U. Siebenlist, C.W. Muller, EMBO J. 20

(2001) 6180–6190.[8] T.W. McKeithan, J.D. Rowley, T.B. Shows, M.O. Diaz, Proc. Natl. Acad. Sci. U. S. A. 84

(1987) 9257–9260.[9] J.O. Valenzuela, C.D. Hammerbeck, M.F. Mescher, J. Immunol. 174 (2005) 600–604.

[10] Y.M. Kim, N. Sharma, J.K. Nyborg, J. Virol. 82 (2008) 11939–11947.[11] D.L. Bundy, T.W. McKeithan, J. Biol. Chem. 272 (1997) 33132–33139.[12] T. Fujita, G.P. Nolan, H.C. Liou, M.L. Scott, D. Baltimore, Genes Dev. 7 (1993)

1354–1363.[13] G. Franzoso, V. Bours, V. Azarenko, S. Park, M. Tomita-Yamaguchi, T. Kanno, K.

Brown, U. Siebenlist, EMBO J. 12 (1993) 3893–3901.[14] V. Bours, G. Franzoso, V. Azarenko, S. Park, T. Kanno, K. Brown, U. Siebenlist, Cell 72

(1993) 729–739.[15] G. Franzoso, V. Bours, S. Park, M. Tomita-Yamaguchi, K. Kelly, U. Siebenlist, Nature

359 (1992) 339–342.[16] J. Inoue, T. Takahara, T. Akizawa, O. Hino, Oncogene 8 (1993) 2067–2073.[17] G.P. Nolan, T. Fujita, K. Bhatia, C. Huppi, H.C. Liou, M.L. Scott, D. Baltimore, Mol. Cell.

Biol. 13 (1993) 3557–3566.[18] T. Kabuta, F. Hakuno, Y. Cho, D. Yamanaka, K. Chida, T. Asano, K. Wada, S.-I.

Takahashi, Biochem. Biophys. Res. Commun. 394 (2010) 697–702.[19] D.J. Klionsky, S.D. Emr, Science 290 (2000) 1717–1721.[20] D. Schmid, C. Munz, Immunity 27 (2007) 11–21.[21] M.A. Delgado, V. Deretic, Cell Death Differ. 16 (2009) 976–983.[22] B. Levine, N. Mizushima, H.W. Virgin, Nature 469 (2011) 323–335.[23] G. Qing, P. Yan, Z. Qu, H. Liu, G. Xiao, Cell Res. 17 (2007) 520–530.[24] A. Colleran, A. Ryan, A. O'Gorman, C. Mureau, C. Liptrot, P. Dockery, H. Fearnhead, L.J.

Egan, J. Biol. Chem. 286 (2011) 22886–22893.[25] L. Jia, G. Gopinathan, J.T. Sukumar, J.G. Gribben, PLoS One 7 (2012) e32584.[26] A. Criollo, F. Chereau, S.A. Malik, M. Niso-Santano, G. Marino, L. Galluzzi, M.C. Maiuri,

V. Baud, G. Kroemer, Cell Cycle 11 (2012) 194–199.[27] M. Djavaheri-Mergny, M. Amelotti, J. Mathieu, F. Besancon, C. Bauvy, P. Codogno,

Autophagy 3 (2007) 390–392.[28] M. Djavaheri-Mergny, M. Amelotti, J. Mathieu, F. Besancon, C. Bauvy, S. Souquere, G.

Pierron, P. Codogno, J. Biol. Chem. 281 (2006) 30373–30382.[29] C. Fabre, G. Carvalho, E. Tasdemir, T. Braun, L. Ades, J. Grosjean, S. Boehrer, D.

Metivier, S. Souquere, G. Pierron, P. Fenaux, G. Kroemer, Oncogene 26 (2007)4071–4083.

[30] T. Copetti, F. Demarchi, C. Schneider, Autophagy 5 (2009) 858–859.[31] C.S. Shi, J.H. Kehrl, Sci. Signal. 3 (2010) ra42.[32] K. Saito, M. Saito, N. Taniura, T. Okuwa, Y. Ohara, Virology 403 (2010) 173–180.[33] J. Wang, J. Li, Y. Huang, X. Song, Z. Niu, Z. Gao, H. Wang, Int. J. Oncol. 42 (2013)

269–276.[34] T. Igakura, J.C. Stinchcombe, P.K. Goon, G.P. Taylor, J.N. Weber, G.M. Griffiths, Y.

Tanaka, M. Osame, C.R. Bangham, Science 299 (2003) 1713–1716.[35] X.H. Liang, S. Jackson, M. Seaman, K. Brown, B. Kempkes, H. Hibshoosh, B. Levine,

Nature 402 (1999) 672–676.[36] A. Trocoli, M. Djavaheri-Mergny, Am. J. Cancer Res. 1 (2011) 629–649.[37] S. Palmer, Y.H. Chen, Immunol. Res. 42 (2008) 210–218.[38] C.A. Pise-Masison, J.N. Brady, Front. Biosci. 10 (2005) 919–930.[39] C. de la Fuente, M.V. Gupta, Z. Klase, K. Strouss, P. Cahan, T. McCaffery, A. Galante, P.

Soteropoulos, A. Pumfery, M. Fujii, F. Kashanchi, Retrovirology 3 (2006) 43.[40] K. Pichler, T. Kattan, J. Gentzsch, A.K. Kress, G.P. Taylor, C.R. Bangham, R. Grassmann,

Blood 111 (2008) 4741–4751.[41] A.K. Kress, G. Schneider, K. Pichler, M. Kalmer, B. Fleckenstein, R. Grassmann, J. Virol.

84 (2010) 8732–8742.[42] T. Hishiki, T. Ohshima, T. Ego, K. Shimotohno, J. Biol. Chem. 282 (2007)

28335–28343.[43] A.M. Pais-Correia, M. Sachse, S. Guadagnini, V. Robbiati, R. Lasserre, A. Gessain, O.

Gout, A. Alcover, M.I. Thoulouze, Nat. Med. 16 (2010) 83–89.[44] A. Criollo, L. Senovilla, H. Authier, M.C. Maiuri, E. Morselli, I. Vitale, O. Kepp, E.

Tasdemir, L. Galluzzi, S. Shen, M. Tailler, N. Delahaye, A. Tesniere, D. De Stefano,A.B. Younes, F. Harper, G. Pierron, S. Lavandero, L. Zitvogel, A. Israel, V. Baud,G. Kroemer,EMBO J. 29 (2010) 619–631.

[45] E.W. Harhaj, S.C. Sun, J. Biol. Chem. 274 (1999) 22911–22914.[46] Z.L. Chu, J.A. DiDonato, J. Hawiger, D.W. Ballard, J. Biol. Chem. 273 (1998)

15891–15894.[47] S.W. Tang, C.Y. Chen, Z. Klase, L. Zane, K.T. Jeang, J. Virol. 87 (2013) 1699–1707.