11-Dehydrocorticosterone Causes Metabolic Syndrome, Which Is Prevented when 11β-HSD1 Is Knocked Out...

11-Dehydrocorticosterone Causes MetabolicSyndrome, Which Is Prevented when 11�-HSD1 IsKnocked Out in Livers of Male Mice

Erika Harno, Elizabeth C. Cottrell, Brian G. Keevil, Joanne DeSchoolmeester,Mohammad Bohlooly-Y, Harriet Andersén, Andrew V. Turnbull,Brendan Leighton, and Anne White

Neuroscience Research Group (E.H., A.W.), Faculty of Life Sciences, University of Manchester,Manchester, M13 9PT, United Kingdom; Centre for Endocrinology and Diabetes (E.C.C., B.G.K., A.W.),Faculty of Medical and Human Sciences, University of Manchester, Manchester, M13 9PT, UnitedKingdom; Department of Clinical Biochemistry (B.G.K.), University Hospital of South Manchester,Manchester, M23 9LT, United Kingdom; Cardiovascular and Gastrointestinal (CVGI) iMed (J.D.S., A.V.T.,B.L.), AstraZeneca, Alderley Park, SK10 4TG, United Kingdom; and Transgenic RAD (M.B.-Y., H.A.),Discovery Sciences, AstraZeneca, Mölndal S-431 83, Sweden

Metabolic syndrome is growing in importance with the rising levels of obesity, type 2 diabetes, andinsulin resistance.Metabolic syndromesharesmanycharacteristicswithCushing’s syndrome,whichhasled to investigation of the link between excess glucocorticoids and metabolic syndrome. Indeed, in-creased glucocorticoids from intracellular regeneration by 11�-hydroxysteroid dehydrogenase type 1(11�-HSD1) drives insulin resistance and increases adiposity, but these metabolic changes are assumedto be due to increased circulating glucocorticoids. We hypothesized that increasing the substrate for11�-HSD1 (11-dehydrocorticosterone, 11-DHC) would adversely affect metabolic parameters. Wefound that chronic administration of 11-DHC to male C57BL/6J mice resulted in increased circulatingglucocorticoids, and down-regulation of the hypothalamic-pituitary-adrenal axis. This elevated 11�-HSD1-derived corticosterone led to increased body weight gain and adiposity and produced markedinsulin resistance. Surprisingly liver-specific 11�-HSD1 knockout (LKO) mice given 11-DHC did not showany of the adverse metabolic effects seen in wild-type mice. This occurred despite the 11-DHC admin-istration resulting in elevated circulating corticosterone, presumably from adipose tissue. Mice withglobal deletion of 11�-HSD1 (global knockout) were unaffected by treatment with 11-DHC, having noincreaseincirculatingcorticosteroneandexhibitingnosignsofmetabolic impairment.Takentogether,these data show that in the absence of 11�-HSD1 in the liver, mice are protected from the metaboliceffects of 11-DHC administration, even though circulating glucocorticoids are increased. This impliesthat liver-derived intratissue glucocorticoids, rather than circulating glucocorticoids, contribute sig-nificantly to the development of metabolic syndrome and suggest that local action within hepatictissue mediates these effects. (Endocrinology 154: 3599–3609, 2013)

Metabolic syndrome is increasing in importance as thecluster of component conditions, obesity, type 2 di-

abetes, insulin resistance and hypertension become moreprevalent. Many clinical symptoms of metabolic syn-drome are found in patients with Cushing’s syndrome,implicating glucocorticoids (Gcs) in the etiology of this

disorder (1). However, circulating cortisol levels are notelevated in obesity (2) and do not appear to be increasedin metabolic syndrome (3).

The effect of exogenous Gcs on metabolic parametersin animal models has given conflicting results. In rats, cor-ticosterone administration reduced body weight (4–6),

ISSN Print 0013-7227 ISSN Online 1945-7170Printed in U.S.A.Copyright © 2013 by The Endocrine SocietyReceived April 19, 2013. Accepted June 28, 2013.First Published Online July 5, 2013

Abbreviations: 11-DHC, 11-dehydrocorticosterone; ES, embryonic; Gcs, glucocorticoids;GKO, global knockout; HOMA-IR, Homeostatic Model of Assessment–Insulin Resistance;HPA, hypothalamic-pituitary-adrenal; 11�-HSD1, 11�-hydroxysteroid dehydrogenasetype 1; LKO, liver-specific knockout; OGTT, oral glucose tolerance test; POMC, pro-opi-omelanocortin; WT, wild type.

E N E R G Y B A L A N C E - O B E S I T Y

doi: 10.1210/en.2013-1362 Endocrinology, October 2013, 154(10):3599–3609 endo.endojournals.org 3599

contrary to what would be expected from studies in ad-renalectomized rodents (7, 8). Similar results have beenobserved in mice, where administration of Gcs in drinkingwater led to a loss in body weight, although their insulinlevels were increased (9). However, when a higher dose ofcorticosterone was administered, which increased levels ofcirculating corticosterone to those seen during stress, thisresulted in a metabolic syndrome–like phenotype in themice, with increased body weight, adiposity, and insulinlevels (10).

Although active Gcs (cortisol in humans and cortico-sterone in rodents) in the circulation are primarily derivedfrom the adrenal gland as part of the hypothalamic-pitu-itary-adrenal (HPA) axis, they can also be regeneratedfrom their substrate (cortisone/11-dehydrocorticosterone[11-DHC]) by the enzyme 11�-hydroxysteroid dehydro-genase type 1 (11�-HSD1) (11). This enzyme is highlyexpressed in metabolically active tissues, including liverand adipose tissue (12, 13), where local Gc regenerationand action can drive hepatic insulin resistance (14, 15) andpromote fat accumulation (15).

However, it is not clear whether Gcs regenerated by11�-HSD1 in tissues and acting within these tissues con-tribute to metabolic syndrome or whether the circulatingGcs play a more important role. Therefore, to addressthese mechanisms, we administered the inactive Gc, 11-DHC, to mice with a liver-specific knockout of 11�-HSD1(LKO) and to wild-type (WT) mice. LKO mice treatedwith 11-DHC failed to develop the metabolic syndrome–like phenotype seen in WT mice. This suggests that loss of11�-HSD1 from the liver prevents the development of in-sulin resistance and body weight gain. To prove that 11�-HSD1 was responsible for the tissue-derived corticoste-rone and therefore also the adverse metabolic effects, wetreated 11�-HSD1 global knockout (GKO) mice with 11-DHC. These GKO mice were unaffected by 11-DHC, withno increases in corticosterone. In addition, GKO mice hadno increases in body weight, adiposity, or insulin resis-tance. Taken together, these data highlight the importanceof corticosterone regenerated in liver by 11�-HSD1 andacting within the liver for the metabolic effects of Gcs.

Materials and Methods

Breeding of liver-specific and global 11�-HSD1knockout mice

The HSD11B1 gene targeting vector was prepared from a129/Sv bacterial artificial chromosome clone (ResGen; Invitro-gen, Paisley, United Kingdom). DNA fragments of 5.2, 1.1, and2.6 kb (for 5� homology, deletion, and 3� homology regions,respectively) were cloned into a modified loxP floxed PGKneoplasmid, linearized, and electroporated into R1 mouse embry-

onic (ES) cells. The deletion fragment includes exon 2 (Supple-mental Figure 1A, published on The Endocrine Society’s JournalsOnline web site at http://endo.endojournals.org). Candidate EScell clones were screened by PCR and confirmed by Southernblotting (Supplemental Figure 1B) to identify homologous re-combination. Targeted ES cells were injected into C57BL/6 blas-tocysts and embryos implanted into pseudopregnant B6CBA fe-male mice. Chimeric animals were mated with C57BL/6 toproduce agouti heterozygous animals (F1). For generating 11�-HSD1 conditional (floxed) mice, the heterozygous F1 mice werebred with EIIa-Cre transgenic mice (C57BL/6 background) todelete the loxP flanked PGKneo cassette. The primers used todetect the WT allele (315 bp) or floxed allele (440bp) were asfollows: forward: GATCTGCCCACCTTTGCCTTCT and re-verse: CCATGAGCTTTCCCGCCTTGACA, respectively.

Cre/loxP technology was used to generate mice with liver-specific disruption of the HSD11B1 gene. Male mice heterozy-gous for the conditional HSD11B1 allele and Cre recombinaseunder the control of the rat albumin promoter were mated withfemale homozygous conditional HSD11B1 mice. The resultingCre-positive, 11�-HSD1lox/lox offspring (LKO) and Cre-nega-tive 11�-HSD1lox/lox (WTf/f) were determined by genotyping atweaning. The Cre status of mice was determined in each strainusing the following primers: forward: ATGAAATGCCACCTA-AGTATGG and reverse: CGCCGCATAACCAGTGAAAC, giv-ing a band size of 565 bp in Cre-positive (LKO) and no band infloxed (WTf/f) mice.

For generation of GKO mice, heterozygous F1 males were bredwith Rosa26-Cre transgenic mice (C57BL/6 background) to deletethe loxP floxed region including exon 2 and the neo cassette, and11�-HSD1 null mice for studies were obtained by intercrossing.OffspringweregenotypedatweaningbyPCRusingspecificprimersto detect WT allele (1.6-kb fragment) and null allele (0.6-kb frag-ment), respectively: forward: CAGGTGAGTACCACTGTGTCT-CATTT; reverse: AGTCCGCCTGCAAAGAGATAGATG.

Quantitative mRNA analysisTotal RNA was extracted from brain, liver, and epididymal

adipose tissue using either Trizol reagent (brain and adipose tis-sues; Invitrogen) or RNeasy mini kit (liver; Qiagen, Manchester,United Kingdom), according to the manufacturer’s instructions.Contaminating genomic DNA was removed using a TurboD-NAse kit (Ambion, Paisley, United Kingdom). RNA quantity andintegrity were determined using a NanoDrop (ND1000; Nano-Drop Technologies, Wilmington, Delaware), before one-stepquantitative RT-PCR was carried out using Taqman RNA-to-CT

1-Step Kit (Applied Biosystems, Paisley, United Kingdom) for themeasurement of HSD11B1 mRNA expression. Specific Taqmanprobes were used to amplify a region of exon 1 and 2 of theHSD11B1 gene (Mm01313990_m1), and values were normal-ized to levels of hypoxanthine-guanine phosphoribosyltrans-ferase (Mm00446968_m1), using standard curve analysis.

11�-HSD1 activity assay11�-HSD1 enzyme activity was determined in vitro, adapted

from a method by Hermanowski-Vosatka et al (16), by measur-ing conversion of 3H-cortisone to 3H-cortisol. Tissues (approx-imately 100 mg) were incubated for 10 minutes (liver), 45minutes (brain), or 60 minutes (adipose) in the presence of 3H-cortisone (20 nmol/L, 1 �Ci/mL, specific activity 1.97 GBq/

3600 Harno et al 11-DHC Causes Metabolic Syndrome Endocrinology, October 2013, 154(10):3599–3609

http://endo.endojournals.org

mmol; PerkinElmer, Waltham, Massachusetts) containingDMEM Ham F12 media (Sigma-Aldrich, Dorset, United King-dom) supplemented with 10% fetal calf serum and 1% penicillin/streptomycin in 37°C at 5% CO2. After tissue incubations, me-dium samples were collected for analysis of cortisone to cortisolconversion. Radiolabeled steroids were extracted using ethyl ac-etate; samples were evaporated to dryness under nitrogen andresuspended in mobile phase for HPLC analysis (methanol:H2O,50:50), adapted from Napolitano et al (17). Radiolabeled ste-roids were separated using reversed-phase HPLC, Agilent 1200HPLC using a Kromasil C18 5-�m column, 4.6 mm � 250 mm(Crawford Scientific, Lanarkshire, United Kingdom) with meth-anol:H2O (50:50) at flow rate of 1.5 mL/min. Radioactivity wasmeasured using a flow scintillation analyzer (Radiomatic series500TR; PerkinElmer Analytical Instruments) with FLO-ONEsoftware. 11�-HSD1 activity was expressed as percentage con-version per 100 mg tissue.

Experimental designMale LKO, GKO, and their WT littermates (WTf/f and WT,

respectively) were singly housed throughout the study. Theyweremaintainedona12-hour light, 12-hourdarkcycle (lightsonat 0600 h) and fed standard chow (RM1; Special Diet Services,Essex, United Kingdom) ad libitum. Mice were administered11-DHC (Stratech Scientific, Suffolk, United Kingdom) in drink-ing water at doses of 25 �g/mL (LKO and GKO) or 50 �g/mL(GKO) or vehicle (1% ethanol) for 5 weeks. Mice were weigheddaily and food intake was measured weekly during the study. Onday 29, mice were underwent an oral glucose tolerance test(OGTT). Blood samples were taken by tail venesection in unre-strained mice at 0700 hours (nadir) and 1900 hours (peak) forcorticosterone measurements on day 34, and on day 35 terminalblood samples were taken under terminal CO2/O2 narcosis.These time points are 1 hour into the light phase and 1 hour intothe dark phase at the previously determined nadir and peak ofcorticosterone. Following cervical dislocation, white adipose de-pots (epididymal, mesenteric, and inguinal) and adrenal glandswere excised and weighed. All work was carried out in accor-dance with the UK Home Office Animals (Scientific Procedures)Act 1986 and approved by the local Ethical Review Committee.

OGTTMice were fasted for 16 hours before baseline blood glucose

was measured (Accu-chek glucometer; Roche Diagnostics, WestSussex, United Kingdom) and blood samples (5 �L) were col-lected for insulin measurement (Crystal Chem ELISA, DownersGrove, Illinois). Mice were administered 10 mL/kg of 20% glu-cose by oral gavage (0 min) and glucose measurements weretaken at 20, 40, 60, and 90 minutes. Blood samples were col-lected for insulin measurements at 20 and 40 minutes. All bloodsamples were taken by tail venesection microsampling and, dueto the small sample volume, repeat measurements were made inthe same mice.

Measurement of hormone levelsPro-opiomelanocortin (POMC) levels were measured in ter-

minal plasma samples using a specific two-site ELISA as previ-ously described (18). ACTH was measured in terminal plasmasamples using a commercially available ELISA (Biomerica, Ir-vine, California) as previously described (19). Circulating cor-

ticosterone was measured in tail-prick samples within 1 minuteof disturbance of the cage, to get “prestress” measurements bycommercially available ELISA (Caymen Chemical, Ann Arbor,Michigan).

Data analysisData are expressed as mean � SEM. Statistical analysis was

performed using Prism 5 (GraphPad Software Inc, La Jolla, Cal-ifornia). As appropriate, t tests, one-way or two-way ANOVAswith Bonferonni post-hoc tests were used. P � .05 was consid-ered significant.

Results

11-DHC administration increases corticosterone inWT mice

To determine whether exogenously administered 11-DHC could be converted to corticosterone and enter thecirculation, mice were administered 25 �g/mL or 50�g/mL 11-DHC in drinking water for 5 weeks. These con-centrations of 11-DHC led to dose-dependent increases incirculating corticosterone at both nadir (Figure 1A) andpeak (Figure 1B). Circulating levels of 11-DHC are diffi-cult to measure, as orally administered 11-DHC is metab-olized or excreted within 15 minutes (20). Therefore thedoses of 11-DHC that were chosen resulted in an elevationof circulating corticosterone to levels similar to those seenafter restraint stress (21, 22).

Treatment with 11-DHC down-regulates HPA axisbiomarkers

We investigated the effect of 5 weeks of chronic 11-DHC administration on HPA axis biomarkers. Adminis-tration of either dose of 11-DHC decreased adrenal glandweight in WT mice compared to vehicle controls (Figure1C). Circulating ACTH levels were also decreased in re-sponse to the increased circulating corticosterone levels atboth the nadir (Figure 1D) and the peak (Figure 1E). Theprecursor of ACTH, POMC, was also decreased by 11-DHC in these mice, which is an indication of POMC genesuppression (Figure 1F).

11-DHC can induce a metabolic syndrome–likephenotype in mice

To investigate the effects of 11�-HSD1-derived corti-costerone, metabolic parameters including body weightand glucose and insulin responses were examined afterchronic 11-DHC treatment. By study day 28, WT micetreated with 50 �g/mL 11-DHC had increased percentagebody weight compared to vehicle controls (Figure 2A) andalso had higher body weight gain (Figure 2B). This wascoupled with an increase in food intake (Figure 2C) and an

doi: 10.1210/en.2013-1362 endo.endojournals.org 3601

increase in epididymal fat pad mass (Figure 2D). Similarincreases were also seen in mesenteric and subcutaneousfat pad masses with 50 �g/mL 11-DHC (data not shown).

11-DHC (50 �g/mL) also increased fasting insulin andinsulin excursion from basal levels following oral glucoseadministration (Figure 2E). There was also a trend towardan increase in both these parameters in the 25 �g/mL 11-DHC group (Figure 2E). Homeostatic Model of Assess-ment–Insulin Resistance (HOMA-IR), a measure of insu-lin resistance, was also increased with 50 �g/mL 11-DHC(Figure 2F). There was no difference in glucose excursionduring an OGTT between any of the treatment groups(Figure 2G).

LKO mice do not develop a metabolic syndrome–like phenotype with 11-DHC treatment

As liver is the primary site of 11�-HSD1 expression, wedeveloped a mouse model with 11�-HSD1 knocked-outonly in the liver (LKO; Supplemental Figure 1A). Thesemice had a greater than 90% reduction in mRNA expres-sion and enzyme activity only in liver, with no effect on the

expression or activity in brain or ad-ipose tissue compared to their WTfloxed littermates (WTf/f; Supple-mental Figure 2, A and B). LKO micehad no metabolic or HPA axis phe-notype (Supplemental Figure 2, C–I)and as reported previously (23).

To investigate the role of hepatic11�-HSD1 on metabolic parameterswe chronically administered 11-DHC to LKO mice, which do nothave the capacity to convert 11-DHC to corticosterone in liver, buthave normal 11�-HSD1 activity inother tissues. Unlike WTf/f mice,LKO mice did not have increasedbody weight with 11-DHC treat-ment (Figure 3A). There was nochange in epididymal fat pad mass inLKO mice treated with 25 �g/mL 11-DHC, whereas it was increased in theWTf/f mice (Figure 3B). In addition,neither strain had increased food in-take in response to 25 �g/mL 11-DHC (Figure 3C).

LKO mice were protected fromthe 11-DHC-induced hyperinsulin-emia seen in WTf/f mice. In responseto glucose, LKO mice treated with 25�g/mL 11-DHC were indistinguish-able from vehicle-treated WTf/f (Fig-ure 3D) or LKO mice (Figure 3E).

However, neither WTf/f or LKO mice had increasedHOMA-IR, but there was a trend toward an increase inWTf/f mice only (Figure 3F). Furthermore, neither WTf/f

nor LKO mice had any changes in glucose tolerance duringan OGTT (Figure 3G).

11-DHC administration increases corticosteroneand down-regulates the HPA axis in LKO mice

To investigate whether the lack of metabolic changes inLKO mice were due to an absence of increased circulatingcorticosterone or to inhibition of conversion of 11-DHCto corticosterone only in the liver, we measured circulatingcorticosterone in these mice. Chronic treatment with 25�g/mL 11-DHC increased circulating corticosterone inboth LKO and their WTf/f littermates at both nadir andpeak (Figure 4, A–D). This resulted in concentrations ofcorticosterone in both strains that were similar to levelsseen during stress.

To investigate whether circulating concentrations ofcorticosterone were responsible for the down-regulation

Figure 1. 11-DHC increases circulating corticosterone and decreases HPA axis biomarkers after5 weeks of treatment in WT mice. (A) Circulating corticosterone concentrations measured inplasma samples taken by tail venesection at nadir (7 AM) and (B) at peak (7 PM). (C) Adrenal glandweight. (D) Plasma ACTH levels measured in terminal samples under CO2/O2 narcosis at nadir (7AM) and (E) at peak (7 PM). (F) Circulating POMC levels in terminal samples from WT mice treatedwith vehicle (1% ethanol), 25 �g/mL, or 50 �g/mL 11-DHC. Group sizes were 10–12, exceptACTH, where group sizes were 5–6. Data are expressed as mean � SEM *, P � .05; **, P � .01,***, P � .001 vs vehicle-treated mice.


of the HPA axis, we measured biomarkers of the axis inboth LKO and WTf/f mice. Both strains of mice had asimilar magnitude of down-regulation of the HPA axis inresponse to chronic 11-DHC treatment and in turn raisedcirculating corticosterone. Both LKO and WTf/f mice hada similar reduction in adrenal gland weight (Figure 4E).ACTH was decreased in response to 25 �g/mL 11-DHC inWTf/f mice at both nadir (Figure 4F) and peak (Figure 4G);in LKO mice, however, the decrease in ACTH was onlysignificant at the peak (Figure 4G). POMC was also de-creased in WTf/f and LKO mice treated with 11-DHC (Fig-ure 4H).

Global 11�-HSD1 knock-out mice are unaffectedby 11-DHC treatment

To test the hypothesis that 11-DHC treatment in-creased circulating corticosterone in WT mice solely

through regeneration by 11�-HSD1,we developed 11�-HSD1 GKO.These mice had exon 2 of theHSD11B1 gene removed (Supple-mental Figure 1A) and were shownto have a greater than 92% reductionin 11�-HSD1 mRNA and enzymeactivity in brain, liver, and adiposetissue (Supplemental Figure 3, A andB). The GKO mice were similar inbody weight, glucose, and insulin re-sponses to their WT littermateswhen on a chow diet (SupplementalFigure 3, C–E) as seen previously(24). Global knockout of 11�-HSD1increased adrenal gland weight, as iscommonly observed (19, 25), buthad no effect on other HPA axis pa-rameters including circulating corti-costerone when compared to WT lit-termates (Supplemental Figure 3,F–I).

In the GKO mice, corticosterone(which must be derived from the ad-renal gland) was similar to that in theWT mice. Chronic 11-DHC treat-ment with either 25 �g/mL or 50�g/mL 11-DHC did not increase cir-culating corticosterone at either na-dir (Figure 5A) or peak (Figure 5B).GKO mice also did not have anychanges in HPA axis biomarkerswith either 25 �g/mL or 50 �g/mL11-DHC. There was no change in ad-renal gland weight between the treat-ment groups (Figure 5C) as well as

no difference in circulating ACTH levels at either nadir(Figure 5D) or peak (Figure 5E). POMC was not differentbetween the groups (Figure 5F).

Similar results were seen in metabolic parameters.GKO mice had no increase in body weight (Figure 6A) orepididymal fat pad mass (Figure 6B), nor in mesenteric orsubcutaneous fat pad masses (data not shown). All thetreatment groups had similar food intake (Figure 6C).During an OGTT, vehicle and 11-DHC-treated mice hadsimilar glucose (Figure 6D) and insulin (Figure 6E) re-sponses and a similar HOMA-IR value (Figure 6F).

Discussion

The involvement of Gcs in metabolic syndrome has beenthe subject of much debate. Although circulating Gcs are

Figure 2. Chronic 11-DHC treatment causes a metabolic syndrome–like phenotype in WT mice.(A) Percentage body weight change over 28 days of treatment. (B) Absolute body weightchange. (C) Percentage change in food intake after 4 weeks of 11-DHC treatment compared tobaseline. (D) Relative epididymal fat pad mass as a percentage of body weight (% BWT). (E)Insulin excursion during an OGTT. (F) HOMA of insulin resistance. (G) Glucose excursion duringan OGTT from WT mice treated with vehicle (1% ethanol), 25 �g/mL, or 50 �g/mL 11-DHC.White circle, vehicle; gray square, 25 �g/mL 11-DHC; black triangle, 50 �g/mL 11-DHC. Groupsizes were 10–12. Data are expressed as mean � SEM. *, P � .05; **, P � .01; ***, P � .001 vsvehicle-treated mice or as marked.


not overtly elevated in patients with metabolic syndrome,itmaybe that themethodology isnot sophisticatedenoughfor measuring subtle increases in Gcs in the presence ofintrapatient variation in pulsatility and mild stress-relatedresponses. Nevertheless, an alternative explanation is thatcorticosterone regenerated by the enzyme 11�-HSD1 intissues, and specifically the liver, may be implicated in theetiology of metabolic syndrome. This is supported by the

data presented here showing that deletion of hepatic 11�-HSD1 prevented the metabolic syndrome–like phenotypeassociated with administration of 11-DHC. This lack ofmetabolic phenotype occurred in the presence of increasedcirculating Gcs, indicating that changes in intratissue Gclevels were more important than the alterations in circu-lating levels. In addition, liver 11�-HSD1 does not appearto be the source of raised circulating Gcs in response to

Figure 3. LKO mice are resistant to the metabolic effects of 11-DHC treatment. (A) Percentage body weight change on day 28 in LKO and floxedWT control (WTf/f) mice. (B) Relative epididymal fat pad mass expressed as a percentage of body weight (%BWT). (C) Average weekly food intakeover 4 weeks of 11-DHC treatment. (D) Insulin excursion during an OGTT in WTf/f and (E) LKO mice. (F) HOMA of insulin resistance. (G) Glucoseexcursion during an OGTT in WTf/f and LKO mice treated with vehicle (1% ethanol) or 25 �g/mL 11-DHC. Black circle, vehicle-treated WTf/f; blacksquare, 25 �g/mL treated WTf/f; white circle, vehicle-treated LKO; white square, 25 �g/mL 11-DHC-treated LKO. Group sizes were 11–14. Data areexpressed as mean � SEM. **, P � .01; ***, P � .001 vs vehicle-treated mice of the same genotype.


11-DHC treatment, but instead the most likely origin isadipose tissue. All effects of 11-DHC were absent in GKOmice, indicating the crucial role of 11�-HSD1 in the de-velopment of metabolic syndrome.

The role of Gcs in modulating metabolic parameterspredicts that subtle changes in Gc production or actioncould predispose to metabolic syndrome. Indeed, it is wellknown that Gcs can affect adiposity, promoting increasedfat mass by stimulating adipose tissue hyperplasia,through increased storage of lipids, and hypertrophy, byincreased differentiation of stromal cells and preadi-

pocytes (26), as well as by redistribution to visceral stores.However the increase in fat pad mass and body weight inthis study after chronic 11-DHC treatment in WTf/f miceoccurred in the absence of increases in food intake. There-fore this increase in body weight is most likely due todecreased energy expenditure, although this was not mea-sured in the present study. The reduced energy expendi-ture could be attributed to mild myopathy of the skeletalmuscle and recent studies have shown that Gc adminis-tration can lead to increased markers of muscle atrophytogether with decreased muscle strength (27). An alterna-

Figure 4. LKO mice have elevated circulating corticosterone and a reduction in HPA axis biomarkers after chronic 11-DHC treatment. (A)Circulating corticosterone levels measured in plasma samples taken by tail venesection in floxed WT littermates (WTf/f) mice at nadir (7 AM) and (B)at peak (7 PM), and (C) in LKO mice at nadir (7 AM) and (D) at peak (7 PM). (E) Adrenal gland weight. (F) Plasma ACTH levels measured in terminalsamples after CO2/O2 narcosis at nadir (7 AM) and (G) at peak (7 PM). (H) Circulating POMC measured in terminal samples from WTf/f or LKO micetreated with vehicle (1% ethanol) or 25 �g/mL 11-DHC. Group sizes were 10–14, except for ACTH, where they were 5–7. Data are expressed asmean � SEM. *, P � .05; **, P � .01; ***, P � .001 vs vehicle-treated mice of the same genotype.


tive explanation could be that Gc administration led todecreased activity in the mice (10), which may also ac-count for the increased body weight in the absence of in-creased food intake.

The effect of Gcs on hepatic glucose production (28),where Gcs have direct effects on PEPCK and PGC-1� geneexpression (29), gives clear evidence for increased glucoseoutput, which would be counteracted initially by hyper-insulinemia (30, 31). However, direct effects of Gcs oninsulin receptor signaling pathway elements, such as in-sulin receptor, and insulin receptor substrates1and2,mayalso be responsible for Gc-induced insulin resistance (32,33). Therefore, the action of 11-DHC-derived corticoste-rone on these metabolic parameters is predictable. In ad-dition, in mice where corticosterone administration indrinking water raised circulating corticosterone to levelssimilar to those seen in the present study (10), the mice hadincreased adiposity, body weight gain, and hyperinsulin-emia, consistent with our findings.

The data presented here indicatethat administration of the substratefor 11�-HSD1 is capable of increas-ing corticosterone and generating ametabolic syndrome–like pheno-type. Surprisingly, knockout of 11�-HSD1 specifically in liver was suffi-cient to prevent these metabolicchanges. Despite the circulating cor-ticosterone concentrations in LKOand WTf/f mice being similar, the de-creased 11�-HSD1-derived cortico-sterone within the liver was suffi-cient to prevent body weight gain. Ithas been assumed that the bodyweight effects of Gcs are due tochanges in circulating levels, sup-ported by the fact that adrenalec-tomy reduces circulating corticoste-rone levels and also reverses obesity(7, 8). However, adrenalectomy alsoprevents corticosterone produced inthe adrenal being converted to 11-DHC in the kidney and so removesthe substrate for 11�-HSD1. There-fore, from the data presented here, itappears that it is the intratissue-re-generated corticosterone levels thatare important for body weight gain,rather than the whole-body circulat-ing concentrations. Moreover, adi-pose tissue and brain are the main

sites of 11�-HSD1 activity generally associated with reg-ulation of body weight and adiposity. However, the lackof body weight gain and increased epididymal fat pads inLKO mice treated with 11-DHC suggest corticosteroneregenerated in liver is also important for adipose tissuedeposition and fat accumulation.

In the present study, WT mice treated with 11-DHChad markedly increased fasting insulin and an increasedinsulin response during a glucose challenge. This resultwas consistent with other models where Gc-induced pe-ripheral insulin resistance leads to compensatory �-cellproliferation and increased insulin secretion (30, 31).However, no differences in glucose were observed be-tween control and 11-DHC-treated mice, suggesting thatat the stage examined, �-cell compensation was sufficientto maintain normoglycemia. In addition, the increased in-sulin response was not observed in GKO mice, indicatingthat either the tissue-regenerated corticosterone or the re-sulting increases in circulating corticosterone were re-sponsible for the reduction in insulin sensitivity in WT

Figure 5. 11-DHC treatment does not increase corticosterone or affect HPA axis biomarkers inGKO mice. (A) Circulating corticosterone levels measured in plasma samples taken by tailvenesection at nadir (7 AM) and (B) at peak (7 PM). (C) Adrenal gland weight. (D) Plasma ACTHlevels measured in terminal samples under CO2/O2 narcosis at nadir (7 AM) and (E) at peak (7 PM).(F) Circulating POMC levels in terminal samples from GKO mice treated with vehicle (1%ethanol), 25 �g/mL, or 50 �g/mL 11-DHC. Group sizes were 11–12, except for ACTH, wherethey were 5–6. Data are expressed as mean � SEM.


mice. This was clarified using LKO mice, where circulat-ing corticosterone was increased but there was no changein insulin sensitivity. This provides evidence that 11�-HSD1-derived corticosterone in liver has a role in Gc-induced hyperinsulinemia. Taken together, these data sug-gest that 11-DHC treatment leads to relativehyperinsulinemia in WT mice, and this maintains nor-moglycemia during a glucose challenge.

There is still some uncertainty about the contribution of11�-HSD1-derived Gcs to circulating concentrations ofGcs. In human subjects, deuterated tracers have been usedto measure 11�-HSD1 contribution from liver and adi-pose tissue. These tracers were detected in the portal vein(34, 35), indicating that regenerated Gcs enter the circu-lation at least locally, but whole-body measurements havenot been determined. A mouse model of adipose tissue

Figure 6. Chronic 11-DHC treatment does not adversely affect metabolic parameters in GKO mice. (A) Percentage body weight change over 28days of treatment. (B) Relative epididymal fat pad mass as a percentage of body weight (% BWT). (C) Percentage change in food intake after 4weeks of treatment compared to baseline. (D) Glucose and (E) insulin excursion during an OGTT. (F) HOMA of insulin resistance from GKO micetreated with vehicle (1% ethanol), 25 �g/mL, or 50 �g/mL 11-DHC. White circle, vehicle (1% ethanol); gray square, 25 �g/mL 11-DHC; blacktriangle, 50 �g/mL 11-DHC. Group sizes were 10–12. Data are expressed as mean � SEM.


11�-HSD1 overexpression exhibited no increase inwhole-body circulating corticosterone levels (15). How-ever, increased portal vein concentrations were observed,which could be attributed to increased adipose tissue re-generation and local release. The current study providesevidence that active Gcs can enter the blood, as WT micetreated with 11-DHC have increased plasma corticoste-rone levels in the presence of a decreased HPA axis re-sponse. Furthermore, adipose tissue is most likely to be themain site of production of this 11�-HSD1-derived corti-costerone, as LKO mice still have increased circulatingcorticosterone in response to 11-DHC in the absence ofliver 11�-HSD1. Adipose tissue would be the only otherorgan with sufficient 11�-HSD1 to regenerate the ob-served levels of corticosterone. Thus, an additional keyfinding of the present study is that corticosterone regen-erated from increased 11-DHC levels by 11�-HSD1, mostlikely in adipose tissue, enters the circulation resulting inmarkedly increased plasma levels.

Treatment with 11-DHC led to a reduction in HPA axisactivity in WT mice at least in terms of decreases in adrenalgland weight, circulating POMC, and ACTH. This resultis compatible with increases in circulating corticosteroneleading to down-regulation of the HPA axis via a negativefeedback loop (11). Similarly, LKO and WTf/f mice treatedwith 11-DHC had comparable increases in circulatingcorticosterone and also had parallel reductions in adrenalgland weight, POMC, and ACTH. Vehicle-treated GKOmice had similar corticosterone to WT littermates as iscommonly seen in mice bred on a C57BL/6 background(19, 36–39). This is however different to the original GKOmice bred on a 129 background, where increased circu-lating corticosterone was noted in the knock-out mice (21,25, 40). As expected, in this study 11-DHC did not raisecirculating corticosterone and did not cause a reduction inthe HPA axis in mice with a global knockout of11�-HSD1.

In conclusion, this study has shown that inhibition ofcorticosterone regeneration from 11-DHC by liver 11�-HSD1 can protect mice from glucocorticoid-induced met-abolic syndrome. Chronic administration of 11-DHC ledto pathophysiological symptoms, including increasedbody weight gain, adiposity and food intake, as well ashyperinsulinemia. Studies in mice with knockout of 11�-HSD1 in liver have indicated a key role for liver intratissuecorticosterone in these metabolic changes. Finally, LKOmice treated with 11-DHC had increased circulating cor-ticosterone levels, indicating that the major source of 11�-HSD1-derived corticosterone that enters the circulation isgenerated elsewhere. This novel model suggests that tis-sue-derived Gcs may be important in contributing towhole-body metabolic dysfunction.

Acknowledgments

The authors thank AstraZeneca and the University of Man-chester Biomedical Research Centre for their funding and sup-port during the studies. Grateful thanks are also given to DavidTucker, Lynne Vicary, and the transgenic team at AstraZenecafor the production and genotyping of the 11�-HSD1 KO mice,to Bill Brown and the IPG-Animal Science and Welfare supportteam at AstraZeneca for the generation of experimental results,and to Gemma Convey, Julie Cook, and Usha Chauhan at As-traZeneca for analytical support.

Address all correspondence and requests for reprints to: Prof.Anne White, Faculty of Life Sciences, AV Hill Building, Univer-sity of Manchester, Manchester, M13 9PT, United Kingdom.E-mail: [email protected].

Disclosure Summary: E.H. and A.W. receive grant fundingfrom AstraZeneca. J.D.S., M.B.-Y., H.A., A.V.T., and B.L. areemployees of AstraZeneca. The other authors have no conflictsof interest to declare.

References

1. Anagnostis P, Athyros VG, Tziomalos K, Karagiannis A, Mikhai-lidis DP. Clinical review: the pathogenetic role of cortisol in themetabolic syndrome: a hypothesis. J Clin Endocrinol Metab. 2009;94:2692–2701.

2. Fraser R, Ingram MC, Anderson NH, Morrison C, Davies E, Con-nell JM. Cortisol effects on body mass, blood pressure, and choles-terol in the general population. Hypertension. 1999;33:1364–1368.

3. Gathercole LL, Stewart PM. Targeting the pre-receptor metabolismof cortisol as a novel therapy in obesity and diabetes. J SteroidBiochem Mol Biol. 2010;122:21–27.

4. Shpilberg Y, Beaudry JL, D’Souza A, Campbell JE, Peckett A, Rid-dell MC. A rodent model of rapid-onset diabetes induced by gluco-corticoids and high-fat feeding. Dis Models Mech. 2012;5:671–680.

5. Waters P, McCormick CM. Caveats of chronic exogenous cortico-sterone treatments in adolescent rats and effects on anxiety-like anddepressive behavior and hypothalamic-pituitary-adrenal (HPA) axisfunction. Biol Mood Anxiety Disord. 2011;1:4.

6. Pung T, Zimmerman K, Klein B, Ehrich M. Corticosterone in drink-ing water: altered kinetics of a single oral dose of corticosterone andconcentrations of plasma sodium, albumin, globulin, and total pro-tein. Toxicol Ind Health. 2003;19:171–182.

7. Marchington D, Rothwell NJ, Stock MJ, York DA. Energy balance,diet-induced thermogenesis and brown adipose tissue in lean andobese (fa/fa) Zucker rats after adrenalectomy. J Nutr. 1983;113:1395–1402.

8. Makimura H, Mizuno TM, Roberts J, Silverstein J, Beasley J,Mobbs CV. Adrenalectomy reverses obese phenotype and restoreshypothalamic melanocortin tone in leptin-deficient ob/ob mice. Di-abetes. 2000;49:1917–1923.

9. Coll AP, Fassnacht M, Klammer S, et al. Peripheral administrationof the N-terminal pro-opiomelanocortin fragment 1–28 toPomc�/� mice reduces food intake and weight but does not affectadrenal growth or corticosterone production. J Endocrinol. 2006;190:515–525.

10. Karatsoreos IN, Bhagat SM, Bowles NP, Weil ZM, Pfaff DW, McE-wen BS. Endocrine and physiological changes in response to chroniccorticosterone: a potential model of the metabolic syndrome inmouse. Endocrinology. 2010;151:2117–2127.


mailto:[email protected]

11. Harno E, White A. Will treating diabetes with 11�-HSD1 inhibitorsaffect the HPA axis? Trends Endocrinol Metab. 2010;21:619–627.

12. Cooper MS, Stewart PM. 11�-hydroxysteroid dehydrogenase type1 and its role in the hypothalamus-pituitary-adrenal axis, metabolicsyndrome, and inflammation. J Clin Endocrinol Metab. 2009;94:4645–4654.

13. Hughes KA, Webster SP, Walker BR. 11-�-Hydroxysteroid dehy-drogenase type 1 (11�-HSD1) inhibitors in type 2 diabetes mellitusand obesity. Expert Opin Invest Drugs. 2008;17:481–496.

14. Paterson JM, Morton NM, Fievet C, et al. Metabolic syndromewithout obesity: Hepatic overexpression of 11�-hydroxysteroid de-hydrogenase type 1 in transgenic mice. Proc Natl Acad Sci USA.2004;101:7088–7093.

15. Masuzaki H, Paterson J, Shinyama H, et al. A transgenic model ofvisceral obesity and the metabolic syndrome. Science. 2001;294:2166–2170.

16. Hermanowski-Vosatka A, Balkovec JM, Cheng K, et al. 11�-HSD1inhibition ameliorates metabolic syndrome and prevents progres-sion of atherosclerosis in mice. J Exp Med. 2005;202:517–527.

17. Napolitano A, Voice MW, Edwards CR, Seckl JR, Chapman KE.11�-Hydroxysteroid dehydrogenase 1 in adipocytes: expression isdifferentiation-dependent and hormonally regulated. J SteroidBiochem Mol Biol. 1998;64:251–260.

18. Stovold R, Meredith SL, Bryant JL, et al. Neuroendocrine and ep-ithelial phenotypes in small-cell lung cancer: implications for me-tastasis and survival in patients. Br J Cancer. 2013;108(8):1704–1711.

19. Carter RN, Paterson JM, Tworowska U, et al. Hypothalamic-pitu-itary-adrenal axis abnormalities in response to deletion of 11�-HSD1 is strain-dependent. J Neuroendocrinol. 2009;21:879–887.

20. Tagawa N, Ikariko N, Fukumura K, Kobayashi Y. Development ofan enzyme-linked immunosorbent assay for serum 11-dehydrocor-ticosterone in rat and mouse. Biol Pharmaceut Bull. 2007;30:403–409.

21. Harris HJ, Kotelevtsev Y, Mullins JJ, Seckl JR, Holmes MC. Intra-cellular regeneration of glucocorticoids by 11�-hydroxysteroid de-hydrogenase (11�-HSD)-1 plays a key role in regulation of the hy-pothalamic-pituitary-adrenal axis: analysis of 11�-HSD-1-deficientmice. Endocrinology. 2001;142:114–120.

22. Brunton PJ, Sausbier M, Wietzorrek G, et al. Hypothalamic-pitu-itary-adrenal axis hyporesponsiveness to restraint stress in mice de-ficient for large-conductance calcium- and voltage-activated potas-sium (BK) channels. Endocrinology. 2007;148:5496–5506.

23. Lavery GG, Zielinska AE, Gathercole LL, et al. Lack of significantmetabolic abnormalities in mice with liver-specific disruption of11�-hydroxysteroid dehydrogenase type 1. Endocrinology. 2012;153:3236–3248.

24. Morton NM, Paterson JM, Masuzaki H, et al. Novel adipose tissue-mediated resistance to diet-induced visceral obesity in 11�-hydrox-ysteroid dehydrogenase type 1-deficient mice. Diabetes. 2004;53:931–938.

25. Kotelevtsev Y, Holmes MC, Burchell A, et al. 11�-hydroxysteroiddehydrogenase type 1 knockout mice show attenuated glucocorti-

coid-inducible responses and resist hyperglycemia on obesity orstress. Proc Natl Acad Sci USA. 1997;94:14924–14929.

26. Peckett AJ, Wright DC, Riddell MC. The effects of glucocorticoidson adipose tissue lipid metabolism. Metabolism. 2011;60:1500–1510.

27. Hassan-Smith Z, Morgan SA, Bujalska IJ, et al. 11�-HSD1KO miceare protected from glucocorticoid dependent age-associated muscleatrophy. Endocr Abstr. 2013;31:OC1.3.

28. Khani S, Tayek JA. Cortisol increases gluconeogenesis in humans: itsrole in the metabolic syndrome. Clin Sci (Lond). 2001;101:739–747.

29. Finck BN, Kelly DP. PGC-1 coactivators: inducible regulators ofenergy metabolism in health and disease. J Clin Invest. 2006;116:615–622.

30. Like AA, Chick WL. Pancreatic � cell replication induced by glu-cocorticoids in subhuman primates. Am J Pathol. 1974;75:329–348.

31. Rafacho A, Abrantes JL, Ribeiro DL, et al. Morphofunctional al-terations in endocrine pancreas of short- and long-term dexameth-asone-treated rats. Hormone Metab Res. 2011;43:275–281.

32. Brennan-Speranza TC, Henneicke H, Gasparini SJ, et al. Osteo-blasts mediate the adverse effects of glucocorticoids on fuel metab-olism. J Clin Invest. 2012;122:4172–4189.

33. Morgan SA, Sherlock M, Gathercole LL, et al. 11�-hydroxysteroiddehydrogenase type 1 regulates glucocorticoid-induced insulin re-sistance in skeletal muscle. Diabetes. 2009;58:2506–2515.

34. Stimson RH, Andersson J, Andrew R, et al. Cortisol release fromadipose tissue by 11�-hydroxysteroid dehydrogenase type 1 in hu-mans. Diabetes. 2009;58:46–53.

35. Stimson RH, Andrew R, McAvoy NC, Tripathi D, Hayes PC,Walker BR. Increased whole-body and sustained liver cortisol re-generation by 11�-hydroxysteroid dehydrogenase type 1 in obesemen with type 2 diabetes provides a target for enzyme inhibition.Diabetes. 2011;60:720–725.

36. Densmore VS, Morton NM, Mullins JJ, Seckl JR. 11�-Hydroxys-teroid dehydrogenase type 1 induction in the arcuate nucleus byhigh-fat feeding: a novel constraint to hyperphagia? Endocrinology.2006;147:4486–4495.

37. Yau JL, McNair KM, Noble J, et al. Enhanced hippocampal long-term potentiation and spatial learning in aged 11�-hydroxysteroiddehydrogenase type 1 knock-out mice. J Neurosci. 2007;27:10487–10496.

38. Yau JL, Noble J, Seckl JR. 11�-Hydroxysteroid dehydrogenase type1 deficiency prevents memory deficits with aging by switching fromglucocorticoid receptor to mineralocorticoid receptor-mediatedcognitive control. J Neurosci. 2011;31:4188–4193.

39. Wamil M, Battle JH, Turban S, et al. Novel fat depot-specific mech-anisms underlie resistance to visceral obesity and inflammation in11�-hydroxysteroid dehydrogenase type 1-deficient mice. Diabetes.2011;60:1158–1167.

40. Yau JL, Noble J, Kenyon CJ, et al. Lack of tissue glucocorticoidreactivation in 11�-hydroxysteroid dehydrogenase type 1 knockoutmice ameliorates age-related learning impairments. Proc Natl AcadSci USA. 2001;98:4716–4721.


11-Dehydrocorticosterone Causes Metabolic Syndrome, Which Is Prevented when 11β-HSD1 Is Knocked Out...

Documents

Transcript of 11-Dehydrocorticosterone Causes Metabolic Syndrome, Which Is Prevented when 11β-HSD1 Is Knocked Out...