A clonotypic Vγ4Jγ1/Vδ5Dδ2Jδ1 innate γδ T-cell...

A clonotypic V4J1/V5D2J1 innate T-cell population restrictedto the CCR6CD27 subset.

Item type Article

Authors Kashani, Elham; Föhse, Lisa; Raha, Solaiman; Sandrock,Inga; Oberdörfer, Linda; Koenecke, Christian; Suerbaum,Sebastian; Weiss, Siegfried; Prinz, Immo

Citation A clonotypic V4J1/V5D2J1 innate T-cell populationrestricted to the CCR6CD27 subset. 2015, 6:6477 NatCommun

DOI 10.1038/ncomms7477

Journal Nature communications

Downloaded 18-May-2018 23:32:08

Item License http://creativecommons.org/licenses/by-nc-sa/4.0/

Link to item http://hdl.handle.net/10033/611701

http://dx.doi.org/10.1038/ncomms7477

http://creativecommons.org/licenses/by-nc-sa/4.0/

http://hdl.handle.net/10033/611701

ARTICLE

Received 3 Jul 2014 | Accepted 2 Feb 2015 | Published 13 Mar 2015

A clonotypic Vg4Jg1/Vd5Dd2Jd1 innate gd T-cellpopulation restricted to the CCR6þCD27� subsetElham Kashani1, Lisa Fohse1, Solaiman Raha1, Inga Sandrock1, Linda Oberdorfer1, Christian Koenecke1,2,

Sebastian Suerbaum3, Siegfried Weiss4 & Immo Prinz1

Here we investigate the TCR repertoire of mouse Vg4þ gd T cells in correlation with their

developmental origin and homeostasis. By deep sequencing we identify a high frequency of

straight Vd5Dd2Jd1 germline rearrangements without P- and N-nucleotides within the

otherwise highly diverse Trd repertoire of Vg4þ cells. This sequence is infrequent in

CCR6�CD27þ cells, but abundant among CCR6þCD27� gd T cells. Using an inducible Rag1

knock-in mouse model, we show that gd T cells generated in the adult thymus rarely contain

this germline-rearranged Vd5Dd2Jd1 sequence, confirming its fetal origin. Single-cell analysis

and deep sequencing of the Trg locus reveal a dominant CDR3 junctional motif that completes

the TCR repertoire of invariant Vg4þVd5þ cells. In conclusion, this study identifies an innate

subset of fetal thymus-derived gd T cells with an invariant Vg4þVd5þ TCR that is restricted

to the CCR6þCD27� subset of gd T cells.

DOI: 10.1038/ncomms7477

1 Institute of Immunology, Hannover Medical School, 30625 Hannover, Germany. 2 Department of Haematology, Haemostasis, Oncology and Stem-CellTransplantation, Hannover Medical School, 30625 Hannover, Germany. 3 Institute of Medical Microbiology and Hospital Epidemiology, Hannover MedicalSchool, 30625 Hannover, Germany. 4 Department of Molecular Immunology, Helmholtz Centre for Infection Research, 38124 Braunschweig, Germany.Correspondence and requests for materials should be addressed to I.P. (email: [email protected]).

NATURE COMMUNICATIONS | 6:6477 | DOI: 10.1038/ncomms7477 | www.nature.com/naturecommunications 1

& 2015 Macmillan Publishers Limited. All rights reserved.

mailto:[email protected]

http://www.nature.com/naturecommunications

d T cells use Rag-mediated V(D)J recombination torearrange T-cell antigen receptors (TCRs) consisting of gand d chains. In theory, the potential junctional diversity of

gd TCRs is in the range of 1018, and thus several orders ofmagnitudes higher than that of ab TCR or Ig rearrangements1.However, gd T cells are often regarded as innate T cells that usetheir TCR recombination machinery to generate identical gdTCRs of limited diversity. This perception is based on theoccurrence of a few prominent gd T-cell subsets with no or littleTCR junctional diversity, in which anatomical localization andfunction correlate with invariant gd TCRs2,3. Specifically, themouse skin epidermis contains a specialized gd T-cell populationof dendritic epidermal T cells (DETCs) with a fixed TCRcomposed of invariant Vg5Jg1Cg1 and germline-rearrangedVd1Dd2Jd2 without P- or N-nucleotides (Tonegawanomenclature)4,5. The same canonical Vd1Dd2Jd2 chain isemployed in combination with an invariant Vg6Jg1Cg1TCRchain in interleukin (IL)-17-producing Vg6/Vd1 T cells. TheseVg6/Vd1 cells were initially thought to be restricted to the uterusand the tongue6, but subsequently were also found in most othertissues including the lung7, liver8, dermis9,10, secondary lymphoidorgans11 and intestinal lamina propria12. Finally, IL-4-producingVg1þ gd NKT cells with restricted Vd6Dd2Jd1 junctions andsemi-invariant Vg1Jg4Cg4 junctions are preferentially localizedin the liver and spleen13,14. In contrast, gd T cells circulating inthe blood and secondary lymphoid organs mostly contain eitherVg1 or Vg4 rearrangements and are thought to have highlydiverse TCR repertoires3,15–18.

Recently, gd T-cell populations grouped on the basis of theTCR g-chain usage were included into the ImmGen transcrip-tome database19. The data suggested that gd effector T-cellfunction correlated with gd TCR usage also in Vg4þ T cells. Fetalthymic, and to a lesser extent splenic, Vg4þ T cells wererecognized as gd effector T cells associated with IL-17production19. However, the pool of Vg4þ T cells isheterogeneous and contains both innate cells with IL-17-producing capacity as well as cells that are biased to interferon(IFN)-g production. These two populations can be segregatedaccording to a CCR6þCD27� or CCR6�CD27þ surfacemarker phenotype, respectively20–22. In addition, Vg4þ T cells

also comprise CD27þCD45RBhigh cells, a subset that readilyproduces IFN-g upon stimulation with IL-18 and IL-12 (ref. 23),similar to NK1.1þ gd T cells21. Moreover, the requirements forfinal differentiation into effector cells may vary between gd T-celltypes depending on their ontogeny24. For example, it was recentlyproposed that Vg4þ T cells but not Vg6þ T cells requireextrathymic maturation for imprinting of skin-homing propertiesand acquisition of an IL-17-producing phenotype25.

To address the correlation of Vg4þ TCR and Vg4þ T-cellfunction in more detail, we performed a high-resolution analysisof the mouse gd TCR repertoire. Focusing on Vg4þ T cells,rearranged Trd and Trg loci of the respective subsets weresequenced using 454 high-throughput sequencing technology. Wefound striking differences in functionally different subsets ofVg4þ T cells. Importantly, this study identifies invariant Vg4þ

Vd5þ T cells as a novel innate T-cell population that is abundantonly among CCR6þCD27� gd T cells, which are known fortheir IL-17-producing phenotype10,18,20–22,24,26,27.

ResultsHighly diverse Trd repertoire in Vc1þ and Vc4þ cells. Mostgd T cells in the blood and secondary lymphoid organs display aTCR that comprises either Vg1 or Vg4 rearrangements. In con-trast to fetal Vg5þ DETCs or invariant Vg6þ gd T cells, whichhave a restricted TCR repertoire of very limited diversity, circu-lating Vg1þ or Vg4þ T cells are assumed to be far more poly-clonal18. To investigate their TCR diversity in depth, we sortedthese two major subsets of peripheral gd T cells on the basis of agd T-cell-specific reporter fluorescence28 and co-staining withmonoclonal antibodies (mAbs) directed against their Vg1þ orVg4þ TCR. Next, mRNA of these samples was amplified byrapid amplification of cDNA ends (RACE) using a gene-specificprimer within the first exon of the constant gene segment of theTrd locus to amplify all rearranged VDJ combinations (Fig. 1a).We observed differentially biased recombination of Trd chains inVg1þ and Vg4þ cells. Approximately 60% of the Trd chainsfrom Vg1þ samples contained a Vd6 segment, followed by Vd2,Vd1, Vd7 and Vd12 (Fig. 1b). Trd chains from Vg4þ samplescontained mainly rearrangements of Vd7 segments (B55%),

b

0

Vδ1 Vδ2Vδ3

∗

Vδ4 Vδ5 Vδ6 Vδ7 Vδ8 Vδ9Vδ1

1Vδ1

0Vδ1

2Vδ1 Vδ2

Vδ3∗

Vδ4 Vδ5 Vδ6 Vδ7 Vδ8 Vδ9Vδ1

1Vδ1

0Vδ1

2

10203040506070

c

010203040506070

O

a

V JD C

CDR3

RACEprimer

Gene-specificprimer

Per

cent

age

in th

e V

γ1+ po

ol

Per

cent

age

in th

e V

γ4+ po

ol

Rearranged δ chains in the Vγ1+ pool Rearranged δ chains in the Vγ4+ pool

Figure 1 | Vd gene segment usage among Vc1þ and Vc4þ cells from peripheral lymphoid organs. (a) Schematic presentation of a rearranged Trd locus

and primers for RACE PCR (O: SMARTer anchor oligonucleotide; V: variable, D: diversity, J: joining and C: constant gene segments). (b,c) Results of RACE

PCR product sequencing. Bars indicate proportion of in-frame rearrangements of Vd gene segments within the purified Vg1þ or Vg4þ cells pooled from

the pLN and spleen of three TcrdH2BeGFP mice. (*: Vd3 is a pseudogene). For each Vg pool, at least 22,000 in-frame sequences were analysed. Data are

representative of two independent experiments that gave similar results.

gARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms7477

2 NATURE COMMUNICATIONS | 6:6477 | DOI: 10.1038/ncomms7477 | www.nature.com/naturecommunications



followed by Vd2, Vd5 and Vd6 (Fig. 1c). This extends but islargely consistent with prior studies based on Vd-specific mAbs29.Further analysis of individual CDR3 sequences revealed a highlydiverse repertoire in both Vg1þ and Vg4þ cells (SupplementaryFig. 1). A notable exception to broad Trd polyclonality wasobserved only in Vd5 rearrangements within the pool of Vg4þ

cells, where one Vd5þDd2þ Jd1þ sequence was remarkablyabundant (Supplementary Fig. 1).

Abundant Vd5Dd2Jd1 rearrangements in Vc4þ cells. In orderto further investigate the occurrence of abundant Vd5Dd2Jd1sequence in gd T cells, we applied primers that specificallyamplified CDR3 regions located between Vd5 and Jd1 segments(Fig. 2a). With this independent approach, we confirmed the dataobtained by RACE analysis. On the amino-acid level, B30% ofVd5þ Trd sequences in Vg4þ cells isolated from secondarylymphoid organs showed a unique arrangement of Vd5, Dd2 andJd1 segments, whereas this combination was absent in Vg1þ

T cells, and represented less than 0.3% of Vd5þ Trd sequences inintestinal Vg7þ cells (Fig. 2b). Importantly, the Vd5, Dd2 andJd1 segments were directly rearranged without P- andN-nucleotides (hereafter called germline rearrangements) in morethan 95% of these canonical Trd sequences, while other nucleo-tide sequences coding for the same CDR3 amino-acid sequencewere uncommon (Table 1). Next, we hypothesized that thesecanonical Vd5Dd2Jd1 sequences originated from Vg4þ gdT cells that had developed in the fetal thymus, similar to theinvariant Trd chains found in Vg5þ DETCs and in Vg6þ gdT cells. Their TCRs share canonical N-nucleotide-lackingVd1Dd2Jd2 rearrangements4–6. To this end, we sequenced theVd5 repertoire of Vg4þ gd T cells sorted from either wild-typeTcrdH2BeGFP control mice (wt) or from Indu-Rag1 mice30

crossed with TcrdH2BeGFP mice. In the latter, deficient V(D)Jrecombination had been restored in the adult stage by tamoxifen-induced cre recombinase expression. Only B1% of the canonicalVd5Dd2Jd1 rearrangements were found when only adult gdT-cell development had been possible in Indu-Rag1 mice ascompared with control Vg4þ gd T cells with more than 30% ofsuch sequences (Fig. 2c). These results suggest that the largemajority of canonical Vg4þ /Vd5Dd2Jd1þ gd T cells aregenerated early in ontogeny, presumably in the embryonicthymus.

Canonical rearrangements in CCR6þCD27� cd T cells. Next,we tested whether Vg4þ cells with canonical Vd5Dd2Jd1 rear-rangements were contributing to the pool of IL-17-producingVg4þ gd T cells, as these were recently discovered to developexclusively before birth and subsequently persist in adult mice asself-renewing, long-lived cells11. Such IL-17-producing effectorgd T cells are contained within a population of gd T cellsidentified by a CCR6þCD27� surface marker phenotype20–22.Therefore, we sorted Vg4þ T cells from peripheral lymph nodes(pLNs) and spleen of adult TcrdH2BeGFP mice intoCCR6�CD27þ and CCR6þCD27� subsets, sequenced theirTrd loci and compared them with each other. Clearly, canonicalVd5Dd2Jd1 rearrangements were highly enriched in theCCR6þCD27� subset (Fig. 2d). Thereby, the correspondingCDR3 amino-acid motif ASGYIGGIRATDKLV fromCCR6þCD27� Vg4þ T cells was principally but notexclusively encoded by Vd5Dd2Jd1 rearrangements unmodifiedby P- or N-nucleotides (Fig. 3). Together, these results suggestthat CCR6þCD27� Vg4þ T cells have a distinct TCR repertoirethat comprises canonical Vd5Dd2Jd1þ gd T cells. Thedata further support the hypothesis that IL-17-producing

CCR6þCD27� Vg4þ T cells are principally generated withina functional wave of embryonic gd T-cell development11,18.

Ontogeny and organ distribution of Vd5Dd2Jd1þ T cells. Tofurther explore the potential fetal thymic origin of canonicalVd5Dd2Jd1þ Vg4þ T cells, we sorted Vg4þ T cells derivedfrom the thymus at different stages during ontogeny andsequenced the Trd repertoire of Vd5–Jd1 amplicons (Fig. 4a). Theinvariant Vd5Dd2Jd1 sequence was already abundant in the fetalthymic Trd repertoire of Vg4þ T cells on embryonic day 18 (E18,15% of all Vd5 sequences), but also persisted in juvenile (11–17%)or adult thymi (7% at 4 months; Fig. 4a and SupplementaryFig. 2). These data further support the hypothesis that IL-17-producing gd T cells, in particular with the invariant Vd5Dd2Jd1clonotype, are already generated in the fetal thymus, but laterpersist as resident cells in the juvenile and adult thymus11,24.Moreover, these findings are consistent with a previous ontogenystudy as described in (ref. 31). However, invariant Vd5Dd2Jd1þ

T cells were even more abundant in peripheral lymphoid organsthan in the thymus, suggesting peripheral homeostatic expansionof the subset. Notably, invariant Vd5Dd2Jd1þ Trd sequencesmade up 43% of all Vd5 sequences of Vg4þ T cells in pLNs and27% in the spleen (Fig. 4b). Because TCR repertoire as well as thedevelopmental requirements of Vg4þ T cells vary along withlocation25, we investigated different peripheral anatomical sitesseparately. By deep sequencing of Vd5–Jd1 amplicons weexamined the TCR repertoire of Vg4þ T cells derived fromother organs including the lung, skin and liver (Fig. 4b andSupplementary Fig. 3). It turned out that the invariantVd5Dd2Jd1 sequence also dominated the Trd repertoire ofVg4þ T cells in peripheral tissues such as the skin (27%), lung(15%) and liver (25%), albeit to a lesser extent than in pLNs.Across all samples derived from the pLN and spleen, theVd5Dd2Jd1 clonotype made up B35% of the Vd5 repertoire inVg4þ T cells. Since B10% of Vg4þ T cells used the Vd5segment (as shown by RACE analyses in Fig. 1), these constitute3.5% clonotypic cells of all Vg4þ T cells. Thus, with Vg4þ

T cells making up to 50% of all gd T cells derived from the pLN32,the actual rate of clonotypic invariant Vd5Dd2Jd1þ gd T cells is1.5–2% among all gd T cells. This remarkably high frequency is inthe range of invariant IL-17A-producing Vg6Vd1þ T cells thatconstitute 2–4% among all gd T cells in secondary lymphoidorgans33,34. Nevertheless, only moderate expansion of this subsetin peripheral tissues as compared with the thymus underlinestheir genuine innate nature.

Decreased TCR diversity in CCR6þCD27� Vc4þ T cells.Next, we asked whether TCR diversity in noninvariant Vg4þ

Vd5þ T cells among the CCR6þCD27� subset was also dif-ferent to CCR6�CD27þ Vg4þ T cells (Fig. 5). Within anequally sized pool of in-frame amino-acid sequences obtainedfrom both populations, CCR6�CD27þ Vg4þ T cells had ahigher proportion of unique Vd5 rearrangements that were pre-sent only once in the tested sample (singletons), while CCR6þ

CD27� Vg4þ T cells showed fewer singletons (Fig. 5a). Con-sequently, samples from CCR6þCD27� Vg4þ T cells containeda higher frequency of sequences that were detected several times.In Fig. 5b, in which all sequences are represented according totheir actual frequency among all sequences, such clones wereconsidered as expanded (1–1.99%) or highly expanded (Z 2%).To quantify the TCR diversity of the respective two gd T-cellsubsets, we calculated the effective number of sequences using theShannon index, which considers the number of observed indivi-dual sequences as well their abundance in the repertoire35,36. Itturned out that the CCR6þCD27� subset was three times less

NATURE COMMUNICATIONS | DOI: 10.1038/ncomms7477 ARTICLE




diverse than CCR6�CD27þ cells, and still two times less diversewhen the dominant canonical Vd5Dd2Jd1 sequence was excludedfrom the equation (Fig. 5c). Qualitatively, we observed essentiallyno overlapping Vd5 sequences between two independentlyanalysed samples of CCR6�CD27þ Vg4þ cells. The only

exception was the canonical sequence that was found repeatedly,albeit at low frequency (Fig. 5d, left panel). In contrast, twoindependent samples of CCR6þCD27� Vg4þ T cells showed anoverlap of 29 Trd sequences, beside the canonical Vd5Dd2Jd1sequence (Fig. 5d, right panel). Accordingly, the similarity of two

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

c

b

a

d

0

500

1,000

1,500

2,000

2,500

3,000

7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 247 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

F CDR3

D J1V5

R

C

Vδ5 chain from Vγ1+ pool600

500

400

300

200

100

09

1011

1213 15

14 1617

1819

2021

22

CDR3 AA sequence length

Num

ber

of s

eque

nces

Vδ5 chain from Vγ4+ pool Vδ5 chain from Vγ7+ pool

910

1112

1314

1516

1718

1920

2122

23

CDR3 AA sequence length CDR3 AA sequence length


Num

ber

of s

eque

nces

Num

ber

of s

eque

nces



98 10

1112

1314

1516

1718

1920

2122

Vδ5 chain from Vγ4+ Indu-Rag1 pool Vδ5 chain from Vγ4+ wt pool

3,000

2,000

2,500

1,500

1,000

500

07 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

Vδ5 chain from Vγ4+CCR6–CD27+ wt pool Vδ5 chain from Vγ4+CCR6+CD27– wt pool

Figure 2 | One Vd5Dd2Jd1 sequence is dominant in CCR6þCD27� Vc4þ T cells. (a) Schematic presentation of a rearranged Trd locus showing the

position of representative primers used for amplification of variable Trd regions between Vd5 and Jd1, F: forward primer, R: reverse primer. (b) CDR3

amino-acid sequence length distribution and composition for in-frame rearrangements of Vd5–Jd1 chain in Vg1þ T cells (left panel), and Vg4þ T cells

(middle panel) isolated from a pool of pLN and spleen, or Vg7þ intestinal IELs (right panel), of three TcrdH2BeGFP mice in each subset. (c) In-frame

rearrangements of Vd5–Jd1 chains in Vg4þ T cells pooled from the pLN and spleen of four TcrdH2BeGFP mice (wt; left panel) or four tamoxifen-induced

Indu-Rag1 x TcrdH2BeGFP mice (right panel). Genomic DNA from 10,000 Vg4þ T cells was used as template. For each subset, 5,870 sequences were

analysed. (d) In-frame rearrangements of Vd5–Jd1 chains in CCR6�CD27þ (left panel) versus CCR6þCD27� (right panel) Vg4þ T cells pooled from the

pLN and spleen of three TcrdH2BeGFP mice. cDNA from 4,800 CCR6�CD27þ or CCR6þCD27� Vg4þ cells was used as template. For each subset,

3,552 sequences were analysed. Individual in-frame-rearranged CDR3 amino-acid sequences are separated by colours. Data are representative of at least

two independent experiments that gave similar results.

ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms7477




independent samples, calculated as the Morisita–Horn index, waslow (0.003) for CCR6�CD27þ and high (0.889) forCCR6þCD27� Vg4þ T cells. In conclusion, CCR6þCD27�

Vg4þ T cells, which are known for their IL-17-productioncapacity, display TCR repertoires of limited diversity and aconsiderable TCR sequence overlap between independentsamples derived from individual mice. This is consistent withthe view that these cells develop as a population of prewiredinnate effector cells with limited TCR diversity in the fetal thymusto persist and expand after birth.

The corresponding Vc4 repertoire. To complement the Trdrepertoires, we next determined the respective Vg4 repertoiresof sorted Vg4þ T-cell populations. Sequencing was performedusing a Vg4-specific primer in combination with a consensusprimer amplifying Jg1, Jg2 and Jg3 (Fig. 6). Consistent withprevious findings2,37, overall diversity of the rearranged Trgloci was lower than at Trd loci, and more than 99% of Vg4rearrangements involved Jg1. Analysis of CDR3 amino-acidsequence length distribution and composition of Vg4 chainrepertoires demonstrated an expanded Vg4 motif,SYGXYSSGFHKV. Notably, this dominant motif was abundantin Vg4þ T cells derived from wt and Indu-Rag1 mice (Fig. 6a)as well as in CCR6�CD27þ and CCR6þCD27� Vg4þ T cells

(Fig. 6b). This is in contrast to our findings for the canonicalVd5Dd2Jd1 Trd locus rearrangement, which was exclusivelyabundant in fetal thymus-derived CCR6þCD27� gd T cells.Nevertheless, the Vg4 repertoire of the IL-17-producingCCR6þCD27� subset was even more focused towards theSYGXYSSGFHKV consensus CDR3 sequence thanCCR6�CD27þ Vg4þ T cells (Fig. 6b). Among all Vg4 chainsequences analysed, a leucine residue was most frequently found

Table 1 | Most frequent Vd5 CDR3 nucleotide sequences that encode the canonical Vd5 amino-acid sequence.

Vd5 (50–30) P N1 Dd1 Dd2 (50–30) N2 P Jd1 (50–30) Frequency

A S G Y I G G I R ..T D K L Vgcctcggggtat atcggagggatacgag ctaccgacaaactcgtc Germlinegcctcggggtat atcggagggatacgag ctaccgacaaactcgtc 95–98%gcctcggggtat atcggagggatacg.. g g ctaccgacaaactcgtc 0.9–1.4%gcctcggggtat atcggagggatacgag cg ..accgacaaactcgtc 0.3–0.6%gcctcggggtat atcggagggatacg.. t g ctaccgacaaactcgtc 0.2%gcctcggggtat ata ...ggagggatacgag ctaccgacaaactcgtc 0–0.9%gcctcggg.... ....atat atcggagggatacgag ctaccgacaaactcgtc 0–0.4%gcctcggggta. c atcggagggatacg.. g g ctaccgacaaactcgtc 0–0.3%gcctcggg.... ttat atcggagggatacgag ctaccgacaaactcgtc 0–0.2%

The germline sequences of related gene segments are demonstrated in red. P and N refer to P- and N-nucleotides, respectively.

0 20 40 60 80 100

Vδ5 chains from sorted Vγ4+ cells

wt

Indu-Rag1

CCR6–CD27+

CCR6+CD27−

% of Canonical Vδ5Dδ2Jδ1sequence

Germline-rearrangednucleotide sequence forASGYIGGIRATDKLV

Other rearrangementsfor ASGYIGGIRATDKLV

Figure 3 | Frequency of a canonical Vd5Dd2Jd1 CDR3 sequence. Bar

graphs show percentages of the canonical CDR3 amino-acid sequence

ASGYIGGIRATDKLV among in-frame Vd5 sequences derived from the

indicated Vg4þ T-cell populations. Yellow bars represent dominant

rearrangements of germline-Vd5, -Dd2 and -Jd1 segments without P- and

N-nucleotides. Error bars show s.e.m. Blue bars represent the sum of all

other nucleotide sequences coding for ASGYIGGIRATDKLV. Data are

pooled from two independent experiments that gave similar results.

a

0

% of Canonical Vδ5Dδ2Jδ1 AA sequence among Vγ4+Vδ5+ cells

10 20 30 40 50

b

Vδ5 chains from sorted Vγ4+ cells

ThymusEmbryo18 days

Thymus2 weeks

Thymus4 months

Skin

Lung

Liver

Spleen

pLN

Figure 4 | Frequency of a canonical Vd5Dd2Jd1 CDR3 sequence in

thymus ontogeny and in peripheral tissues. Bar graphs show percentages

of the canonical CDR3 amino-acid sequence ASGYIGGIRATDKLV among

in-frame Vd5 sequences derived from the indicated fluorescence-activated

cell sorting-sorted Vg4þ T-cell populations. (a) Frequency of the canonical

CDR3 sequence in the thymus of day E18 old embryos, 2-week-old pups

and 4-month-old adult mice. (b) Frequency of canonical CDR3 sequence in

the skin, lung, liver, spleen and pLN. Data represent eight individual samples

from one 454-sequencing run.





at the variable position X of this CDR3 motif, followed by serine,arginine, proline and subsequently all other amino acids (Fig. 6c).While a stop codon within the germline Vg4 segment precludestrue germline rearrangements, the two most frequent nucleotidesequences coding for SYGLYSSGFHKV were still rathergermline-like as they both lacked N-nucleotides (Table 2).Together, these two sequences accounted for one-third of allin-frame sequences obtained from the CCR6þCD27� subsetof Vg4þ T cells (Fig. 6d). In conclusion, sequence analyses ofthe corresponding Vg4 repertoire is consistent with the viewthat rearrangement at the g and d TCR loci is differentiallycontrolled. Furthermore, the presence of the semi-invariant Vg4sequences also in CCR6�CD27þ Vg4þ T cells and in T cellsfrom Indu-Rag1 mice would alone not be sufficient for anypotential positive selection of IL-17-producing CCR6þCD27�

subset of Vg4þ T cells.

Invariant Vd5Dd2Jd1 chains pair with a canonical Vc4 chain.Finally, we sought to identify the corresponding TCR g andTCR d chain pairs that constituted the TCR heterodimer of

IL-17-producing CCR6þCD27� Vg4þ T cells. To thisend, we performed single-cell PCR from cDNA of sortedVg4þCCR6þCD27� cells. Of 20 individual T cells withVd5Dd2Jd1 Trd germline rearrangement, 7 had Trgrearrangements coding for the most frequent Vg4 CDR3sequence SYGLYSSGFHKV, 12 displayed other variations ofthe SYGXYSSGFHKV motif and one clone showed a shorterversion of this CDR3, namely SYG_YSSGFHKV (Table 3).Together, these results suggest that the pool of fetal thymus-derived IL-17-producing gd T cells of the CCR6þ lineage con-tains a population of invariant Vg4þ cells with a TCR composedof a germline-rearranged Vd5Dd2Jd1 chain and a canonicalVg4Jg1 chain motif.

DiscussionThis study focused on the correlation between TCR sequenceand effector phenotype in Vg4þ T cells, which constitute aheterogenic population of mouse gd T cells. It comprisedhigh-throughput generation of hundreds of thousands ofsequences of rearranged Trg and Trd genes and constitutes, toour knowledge, the first deep-sequencing report on Trd genes in

c

140

Effe

ctiv

e nu

mbe

r of

seq

uenc

es 120

100

80

60

40

20

0

a

0102030405060708090

100

Per

cent

age

into

tal r

eper

toire

Total repertoire

Highly expanded: ≥ 2%

Expanded: 1 − 1.99%

Frequent: 0.5 − 0.99%

Singleton: single events

Infrequent: < 0.5%,but more than single event

Canonical Vδ5Dδ2Jδ1 sequence

Individual clones

With canonicalVδ5Dδ2Jδ1 sequence

Without canonicalVδ5Dδ2Jδ1 sequence

0

CCR6− CD27

+

CCR6−CD27+

CCR6− CD27

+

CCR6− CD27

+

CCR6+ CD27

−

CCR6+CD27−

CCR6+ CD27

−

CCR6+ CD27

−

102030405060708090

100

Per

cent

age

amon

g al

lin

divi

dual

clo

nes

b

d

29+11

MH: 0.003 MH: 0.889

Vδ5 chain from Vγ4+ poolVδ5 chain from Vγ4+ pool

Figure 5 | TCR diversity of CCR6�CD27þ versus CCR6þCD27� Vc4þ cells. (a) Proportion of 309 individual sequences of CCR6�CD27þ Vg4þ

cells, or 276 individual sequences of CCR6þCD27� Vg4þ cells, among 3,552 Vd5 sequences of each subset. Each individual sequence is counted only

once regardless of abundance. (b) Proportion of total sequences from the same pool as a, considering the abundance. For a,b, data shown are from one

representative of two independent experiments. (c) Diversity measured as ‘effective number of sequences’ (e to the power of the Shannon index) for the

same data set of 3,552 CDR3 amino-acid sequences in each subset, including the canonical sequence (light blue), or after eliminating the canonical

sequence from the repertoires (dark blue). (d) Venn diagrams display overlap between the 100 most frequent CDR3 amino-acid sequences in similar

populations from two independent experiments. Numbers indicate overlapping individual sequences. Similarity between the repertoires from two

independent experiments was calculated using the Morisita–Horn index (MH). The MH index reveals the degree of similarity by analysing individual

sequences considering their frequency among the total repertoire, scoring from 0 for completely dissimilar subsets to 1 for identical subsets.





a

0

500

1,000

1,500

2,000

5

Num

ber

of s

eque

nces

6 7 8 9 10 11 12 13 14 15 16

SYGXYSSGFHKV

5 6 7 8 9 10 11 12 13 14 15 16

b

5 6 7 8 9 10 11 12 13 14 15 160

1,000

2,000

3,000

4,000

5,000

6,000

5 6 7 8 9 10 11 12 13 14 15 16

c

d

0 20 40 60 80 100

SYG YSSGFHKVD

SPRQYK

G

FV

IA

E

W

C

H

T

Vγ4 chains from Vγ4+ wt pool Vγ4 chains from Vγ4+ Indu−Rag1 pool

Vγ4 chains from Vγ4+ CCR6−CD27+ wt pool Vγ4 chains from Vγ4+ CCR6+CD27− wt pool



Vγ4 chains from Vγ4+ cells

wt

Indu-Rag1

CCR6−CD27+

CCR6+CD27−

SYGXYSSGFHKV

Num

ber

of s

eque

nces

Percentage of Vγ4 sequence motif

First frequentnucleotidesequence forSYGLYSSGFHKV

Second frequentnucleotidesequence forSYGLYSSGFHKV

Other nucleotidesequences forSYGLYSSGFHKV

OtherSYGXYSSGFHKV

Nucleotidesequence forSYG_YSSGFHKV

Figure 6 | A frequent motif in the Vc4 repertoire. (a,b) CDR3 amino-acid sequence length distribution and composition of in-frame-rearranged Vg4

chains in (a) Vg4þ gd T cells pooled from the pLN and spleen of four TcrdH2BeGFP or four tamoxifen-induced Indu-Rag1 � TcrdH2BeGFP mice;

10,000 Vg4þ cells and 2,892 in-frame sequences each. (b) CCR6�CD27þ or CCR6þCD27� Vg4þ T cells isolated from the pooled pLN and spleen of

three TcrdH2BeGFP mice; 12,000 Vg4þ cells and 6,888 in-frame sequences each. Individual in-frame-rearranged CDR3 amino-acid sequences are

separated by colours. Sequences containing the SYGXYSSGFHKV motif are shown in green tones within a red box, and the sequence SYG_YSSGFHKV

(lacking X) with 11 amino acids is also shown in green. Data are representatives of three independent experiments. (c) Graphical representation of multiple

sequence alignment for the frequent Vg4 amino-acid motif, SYGXYSSGFHKV, inspired by http://weblogo.berkeley.edu. (d) Percentage of the most frequent

CDR3 sequence, SYGLYSSGFHKV, and the proportion of its related nucleotide sequences (in blue tone), along with percentage of other nucleotide

sequences containing the SYGXYSSGFHKV motif (in light green), and the sequences for SYG_YSSGFHKV (in dark green), within all in-frame Vg4

sequences of the indicated populations. Data are representative of two independent experiments that gave similar results.




http://weblogo.berkeley.edu


any species as well as on mouse Trg genes. In general, our resultsclearly support the view that diversity of rearranged Trd loci ismuch higher than for their Trg counterparts. In particular, themouse Vg4 repertoire contained predominant expandedsequences that were shared between individual mice. Thesefindings are consistent with prior deep-sequencing studies of thehuman TRG repertoire38,39, which described a limited diversity inthe TRG repertoire. There38, the TRG repertoire of peripheralblood gd T cells from three independent donors was dominatedby canonical Vg9JgP sequences. In sharp contrast to the Trglocus, our study showed that the Trd repertoire was highly diversein sorted Vg4þ and Vg1þ T cells from peripheral lymphoidorgans. Most importantly, we revealed a novel invariant subset ofinnate gd T cells, with a TCR composed of a canonical Vg4Jg1motif paired with germline-rearranged Vd5Dd2Jd1. Thisinvariant TCR rearrangement might have evolved underselective pressure for simple and efficient modularrecombination without any N- or P-nucleotides of therespective loci yielding a useful invariant TCR. Furthermore, itis conceivable that the canonical CDR3d loop might interact withputative TCR ligands autonomously and uncoupled from thevariable CDR3g. Such mode of gd TCR–ligand interaction wouldbe reminiscent of gd TCR recognition of the nonclassical majorhistocompatibility complex class I molecules T10 and T22 (refs40,41). While relatively short CDR3d chains can bind to modelantigens such as phycoerythrin (PE) or Cyanine Dye Cy3 (Cy-3)haptens only in combination with a suitable CDR3g partner, arelatively long CDR3d loop such as the canonical Vd5Dd2Jd1rearrangement (15 AA according to the internationalImMunoGeneTics information systems) may be indeed beindicative of CDR3g-independent ligand binding.

In addition, the novel invariant Vg4þVd5þ T-cell populationshares several decisive features with three other prominentinvariant gd T-cell subsets in mice, which are Vg5 DETCs,Vg6þVd1þ cells and semi-invariant Vg1þVd6þ NKT cells andlikewise fetal liver-derived human Vg9þVd2þ cells42. First, all ofthese populations contain straight germline rearrangements ofinvariant canonical TCRs without nontemplated N-nucleotides.Second, they are of fetal or at least perinatal origin. These twofeatures, canonical germline rearrangements and exclusivedevelopment in the fetal thymus, define such gd T-cellpopulations as genuine innate T cells. Invariant Vg4þVd5þ

T cells were remarkably abundant in every sample of Vg4þ Tcells sorted by a CCR6þCD27� surface phenotype associatedwith IL-17-producing capacity and basically absent inCCR6�CD27þ Vg4þ T cells. Importantly, these results werevery reproducible and consistent regardless of whetherindependent samples were derived from genomic DNA orcDNA and whether these were analysed by either RACE orVd5-specific primers. Thus, the canonical Vg4þVd5þ TCRclassifies a hitherto unrecognized conserved subset of innate andpresumably IL-17-producing Vg4þ T cells. Notably, invariantVg4þVd5þ T cells are actually abundant in peripheral lymphoidorgans in the same magnitude as IL-17-producing Vg6þVd1þ

cells33,34. In future studies, it will be interesting to compare thecommon and discrete functions of these two invariant gd T-cellsubsets that are likely innate ‘natural’ IL-17A-producers.

Interestingly, identical Vd5Dd2Jd1 germline rearrangementshad 24 years ago been designated as BID, for BALB/c invariantdelta43. These Trd germline rearrangements were described asfrequent in lungs and lymph nodes of mice with a BALB/c geneticbackground, but are absent in mice with a C57BL/6 genetic

Table 2 | Most frequent Vc4 CDR3 nucleotide sequences that encode the Vc4 amino-acid sequence SYGLYSSGFHKV.

Vc4 (50–30) N P Jc1 (50–30) Frequency

S Y G Stop.. ..S S G F H K Vtcctacggctaaag atagctcaggttttcacaaggta Germlinetcctacggc..... tat atagctcaggttttcacaaggta 61–62%tcctacggc..... ctat atagctcaggttttcacaaggta 25–27%tcctacgg..... t ctat atagctcaggttttcacaaggta 3.8–5%tcctacgg...... gt tat atagctcaggttttcacaaggta 1.5–2.2%tcctacgg...... gctat atagctcaggttttcacaaggta 0.9–1.2%tcctacggc..... ctt t atagctcaggttttcacaaggta 0.6–0.7%

The germline sequences of related gene segments are demonstrated in red. N and P refer to N- and P-nucleotides, respectively.

Table 3 | Single-cell analysis of 20 Vc4 chains pairing with the canonical Vd5Dd2Jd1 chain.

Vc4 N P Jc1 (50–30) AA sequence Observed

tcctacggctaaag atagctcaggttttcacaaggta SYG..SSGFHKV Germlinetcctacggct tat atagctcaggttttcacaaggta SYGLYSSGFHKV Five timestcctacggc..... ctat atagctcaggttttcacaaggta SYGLYSSGFHKV Oncetcctacgg...... gt tat atagctcaggttttcacaaggta SYGLYSSGFHKV Oncetcctacggct.... c at atagctcaggttttcacaaggta SYGSYSSGFHKV Four timestcctacggc..... ga at atagctcaggttttcacaaggta SYGEYSSGFHKV Two timestcctacggc..... ac at atagctcaggttttcacaaggta SYGTYSSGFHKV Two timestcctacggc..... gc at atagctcaggttttcacaaggta SYGAYSSGFHKV Oncetcctacggc..... cc at atagctcaggttttcacaaggta SYGPYSSGFHKV Oncetcctacggc..... gtc t atagctcaggttttcacaaggta SYGVYSSGFHKV Oncetcctacggcta... t t atagctcaggttttcacaaggta SYGYYSSGFHKV Oncetcctacggcta... tagctcaggttttcacaaggta SYG_YSSGFHKV Once

The germline sequences of related gene segments and the variable AA between G3 and Y5 are demonstrated in red. N and P refer to N- and P-nucleotides, respectively.





background43. However, BID chains were later found to begenerated also in C57BL/6 fetal thymocytes at levels similar tothose detected in BALB/c mice44. Hence, it was concluded thatthe presence of BID among resident pulmonary lymphocytes ofBALB/c and of BALB/c � C57BL/6 F1 mice but not in C57BL/6mice was because of positive selection and peripheralexpansion44. Yet, in our study, gd T cells bearing BID, that is,Vd5Dd2Jd1 germline rearrangements, turned out to be anabundant innate Vg4þ T-cell population in C57BL/6 mice. Itis currently unclear, however highly relevant for future work, whythe C57BL/6 mice of our study and the C57BL/6 mice of the BaselInstitute used as negative controls for the original BID descriptionin 1990 would differ in this respect. It is tempting to speculatethat specific genetic variations are responsible for differentialselection and peripheral expansion processes. This might providea remarkable analogy to the seminal observation that a substrainof inbred FVB mice was uniquely depleted of invariant Vg5þ

DETCs45, which led to the discovery of the DETC-selectingdeterminant Skint-1 (refs 46,47). In any case, identification ofpotential cognate ligands of the invariant TCRs from canonicalVg4þVd5þ T cells, as well as Vg5 DETCs, Vg6þVd1þ cellsand semi-invariant Vg1þVd6þ NKT cells, has highest priority.Formerly suggested candidates for the selection of invariantVg4þVd5þ T cells, called BIDþ cells, included the murine heat-shock protein 60 (ref. 48) and a potential self-ligand thatcorrelates with the presence of the endogenous murine leukaemiavirus Mpmv-30 (ref. 49). Furthermore, it needs to be determinedin future studies whether innate invariant Vg4þVd5þ T cellsaccumulate or expand in response to inflammatory stimuli andduring bacterial infection as reported for invariant Vg6þVd1þ

cells12,50–52.The null hypothesis, however, is that no specific antigen is

required for selection and development of canonical innateVg4þVd5þ T cells. This would be consistent with the hypothesisthat the capacity to produce IL-17 cytokines is prewired in asubset of fetal T-cell precursors before and is independent of TCRrearrangement11. In addition, there is considerable evidence thatpositively selecting TCR-triggering in immature fetal gd T-cellprecursors induces differentiation towards the potential toproduce IFN-g while suppressing the IL-17-associated factorsSox13, Sox4 and Rorc32,53–55. Thus, if TCR-specific selection ofinvariant Vg4þVd5þ T cells occurred during thymicdevelopment, they would, in contrast to our observations, berather expected to adopt a CCR6�CD27þ phenotype with thepotential to produce IFN-g.

In conclusion, we establish a novel truly innate gd T-cell subsetof invariant Vg4þVd5þ T cells, which is confined to presumablyIL-17-producing CCR6�CD27þ T cells. Future studies addres-sing the specific physiological functions of these cells within thepLNs and within tissues such as the lung, skin and liver willadvance the understanding of innate lymphocyte and gd T-cellbiology.

MethodsMice. All mice used throughout the study were on a C57BL/6 genetic background.C57BL/6-TcrdH2BeGFP mice were generated at the Centre d’Immunologie deMarseille-Luminy28 and C57BL/6-Indu-Rag1 mice were a kind gift from SiggiWei�30. Indu-Rag1 mice were crossed to TcrdH2BeGFP to obtain tamoxifen-inducible Indu-Rag1 � TcrdH2BeGFP mice11 at the animal facilities of theHelmholtz Centre for Infection Research, Braunschweig. C57BL/6-TcrdH2BeGFPand C57BL/6 wild-type control mice were bred and maintained under specificpathogen-free conditions at the animal facility of the Hannover Medical School,and used at 8–14 weeks of age (16 weeks in case of Indu-Rag1 � TcrdH2BeGFPmice) if not otherwise stated in the figure legends. Animal experiments werecarried out according to the institutional guidelines approved by the localgovernment. This study was performed in accordance with the German AnimalWelfare Law and with the European Communities Council Directive 86/609/EECfor the protection of animals used for experimental purposes.

Cell isolation and cell sorting. pLNs and spleens were mashed, filtered through50-mM nylon meshes and washed with PBS/3% fetal calf serum. Spleen cells weretreated with erythrocyte-lysis buffer before mixing with lymph node cells asdescribed previously56. The liver and lung were cut into small pieces and digestedwith 0.5 mg ml� 1 Collagenase D and 0.025 mg ml� 1 DNAse-1. The digestion wasstopped by adding EDTA to a final concentration of 20 mM. For the isolation ofskin lymphocytes, an area of the back was shaved, the skin was removed and cutinto pieces and digested with 0.5-mg ml� 1 Liberase and 0.025 mg ml� 1 DNAse-1.Digestion was carried out for 45 min at 37 �C and was stopped by adding EDTA toa final concentration of 40 mM. Digested organs were meshed through a 40-mmCellstrainer. Lung lymphocytes were separated using Lympholyte M. Liver and skinlymphocytes were separated with density gradient centrifugation using Percollgradients. MAbs against TCR Vg4 (clone UC3-10A6, PE-conjugated, 1:200) werepurchased from Biolegend or produced in rat hybridoma cell lines (clone 49.2-9,Cy5-conjugated, 1:100). Antibody against TCR Vg1 (clone 2.11, PE-conjugated,1:100) was purchased from Biolegend and antibody against TCR Vg7 (clone F2.67,Cy5-conjugated, 1:50) produced in rat hybridoma cell lines. Antibodies againstTCR b (clone H57-597, PE-Cy7-conjugated, 1:200) and CD27 (clone LG.3A10,PerCP/Cy5.5-conjugated, 1:200) were obtained from Biolegend. Antibodies againstCD196 (CCR6; clone 140706, Alexa Fluor 647-conjugated, 1:100) were purchasedfrom BD Biosciences. Cell suspensions were treated with FcR block (clone 2.4G2)before 20-min staining with mAbs. Antibody-labelled cell populations were sortedfor high-throughput sequencing through the FACSAria IIu flow cytometer (BectonDickinson). In experiments designed to compare two populations, we always sortedthe same amount of cells as a starting population to be able to quantify TCRdiversities. Likewise, single cells were sorted into 96-well plates for single-cell PCRby MoFlo or XDP flow cytometer (Beckman-Coulter). The first rows of the plateswere left empty as negative controls.

Nucleic acid isolation. For isolation of genomic DNA, sort-purified cell fractionswere resuspended in PCR lysis buffer (10 mM Tris (pH 8.4), 50 mM KCl, 2 mMMgCl2, 0.5% Nonidet P-40, 0.5% Tween-20, 400 mg ml� 1 proteinase K) at500 cells ml� 1 and incubated overnight at 50 �C. The proteinase K was inactivatedat 95 �C for 10 min. This protocol was adapted from refs 56–58. Up to 20 ml of theDNA samples were used directly for PCR. Total RNA was isolated from sorted cellpopulations using the RNeasy Mini Kit (QIAGEN) and was reverse-transcribedwith Superscript III (Invitrogen) using Random Primers (Invitrogen).

RACE. To generate unbiased template libraries of rearranged CDR3 regions of theTrd locus, anchor sequence-containing cDNA template was synthesized using theSMARTer RACE cDNA Amplification Kit (Clontech) according to the manu-facturer. RACE PCR was performed with a gene-specific primer located in the Cdgene segment (50-CGAATTCCACAATCTTCTTG-30) and an anchor sequence-specific primer recommended in the kit.

Gene-specific PCR. PCR was performed to generate amplicon libraries ofrearranged TCR sequences. Gene-specific primers (Vg4: 50-TGCAACCCCTACCCATATTTTCT-30 in combination with a consensus primer amplifying Jg1, 2 and3: 50-GTTCCTTCTGCAAATACCTTGTGA-30 or Vd5: 50-AGCACAGCAAGGCCAACAGAACCTT-30 in combination with Jd1: 50-TTGGTTCCACAGTCACTTGGGTTCC-30). Either genomic DNA or cDNA were amplified using 0.375 mM ofeach forward and reverse primers, 50 mM of each dNTP, 1.5 mM MgCl2 and 2.5 UTaq DNA Polymerase (invitrogen) in a 50-ml reaction. Amplifications wereperformed at 94 �C for 4 min, followed by 35 cycles consisting of 30 s at 94 �C, 30 sat 59 �C and 20 s at 72 �C, and finally a single incubation at 72 �C for 5 min.

High-throughput sequencing. Forward and reverse PCR primers for deep-sequencing contained at their 50 ends the respective 454 universal adaptorsequences and multiplex identifier (MID) nucleotides. PCR products were purifiedusing gel extraction with the QIAquick Gel Extraction kit (QIAGEN) and wasquantified with Qubit fluorometer (Invitrogen) using the Quant-iT dsDNA HSAssay kit (Invitrogen). Amplicons were processed with the emPCR—Lib-A SV kit(GS FLX Titanium series; Roche) according to the manufacturer to sequence on454 Genome Sequencer FLX system (Roche). Productive rearrangements andCDR3a regions were defined by comparing nucleotide sequences to the referencesequences from IMGT, the international ImMunoGeneTics information system(http://www.imgt.org)59. Rearrangements were analysed and CDR3a regions weredefined using IMGT/HighV-QUEST60.

Single-cell PCR. For single-cell PCR, CCR6þCD27� Vg4þ single cells weresorted directly into 96 wells. We reverse-transcribed RNA from each sort-purifiedcell to cDNA, and used it as a template to amplify corresponding g and d TCRchains. Single cells sorted in 6-ml PBS were immediately frozen on dry ice andtransferred to � 80 �C. Frozen cells were lysed by heating to 65 �C for 2 min andwere cooled to 4 �C. RNA transcription and a first round of PCR were sequentiallyperformed in one reaction using the OneStep RT–PCR kit (QIAGEN) according tothe manufacturer with some modifications. A combination of specific50- primerpair for Vg4 chain (Vg4 outer: 50-ASCAAGAGATGAGACTGCACAAAT-30 in




http://www.imgt.org


combination with Jg1, 2 and 3: 50-GTTCCTTCTGCAAATACCTTGTGA-30) andVd5 chain (Vd5 outer: 50-TGCGGATTCTCCAAACCCAGATTTA-30 in combi-nation with Jd1: 50-TTGGTTCCACAGTCACTTGGGTTCC-30) was used for thismultiplex reaction. For a 25-ml reaction, the components were as following: 1�buffer, 400 mM of each dNTP, 0.4 mM of each primer and 1-ml OneStepRT–PCR Enzyme mix. Reverse transcription was performed for 30 min at 50 �Cand was directly followed by amplification. PCR activation was initiated at 95 �Cfor 15 min, before 30 cycles, consisting of 30 s at 94 �C, 30 s at 65 �C and 60 s at72 �C, and finally a single incubation at 72 �C for 10 min. Next, second rounds ofPCR with seminested primers (Vg4: 50-TGCAACCCCTACCCATATTTTCT-30

and Vd5 inner: 50-TAGGGACGACACTAGTTCCCATGAT-30) were separatelyperformed for Vg4 and Vd5 chains. For this, 0.2 ml from the first PCR productswere used as template in a 20-ml reaction. The PCR fragments were amplified using0.5 unit AmpliTaq Gold DNA polymerase (Applied Biosystems) in combinationwith GeneAmp 1� PCR puffer II, 2 mM MgCl2, 0.25 mM of each dNTP and0.3 mM of each primer. After 10 cycles, samples positive for Vg4 and Vd5 weredetected using agarose gel electrophoresis. After additional 20 cycles of PCR, gel-extracted (QIAGEN) PCR products of Vg4 and Vd5 chains from each cell wereseparately cloned in pCR4-TOPO vector through the TOPO TA Cloning Kit forsequencing (Invitrogen). These plasmid vectors were isolated via the QIAprep kit(QIAGEN) and sequenced by GATC Biotech (Germany).

Sequence analysis. First, fna files generated by 454 high-throughput sequencingwere converted and partitioned into separate FASTA files using MIDs and gene-specific primer sequence identifiers. Next, these files were uploaded to HighV-QUEST, an online tool available on the IMGT website59, and compared with theIMGT data base. Analysed txt files returned from IMGT were further processedwith Excel to segregate productive and unproductive TCR rearrangements toquantify and merge similar sequences and for further statistical analysis. Viaspecifically selecting only in-frame productive TCR rearrangements, sequences thatcontained insertions and deletions from the 454 platform were routinely excluded.Shannon indices were calculated using Vegan R package (2.14.0). Venn diagramswere produced with VennMaster (0.37.5; ref. 61). All raw sequence data wereuploaded to the NCBI Sequence Read Archive under the SRP accession numberSRP050364.

References1. Davis, M. M. & Bjorkman, P. J. T-cell antigen receptor genes and T-cell

recognition. Nature 334, 395–402 (1988).2. Bonneville, M., O’Brien, R. L. & Born, W. K. Gammadelta T cell effector

functions: a blend of innate programming and acquired plasticity. Nat. Rev.Immunol. 10, 467–478 (2010).

3. Carding, S. R. & Egan, P. J. Gammadelta T cells: functional plasticity andheterogeneity. Nat. Rev. Immunol. 2, 336–345 (2002).

4. Asarnow, D. M. et al. Limited diversity of gamma delta antigen receptor genesof Thy-1þ dendritic epidermal cells. Cell 55, 837–847 (1988).

5. Havran, W. L. et al. Limited diversity of T-cell receptor gamma-chainexpression of murine Thy-1þ dendritic epidermal cells revealed by V gamma3-specific monoclonal antibody. Proc. Natl Acad. Sci. USA 86, 4185–4189(1989).

6. Itohara, S. et al. Homing of a gamma delta thymocyte subset withhomogeneous T-cell receptors to mucosal epithelia. Nature 343, 754–757(1990).

7. Sim, G. K., Rajaserkar, R., Dessing, M. & Augustin, A. Homing and in situdifferentiation of resident pulmonary lymphocytes. Int. Immunol. 6, 1287–1295(1994).

8. Hamada, S. et al. IL-17A produced by gammadelta T cells plays a criticalrole in innate immunity against listeria monocytogenes infection in the liver.J. Immunol. 181, 3456–3463 (2008).

9. Sumaria, N. et al. Cutaneous immunosurveillance by self-renewing dermalgammadelta T cells. J. Exp. Med. 208, 505–518 (2011).

10. Gray, E. E., Suzuki, K. & Cyster, J. G. Cutting edge: Identification of a motile IL-17-producing gammadelta T cell population in the dermis. J. Immunol. 186,6091–6095 (2011).

11. Haas, J. D. et al. Development of interleukin-17-producing gammadelta T cellsis restricted to a functional embryonic wave. Immunity 37, 48–59 (2012).

12. Sheridan, B. S. et al. gammadelta T cells exhibit multifunctional and protectivememory in intestinal tissues. Immunity 39, 184–195 (2013).

13. Gerber, D. J. et al. IL-4-producing gamma delta T cells that express a veryrestricted TCR repertoire are preferentially localized in liver and spleen.J. Immunol. 163, 3076–3082 (1999).

14. Azuara, V., Levraud, J. P., Lembezat, M. P. & Pereira, P. A novel subset of adultgamma delta thymocytes that secretes a distinct pattern of cytokines andexpresses a very restricted T cell receptor repertoire. Eur. J. Immunol. 27,544–553 (1997).

15. Takagaki, Y., Nakanishi, N., Ishida, I., Kanagawa, O. & Tonegawa, S. T cellreceptor-gamma and -delta genes preferentially utilized by adult thymocytes forthe surface expression. J. Immunol. 142, 2112–2121 (1989).

16. Itohara, S., Nakanishi, N., Kanagawa, O., Kubo, R. & Tonegawa, S. Monoclonalantibodies specific to native murine T-cell receptor gamma delta: analysis ofgamma delta T cells during thymic ontogeny and in peripheral lymphoidorgans. Proc. Natl Acad. Sci. USA 86, 5094–5098 (1989).

17. Bonneville, M. et al. Transgenic mice demonstrate that epithelial homing ofgamma/delta T cells is determined by cell lineages independent of T cellreceptor specificity. J. Exp. Med. 171, 1015–1026 (1990).

18. Prinz, I., Silva-Santos, B. & Pennington, D. J. Functional development ofgammadelta T cells. Eur. J. Immunol. 43, 1988–1994 (2013).

19. Narayan, K. et al. Intrathymic programming of effector fates in threemolecularly distinct gammadelta T cell subtypes. Nat. Immunol. 13, 511–518(2012).

20. Ribot, J. C. et al. CD27 is a thymic determinant of the balance betweeninterferon-gamma- and interleukin 17-producing gammadelta T cell subsets.Nat. Immunol. 10, 427–436 (2009).

21. Haas, J. D. et al. CCR6 and NK1.1 distinguish between IL-17A and IFN-gamma-producing gammadelta effector T cells. Eur. J. Immunol. 39, 3488–3497(2009).

22. Martin, B., Hirota, K., Cua, D. J., Stockinger, B. & Veldhoen, M. Interleukin-17-producing gammadelta T cells selectively expand in response to pathogenproducts and environmental signals. Immunity 31, 321–330 (2009).

23. Wencker, M. et al. Innate-like T cells straddle innate and adaptiveimmunity by altering antigen-receptor responsiveness. Nat. Immunol. 15,80–87 (2013).

24. Chien, Y. H., Zeng, X. & Prinz, I. The natural and the inducible:interleukin (IL)-17-producing gammadelta T cells. Trends Immunol. 34,151–154 (2013).

25. Cai, Y. et al. Differential developmental requirement and peripheral regulationfor dermal Vgamma4 and Vgamma6T17 cells in health and inflammation. Nat.Commun. 5, 3986 (2014).

26. Petermann, F. et al. gammadelta T cells enhance autoimmunity by restrainingregulatory T cell responses via an interleukin-23-dependent mechanism.Immunity 33, 351–363 (2010).

27. Chien, Y. H., Meyer, C. & Bonneville, M. gammadelta T cells: first line ofdefense and beyond. Annu. Rev. Immunol. 32, 121–155 (2014).

28. Prinz, I. et al. Visualization of the earliest steps of gammadelta T celldevelopment in the adult thymus. Nat. Immunol. 7, 995–1003 (2006).

29. Pereira, P. et al. Developmentally regulated and lineage-specific rearrangementof T cell receptor Valpha/delta gene segments. Eur. J. Immunol. 30, 1988–1997(2000).

30. Duber, S. et al. Induction of B-cell development in adult mice reveals the abilityof bone marrow to produce B-1a cells. Blood 114, 4960–4967 (2009).

31. Shibata, K. et al. Identification of CD25þ gamma delta T cells as fetal thymus-derived naturally occurring IL-17 producers. J. Immunol. 181, 5940–5947(2008).

32. Gray, E. E. et al. Deficiency in IL-17-committed Vgamma4(þ ) gammadelta Tcells in a spontaneous Sox13-mutant CD45.1(þ ) congenic mouse substrainprovides protection from dermatitis. Nat. Immunol. 14, 584–592 (2013).

33. Paget, C. et al. CD3(bright) signals on gd T cells identify IL-17A-producingVg6Vd1(+) T cells. Immunol. Cell. Biol. 93, 198–212 (2015).

34. Reinhardt, A. et al. CCR7-mediated migration in the thymus controlsgammadelta T-cell development. Eur. J. Immunol. 44, 1320–1329 (2014).

35. Jost, L. Partitioning diversity into independent alpha and beta components.Ecology 88, 2427–2439 (2007).

36. Schleuning, M. et al. Specialization of mutualistic interaction networksdecreases toward tropical latitudes. Curr. Biol. 22, 1925–1931 (2012).

37. Chien, Y. H. & Bonneville, M. Gamma delta T cell receptors. Cell Mol. Life Sci.63, 2089–2094 (2006).

38. Sherwood, A. M. et al. Deep sequencing of the human TCRgamma andTCRbeta repertoires suggests that TCRbeta rearranges after alphabeta andgammadelta T cell commitment. Sci. Transl. Med. 3, 90ra61 (2011).

39. Schumacher, J. A., Duncavage, E. J., Mosbruger, T. L., Szankasi, P. M. & Kelley,T. W. A comparison of deep sequencing of TCRG rearrangements vstraditional capillary electrophoresis for assessment of clonality in T-Celllymphoproliferative disorders. Am. J. Clin. Pathol. 141, 348–359 (2014).

40. Adams, E. J., Strop, P., Shin, S., Chien, Y. H. & Garcia, K. C. An autonomousCDR3delta is sufficient for recognition of the nonclassical MHC class Imolecules T10 and T22 by gammadelta T cells. Nat. Immunol. 9, 777–784(2008).

41. Shin, S. et al. Antigen recognition determinants of gammadelta T cell receptors.Science 308, 252–255 (2005).

42. McVay, L. D. & Carding, S. R. Extrathymic origin of human gamma delta Tcells during fetal development. J. Immunol. 157, 2873–2882 (1996).

43. Sim, G. K. & Augustin, A. Dominantly inherited expression of BID, aninvariant undiversified T cell receptor delta chain. Cell 61, 397–405 (1990).

44. Sim, G. K. & Augustin, A. Dominant expression of the T cell receptor BALBinvariant delta (BID) chain in resident pulmonary lymphocytes is due toselection. Eur. J. Immunol. 21, 859–861 (1991).





45. Lewis, J. M. et al. Selection of the cutaneous intraepithelial gammadeltaþ T cellrepertoire by a thymic stromal determinant. Nat. Immunol. 7, 843–850 (2006).

46. Boyden, L. M. et al. Skint1, the prototype of a newly identified immunoglobulinsuperfamily gene cluster, positively selects epidermal gammadelta T cells. Nat.Genet. 40, 656–662 (2008).

47. Barbee, S. D. et al. Skint-1 is a highly specific, unique selecting component forepidermal T cells. Proc. Natl Acad. Sci. USA 108, 3330–3335 (2011).

48. Kobayashi, N. et al. V delta 5þ T cells of BALB/c mice recognize the murineheat shock protein 60 target cell specificity. Immunology 81, 240–246 (1994).

49. Sim, G. K. & Augustin, A. The presence of an endogenous murine leukemiavirus sequence correlates with the peripheral expansion of gamma delta T cellsbearing the BALB invariant delta (BID) T cell receptor delta. J. Exp. Med. 178,1819–1824 (1993).

50. Mukasa, A., Born, W. K. & O’Brien, R. L. Inflammation alone evokes theresponse of a TCR-invariant mouse gamma delta T cell subset. J. Immunol. 162,4910–4913 (1999).

51. Mukasa, A., Lahn, M., Pflum, E. K., Born, W. & O’Brien, R. L. Evidence that thesame gamma delta T cells respond during infection-induced and autoimmuneinflammation. J. Immunol. 159, 5787–5794 (1997).

52. Murphy, A. G. et al. Staphylococcus aureus infection of mice expands apopulation of memory gammadelta T cells that are protective againstsubsequent infection. J. Immunol. 192, 3697–3708 (2014).

53. Jensen, K. D. et al. Thymic selection determines gammadelta T cell effector fate:antigen-naive cells make interleukin-17 and antigen-experienced cells makeinterferon gamma. Immunity 29, 90–100 (2008).

54. Turchinovich, G. & Hayday, A. C. Skint-1 identifies a common molecularmechanism for the development of interferon-gamma-secreting versusinterleukin-17-secreting gammadelta T cells. Immunity 35, 59–68 (2011).

55. Malhotra, N. et al. A network of high-mobility group box transcription factorsprograms innate interleukin-17 production. Immunity 38, 681–693 (2013).

56. Chennupati, V. et al. Intra- and intercompartmental movement of gammadeltaT cells: intestinal intraepithelial and peripheral gammadelta T cells representexclusive nonoverlapping populations with distinct migration characteristics.J. Immunol. 185, 5160–5168 (2010).

57. Medina, K. L., Strasser, A. & Kincade, P. W. Estrogen influences thedifferentiation, proliferation, and survival of early B-lineage precursors. Blood95, 2059–2067 (2000).

58. Igarashi, H., Gregory, S. C., Yokota, T., Sakaguchi, N. & Kincade, P. W.Transcription from the RAG1 locus marks the earliest lymphocyte progenitorsin bone marrow. Immunity 17, 117–130 (2002).

59. Lefranc, M. P. et al. IMGT, the international ImMunoGeneTics informationsystem. Nucleic Acids Res. 37, D1006–D1012 (2009).

60. Brochet, X., Lefranc, M. P. & Giudicelli, V. IMGT/V-QUEST: the highlycustomized and integrated system for IG and TR standardized V-J and V-D-Jsequence analysis. Nucleic Acids Res. 36, W503–W508 (2008).

61. Kestler, H. A. et al. VennMaster: area-proportional Euler diagrams forfunctional GO analysis of microarrays. BMC Bioinformatics 9, 67 (2008).

AcknowledgementsWe thank Andreas Krueger for discussions and carefully reading of the MS, MathiasHerberg for help with animal caretaking, Sabrina Woltemate and Zharah Fiebig forexcellent technical assistance with 454 sequencing, and Benjamin Wahl for sharing VBAmacros. We acknowledge the assistance of the Cell Sorting Core Facility of the HannoverMedical School. This work was funded by grants from Deutsche ForschungsgemeinschaftDFG-PR727/4-1 (I.P.), DFG-PR727/5-1 (I.P.), DFG SFB 900/B8 (I.P. and C.K.) and DFGSFB 900/Z1 (S.S.). E.K. is a scholar of Hannover Biomedical Research School (HBRS) andZentrum fur Infektionsbiologie (ZIB).

Author contributionsE.K., L.F., S.R. and I.P. designed the studies, performed the experiments and analysed thedata. E.K., L.F., I.S. and L.O. performed cellular and molecular experiments. E.K. and L.F.performed bioinformatics analyses. S.S. contributed to deep-sequence experiments. S.W.provided vital reagents. S.W., C.K. and S.S. contributed to study design. I.P. and E.K.co-wrote the manuscript.

Additional informationSupplementary Information accompanies this paper at http://www.nature.com/naturecommunications.

Competing financial interests: The authors declare no competing financial interests.

Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions.

How to cite this article: Kashani, E. et al. A clonotypic Vg4Jg1/Vd5Dd2Jd1 innate gdT-cell population restricted to the CCR6þCD27� subset. Nat. Commun. 6:6477 doi:10.1038/ncomms7477 (2015).






http://npg.nature.com/reprintsandpermissions

http://npg.nature.com/reprintsandpermissions


A clonotypic Vγ4Jγ1/Vδ5Dδ2Jδ1 innate γδ T-cell...

Documents

Transcript of A clonotypic Vγ4Jγ1/Vδ5Dδ2Jδ1 innate γδ T-cell...