Differential requirement for the dual functions of β-catenin in embryonic stem cell self-renewal...

ART I C L E S

Differential requirement for the dual functions ofβ-catenin in embryonic stem cell self-renewal andgerm layer formationNatalia Lyashenko1, Markus Winter1, Domenico Migliorini1,3, Travis Biechele2, Randall T. Moon2

and Christine Hartmann1,4

Canonical Wnt signalling has been implicated in mouse and human embryonic stem cell (ESC) maintenance; however, itsrequirement is controversial. β-catenin is the key component in this highly conserved Wnt pathway, acting as a transcriptionaltransactivator. However, β-catenin has additional roles at the plasma membrane regulating cell–cell adhesion, complicating theanalyses of cells/tissues lacking β-catenin. We report here the generation of a Ctnnb1 (β-catenin)-deficient mouse ESC (mESC)line and show that self-renewal is maintained in the absence of β-catenin. Cell adhesion is partially rescued by plakoglobinupregulation, but fails to be maintained during differentiation. When differentiated as aggregates, wild-type mESCs formdescendants of all three germ layers, whereas mesendodermal germ layer formation and neuronal differentiation are defective inCtnnb1-deficient mESCs. A Tcf/Lef-signalling-defective β-catenin variant, which re-establishes cadherin-mediated cell adhesion,rescues definitive endoderm and neuroepithelial formation, indicating that the β-catenin cell-adhesion function is more importantthan its signalling function for these processes.

ESCs are self-renewing, fully pluripotent cells. Descendants fromall three germ layers can be produced in vitro by allowing ESCs todifferentiate as aggregates, known as embryoid bodies1–3. Varioussignalling pathways, including the leukaemia inhibitory factor (LIF),bonemorphogenetic protein 4 andWnt/β-catenin signalling pathways,can maintain the self-renewal capacity of mESCs (refs 4–7). Althoughcytokines required for human ESCs and mESCs differ substantially8–11,activation of Wnt/β-catenin signalling is beneficial for both12. Wnt-ligand binding to its receptor complex, composed of a serpentine recep-tor encoded by the Fzd (Frizzled) gene family and a co-receptor of thelow-density-lipoprotein-related family encoded by the Lrp5 and Lrp6genes, activates the pathway. Ligand binding results in inhibition of thedestruction complex composed of adenomatosis polyposis coli, axin,casein kinase 1α (CK1α) and glycogen synthase kinase 3β (GSK3β)13,14.This changes the fate of β-catenin, which in the absence of Wntligands would be phosphorylated by CK1α and GSK3β, subsequentlyubiquitylated and degraded through the proteosome pathway. Inresponse to Wnt signalling, β-catenin accumulates, translocates to thenucleus and transactivates target genes, such asAxin2, in a complexwithTcf/Lef (lymphoid enhancer-binding factor) transcription factors14.The Wnt/β-catenin requirement in ESC self-renewal has

been addressed, yielding contradictory results15–18. Inhibition of

1Research Institute of Molecular Pathology, Dr. Bohrgasse 7, 1030 Vienna, Austria. 2Institute for Stem Cell and Regenerative Medicine, Department of Pharmacology,Howard Hughes Medical Institute, University of Washington School of Medicine, Campus Box 358056, Seattle, Washington 98109, USA. 3Present address: Laboratoryof Molecular Cancer Biology, University of Leuven, Herestraat 49, 3000 Leuven, Belgium.4Correspondence should be addressed to C.H. (e-mail: hartmann@imp.ac.at)

Received 3 June 2010; accepted 13 April 2011; published online 19 June 2011; DOI: 10.1038/ncb2260

Wnt/β-catenin signalling in mESCs using a dominant-negative1NhLef1 mutant did not affect self-renewal16, whereas the resultsof studies analysing β-catenin-deficient mESCs differed substantially.Two studies, using either a previously19 or a newly establishedβ-catenin-deficient mESC line, reported defects in stemness15,18. Athird study, using Ctnnb1-null mESCs of unclear origin, reported nosuch defects17. In two of the three studies, themESCs, according to theirmolecular characterization, were epiblast-like stem cells15,17 (EpiSCs).Thus, there is clearly a need to establish additional independentβ-catenin-deficient mESCs to shed light on the requirement ofWnt/β-catenin in ESC self-renewal. However, β-catenin is not onlyan essential component of the canonical Wnt pathway, it is also anintegral component of adherens junctions linking classical cadherinsto α-catenin and the actin cytoskeleton20. This second function ofβ-catenin can also be carried out by the related family memberplakoglobin, which is also an essential desmosomal component19,21–23.Given the dual functions of β-catenin, it is difficult to unambiguouslydistinguish between β-catenin requirement in Wnt signalling versuscell adhesion in cellular and developmental processes.Here we established new Ctnnb1-deficient mESCs with a deletion

of exons 3–6, to address the role of β-catenin in mESC self-renewaland differentiation and show that β-catenin is not required for

NATURE CELL BIOLOGY VOLUME 13 | NUMBER 7 | JULY 2011 753

ART I C L E S

TOPFlash

fl/fl fl/fl

5E 3B 1B7G fl/fl fl/fl

Δ/Δ fl/flΔ/Δ

tive e

ressio

7G3B 1B5E

Input IP

Plakoglobin

E-cadherin

β-catenin

Tubulin

650-bp deletion350-bp floxed310-bp wild type

TOPFlash

Wnt3a-CM

FOPFlash

fl/fl Δ/Δ

1 2 3 4 5 6

5E fl/fl7G fl/fl1B Δ/Δ3B Δ/Δ

5E 6E 7G 7A 3A 10C 11A 1B 3B fl/fl +/+

fl/fl Δ/Δfl/Δ 110

β-cate

3.53.02.52.01.51.00.5

0rWnt3a

Wnt3aCMBIO

80706050403020100

tive e

ressio

E-cadherin

Plakoglobin

Tubulin

β-catenin

α-catenin

Δ/Δfl/fl3.5

+–– –– –

––+

–+–

+–– –– –

––+

–+–

d e f g

Figure 1 Characterization of β-cat fl/fl and β-cat1/1 mESCs. (a) GenotypingPCR for β-cat fl/fl (5E, 6E, 7G), β-cat fl/1 (7A, 3A, 10C) and β-cat1/1

(11A, 1B, 3B) individual mESC subclones. (b) Population doublingsof β-cat fl/fl and β-cat1/1 mESC clones grown for five days. Cells werecollected and counted each day (carried out in triplicate). (c) Morphologicalappearance of β-cat fl/fl and β-cat1/1 mESCs. Scale bars, 100 µm.(d) Confocal microscopy images of immunofluorescence staining forβ-catenin, plakoglobin and E-cadherin of β-cat fl/fl and β-cat1/1 mESCcolonies. Scale bars, 20 µm. (e) Western blots for β-catenin, E-cadherin,plakoglobin and tubulin in mESCs. (f) Relative plakoglobin expressionlevels in β-cat fl/fl and β-cat1/1 mESCs (n = 1). (g) Western blot for

E-cadherin, α-catenin, β-catenin and plakoglobin showing input andE-cadherin immunoprecipitates (IP) in β-cat fl/fl and β-cat1/1 mESCs.(h) Histogram showing representative examples of BAR (TOPFlash) andfuBAR (FOPFlash) assays using stable β-cat fl/fl and β-cat1/1 mESC lines.(i) Histogram showing a representative example of a TOPFlash assayof stable BAR β-cat fl/fl and β-cat1/1 mESCs stimulated with rWnt3a,Wnt3aCM or BIO. Error bars ± s.d in b,h and i are calculated on the basisof three measurements. (j) Histogram showing relative Axin2 expressionlevel in β-cat fl/fl and β-cat1/1 mESCs stimulated with Wnt3aCM and BIO.Data are the mean of two biological replicates. Uncropped images of blotsare shown in Supplementary Fig. S8.

self-renewal. Under self-renewal conditions, plakoglobin partiallysubstitutes for the β-catenin cell-adhesion function, but fails to doso during differentiation. To address the extent to which β-cateninsignalling versus cell-adhesion functions are required during in vitrodifferentiation of mESCs, we generated β-catenin-rescued mESCsexpressing either wild-type or a Tcf/Lef-signalling-defective β-cateninvariant. Our findings show that the cell-adhesion function of β-cateninis more important than its signalling function for definitive endodermformation and promotion of neuronal differentiation.

RESULTSCharacterization of β-catenin-deficient mESCsmESCs were derived from β-catenin fl/fl (β-cat fl/fl ; ref. 24) blastocystsand individual feeder-free β-cat fl/fl mESCs were established using LIFand serum. Several Ctnnb1-deficient mESC subclones (referred to asβ-cat1/1) were established from one β-cat fl/fl mESC line (NLβ-12)using adenoviral-mediated Cre recombinase and two were used forfurther characterization (Fig. 1a). The parental β-cat fl/fl mESC line,

NLβ-12, was fully pluripotent, as it gave rise to chimaeric mice andtransmitted through the germ line (Supplementary Fig. S1).β-cat1/1 and β-cat fl/fl mESCs showed an overall similar prolifera-

tion behaviour and colony appearance (Fig. 1b,c). β-cat1/1 coloniesstained negative for β-catenin by immunocytochemistry, whereasE-cadherin and plakoglobin staining and distribution were normal(Fig. 1d). Interestingly, the staining intensity of the latter was increased,as were protein levels (Fig. 1d,e), but transcript levels were unchanged(Fig. 1f). Thus, as in F9 teratocarcinoma stem cells, plakoglobinsubstitutes for the β-catenin cell-adhesion function in mESCs (ref. 22).This was confirmed by immunoprecipitation experiments, showingincreased plakoglobin levels bound to E-cadherin in β-cat1/1 versusβ-cat fl/fl mESCs (Fig. 1g).Plakoglobin has a weak in vitro signalling activity25,26. Therefore, we

analysed Tcf/Lef-mediated gene expression using the sensitive lentiviralluciferase β-catenin-activated reporter (BAR) system, with 12 multi-merized Tcf/Lef binding sites27. Without external stimulation, minimalreporter activity was detected in control and β-cat1/1 mESCs (Fig. 1h).

754 NATURE CELL BIOLOGY VOLUME 13 | NUMBER 7 | JULY 2011

ART I C L E S

On stimulation with the GSK3 inhibitor 6-bromoindirubin-3′-oxime(BIO), recombinant Wnt3a (rWnt3a) or Wnt3a-conditioned medium(Wnt3aCM), BAR-reporter activity was increased in control mESCs,but not detectable above ground levels in β-cat1/1 mESCs (Fig. 1i anddata not shown). Similarly, Axin2 expression levels were increased incontrol, but not inβ-cat1/1, mESCs (Fig. 1j). Stimulation had no effecton plakoglobin levels, nor did junction plakoglobin (Jup) knockdownaffect basal Axin2 levels (data not shown). Thus, our data indicatethat the twofold increase in plakoglobin levels cannot substitute forβ-catenin/Tcf/Lef-mediated signalling activity.

Analysis of stem cell markersNo difference in Oct4 (octamer-binding transcription factor 4),Nanog, Rex1 (also known as Zfp42, zinc finger protein 42) and Sox2(SRY-box containing gene 2) transcriptional levels (Fig. 2a), nor Oct4and Nanog protein levels (Fig. 2b), was observed between β-cat fl/fl

and β-cat1/1 mESCs. Fluorescence-activated cell sorting analysisshowed no difference in SSEA-1 (stage-specific embryonic antigen-1)levels (data not shown). Furthermore, Stat3 (signal transducer andactivator of transcription 3) phosphorylation kinetics was not altered(Fig. 2c). Late passages of β-cat1/1 and β-cat fl/fl mESCs stainedpositive for the self-renewal marker alkaline phosphatase (Fig. 2d) andshowed no differences in colony formation ability (data not shown).Concomitantly, transcriptome analyses of β-cat fl/fl and β-cat1/1

mESCs under standard conditions revealed significant transcriptionaldifferences (P < 0.05) in only five genes besides Ctnnb1; with theexpression levels of l7Rn6 (lethal, Chr 7, Rinchik 6), H19 (H19 fetalliver mRNA) and Rhox5 (reproductive homeobox 5; also knownas Pem) being increased, and those of Trpv6 (transient receptorpotential cation channel, subfamily V, member 6) and Daam1(dishevelled-associated activator of morphogenesis 1) being decreased(Supplementary Table S1).Overall, our data indicate that β-catenin activity is not required

for mESC self-renewal in the presence of LIF and serum. To furtherestablish that β-catenin is dispensable for mESC self-renewal, weexamined β-cat1/1 mESCs under serum-free conditions using the2i+LIF system, inhibiting mitogen-activated kinase kinase (MEK)using PD0325901, and GSK3 using CHIR99021 (ref. 16). β-cat1/1

mESCs were readily established in 2i+ LIF from β-cat fl/fl mESCsusing adenovirally provided Cre recombinase, but exhibited a differentmorphology (Fig. 2e).However,Nanog,Oct4, Sox2 andRex1 expressionlevels were indistinguishable from controls (Fig. 2f). β-cat1/1 mESCsformed colonies also under serum-free conditions in the presence ofPD0325901+LIF or CHIR99021+LIF, but not under PD0325901+CHIR99021 conditions (Supplementary Fig. S2). This establishesthat β-catenin-deficient mESCs are LIF dependent and that theGSK3 inhibitor, CHIR99021, has weak, β-catenin-independent effects.However, β-cat1/1 mESC propagation was possible under serum-freeconditions only in the presence of PD0325901+CHIR99021+LIF orPD0325901+LIF (data not shown).

Minor cell-adhesion defects in mESCsβ-cat1/1 and control mESC colonies had similar morphologies inserum+ LIF (Fig. 1c). However, we noticed subtle differences andanalysed colonies at the ultrastructural level by transmission electronmicroscopy (TEM). This revealed cell-adhesion defects in β-cat1/1

Oct3/4Tubulin

Serum + LIF+LIFp-Stat3Tubulin

Stat3Tubulin

tive e

ressio

fl/flfl/fl Δ/Δ

Δ/Δ Δ/Δ

tive e

ressio

3B Δ/Δ

2i + LIF

5E fl/fl7G fl/fl

1B Δ/Δ5E 7G 3B 1B

Δ/Δfl/fl

β-catenin

Nanog Oct4 Sox2 Rex1

1.41.21.00.80.60.40.2

0 15 30 60 15 30 600 min

Nanog Oct4 Sox2 Rex1

e1.41.21.00.80.60.40.2

Figure 2 Self-renewal markers are not affected in β-cat fl/fl and β-cat1/1

mESCs under different culture conditions. (a) Histogram showing relativeexpression levels of self-renewal marker genes Nanog, Oct4, Sox2 and Rex1in β-cat fl/fl and β-cat1/1 mESCs cultured in serum+LIF. (b) Western blotof β-catenin, Nanog, Oct3/4 and tubulin in β-cat fl/fl and β-cat1/1 mESCscultured in serum+LIF. (c) Western blots for Stat3 and p-(Tyr 705)-Stat3levels in response to LIF stimulation. (d) Alkaline phosphatase stainingon passage 25 β-cat fl/fl and β-cat1/1 mESCs cultured in serum+LIF.(e) Morphology of β-cat fl/fl and β-cat1/1 mESCs cultured in 2i+LIF withoutserum. (f) Histogram showing relative expression levels of self-renewalmarker genes Nanog, Oct4, Sox2 and Rex1 in β-cat fl/fl and β-cat1/1 mESCscultured in 2i+LIF. Data in a and f are the mean of two biological replicates.Scale bars in d and e, 100 µm. Uncropped images of blots are shown inSupplementary Fig. S8.

mESC colonies, with regions lacking cell–cell contacts (Fig. 3a),indicating that plakoglobin cannot fully substitute for β-catenin. Toshow that plakoglobin substitutes in part for β-catenin cell adhesion,we carried out siRNA knockdown (Fig. 3b). Corresponding with thetransfection efficiency, about 85% of β-cat1/1 mESC colonies treatedwith Jup siRNA had a differentiated morphology, with cells beingmore dispersed and flattened. In β-cat fl/fl , only 5% had a differentmorphological appearance, whereas control (Lmna, lamin A/C, siRNAtreated) cultures showed no alterations (Fig. 3c and Supplementary Fig.S3b). Concomitant to the morphological changes, the cell-adhesionmolecules PECAM1 (platelet/endothelial cell-adhesionmolecule 1) andE-cadherin were lost from the membrane and their levels reduced onJup-siRNA treatment (Fig. 3b–d). However, expression of self-renewalmarker genes Nanog, Oct4 and Sox2 was not altered; only proliferationwas slightly decreased (Supplementary Fig. S3c). This shows that inthe absence of β-catenin, plakoglobin is an essential component of celladhesion in mESCs, mediating adhesion through adherens junctionsand desmosomes, and supports previous findings that cell adhesion isnot essential for self-renewal maintenance16,17. Furthermore, our dataestablish no requirement for plakoglobin in self-renewal maintenance.Next, we carried out rescue experiments expressing different β-cateninversions; wild-type (β-catWT), carboxy-terminal truncated (β-cat1C)and a point-mutated version28 (β-catM6) from the Rosa26 (also knownas Gt(ROSA)26Sor) locus in β-cat1/1 mESCs, referred to in thefollowing as β-cat rescWT , β-cat resc1C and β-cat rescM6, respectively. Allthree variants showedmembrane localization (Supplementary Fig. S4a)

ART I C L E S

fl/fl Δ/Δ

1.0 0.9 1.0 1.1 0.50.3

Control siRNA Jup siRNA

– – – –

––––

– ++

++– – –

– – –

∗∗

∗ ∗

rescWT rescΔC

1.0 1.2 1.3 1.0 1.0 0.6

E-cadherin

Plakoglobin

Control siRNA

Jup siRNA

Tubulin

1.0 1.2 1.1 1.0 0.9 0.9

1.0 1.0 0.5 1.0 1.0 0.2

Tubulin

E-cadherin

Control siRNA

Jup siRNA

Plakoglobin

Δ/ΔControl siRNA Jup siRNA

rescWT

rescΔC

Figure 3 Cell–cell adhesion defects in β-cat fl/fl and β-cat1/1 mESCs inthe presence and absence of Jup knockdown. (a) TEM micrographs ofβ-cat fl/fl and β-cat1/1 mESC colonies at low magnification (top; scalebars, 10 µm) and high magnification of the outlined areas (bottom; scalebars, 2 µm), showing non-adherent spaces between adjacent β-cat1/1

mESCs (asterisks), compared with the tight cell–cell adhesion betweenβ-cat fl/fl mESCs. (b) Western blot for E-cadherin, plakoglobin andtubulin on mESC lysates 48h after treatment with control or Jup RNAi.Quantified E-cadherin and plakoglobin protein levels normalized to tubulin

are shown by the numbers below the corresponding lanes. (c) Phasecontrast and confocal microscopy images of immunofluorescence staining(scale bars, 50 µm) for plakoglobin and PECAM1 on control-siRNA- andJup-siRNA-treated mESCs 48h after transfection. Cells stained with DAPIto visualize nuclei. (d) Confocal microscopy images (scale bars, 50 µm) ofimmunofluorescence staining for E-cadherin (bottom: merged images ofE-cadherin and DAPI staining) on control-siRNA- and Jup-siRNA-treatedmESCs 48 h after transfection. Uncropped images of blots are shown inSupplementary Fig. S8.

and restored cell adhesion, as well as membranous localization ofE-cadherin and PECAM1 on treatment with Jup siRNA (Fig. 3c,d).All three interacted with E-cadherin and their presence resulted

in a slight reduction of plakoglobin (Supplementary Fig. S4b). Aslight further reduction was observed using mESCs stably expressingβ-catenin isoforms under the CAG promoter yielding slightly increased

ART I C L E S

levels of β-catenin variants (Supplementary Fig. S4c,d), supportingthe notion that the increased plakoglobin levels are due to proteinstabilization through its recruitment to adherens junctions substitutingfor the loss of β-catenin.

Cell-adhesion defects during embryoid body differentiationThe in vitro differentiation potential of β-cat1/1 mESCs was analysedusing embryoid body differentiation. This revealed cell-adhesiondefects at day 5, reflected by an increase in the number of single cellsand associated with a decrease in the size of β-cat1/1 embryoid bodieswhen compared with the control (Fig. 4a). Controls formed cyst-likestructures at day 9, whereas this did not occur with β-cat1/1 cells(Fig. 4a and data not shown). Concurrent with the appearance ofcell-adhesion defects, plakoglobin levels decreased from day 5 onwardsin β-cat1/1 embryoid bodies, but also in the control (Fig. 4b). Thereduced plakoglobin levels were probably insufficient to compensatefor the lack of β-catenin, whereas in control embryoid bodies β-cateninlevels steadily increased. Embryoid body differentiation proceedednormally in the different Rosa26-rescued mESCs (Fig. 4a). To confirmprevious observations indicating that the β-cat1C and β-catM6 variantsare compromised in Tcf/Lef transcriptional activity28, we generatedthe corresponding stable BAR-reporter lines and activated canonicalWnt signalling using CHIR99021. Surprisingly low reporter activitywas observed in β-cat rescWT and no activity was observed in β-cat resc1C

or β-cat rescM6 mESCs (Fig. 5a). As Rosa26-transgene expression wasrelatively low and given that residual TOPFlash reporter activity hadbeen observed previously28, we also assayed BAR-reporter activity inthe stable CAG-rescue mESCs. Here, the CAG-WTresc cells showeda more pronounced response and residual activity was observed inCAG-M6resc, but not in CAG-1Cresc mESCs (Fig. 5a). Accordingly,the expression level of the endogenous Wnt/β-catenin/Tcf-regulatedgenes Axin2, Cdx1 (caudal type homeobox 1) and brachyury (T ) wasnot upregulated in β-cat1/1 and β-cat -CAGresc1C mESCs (Fig. 5b).Together, our data show that the β-catenin1C variant is defective inTcf/Lef-mediated signalling.Subsequent embryoid body differentiation studies were carried out

using the Rosa26 β-cat rescWT and β-cat resc1C mESCs, because β-catM6

mESCs showed residual Tcf/Lef-mediated activity and transgene-silencing in CAG-rescued mESCs was observed during embryoid bodydifferentiation (data not shown).

Rescue of endoderm and neuronal differentiation defectsGenetic inactivation ofCtnnb1 inmice results in an early developmentalarrest around embryonic day (E)7.0, with defects in anterior–posterioraxis, mesoderm, definitive endoderm and ectoderm formation19,29.Maternal β-catenin is provided until E4.5 and may thereforecompensate for loss of zygotic β-catenin activity, obscuring itsabsolute requirement in early mouse development29,30. Embryoidbody formation from mESCs allows differentiation of descendantsof all three germ layers and resembles, to a large degree, normal post-implantation embryonic development2,3,31,32, enabling us to examinethe in vitro differentiation potential of β-cat fl/fl ,β-cat1/1,β-cat rescWT

and β-cat resc1C mESCs. Expression profiles of the early ectodermalmarker genes Nes (Nestin), Fgf5 (fibroblast growth factor 5) andPax6 (paired box gene 6) were similar in β-cat1/1 and β-cat fl/fl

embryoid bodies during differentiation (Fig. 6a), indicating that

Plakoglobin

Tubulinfl/f

ΔCΔ/

Day 3 Day 5 Day 7

ESCd1 d2 d3 d4 d5 d6 d7 ESC d1 d2 d3 d4 d5 d6 d7

fl/fl Δ/Δ

β-catenin

Plakoglobin

Tubulin

β-catenin

rescΔCrescWT

Figure 4 Morphological appearance and plakoglobin levels of β-cat fl/fl ,β-cat1/1, β-cat rescWT and β-cat resc1C embryoid bodies during differentiation.(a) Phase-contrast images of embryoid bodies at days 3, 5 and 7 ofdifferentiation. Scale bars, 200 µm. Right column, magnified view of singleembryoid bodies of the different genotypes on day 7. (b) Western blot forβ-catenin, plakoglobin and tubulin from mESC and embryoid body lysatesanalysed at indicated time points (d, day) during differentiation. Uncroppedimages of blots are shown in Supplementary Fig. S8.

ectoderm induction occurs normally. Nevertheless, differentiationof β3-tubulin (TuJ)-positive neurons was severely compromisedin β-cat1/1 embryoid bodies (Fig. 6b). In contrast, TuJ-positiveneurons were readily detected in embryoid bodies derived fromβ-cat rescWT and signalling-defective β-cat resc1C mESCs (Fig. 6b).Neuronal differentiation in monolayer cultures revealed that β-cat1/1

mESCs have, in principle, the potential to differentiate into neurons,but when compared with β-cat fl/fl mESCs this is strongly reduced(Fig. 6c). Again differentiation of TuJ-positive neurons was restored inβ-cat rescWT and signalling-defectiveβ-cat resc1C cells (Fig. 6c).Mesendodermal marker gene, Mixl1 (Mix1 homeobox-like 1),

expression was absent in β-cat1/1 embryoid bodies, but restoredin β-cat rescWT and signalling-defective β-cat resc1C embryoid bodies(Fig. 7a). Similarly, expression of the endodermal marker genes Foxa2(forkhead box A2) and Gata6 (GATA binding protein 6) was absentin β-cat1/1 embryoid bodies (Fig. 7a), but restored in β-cat rescWT

and β-cat resc1C embryoid bodies (Fig. 7a and Supplementary Fig. S5).Loss and rescue of endoderm formation in embryoid bodies derivedfrom β-cat1/1, β-cat rescWT and β-cat resc1C mESCs, respectively, wasconfirmed by immunofluorescence staining for the endodermal

ART I C L E S

tive e

ressio

tive e

ressio

tive e

ressio

P = 0.016

P = 0.432P = 0.003

P = 0.082

TOPFlash FOPFlash

Brachyury (T )

CHIR99021

pCAGGS

160140120100806040200

109876543210

181614121086420

P = 0.111P = 0.39

P = 0.44

P = 0.21P = 0.043

CHIR99021PBS

TOPFlash FOPFlash

35302520151050

9876543210

Rosa26

Axin2 Cdx1

fl/fl Δ/Δ

Figure 5 Analyses of Tcf/Lef-mediated transcriptional activity. (a) Histogramshowing representative examples of TOPFlash (BAR reporter) and FOPFlash(fuBAR reporter) activity in stable mESCs expressing rescue constructs frompGAGGS or the Rosa26 locus under unstimulated (PBS) and stimulated(3 µM CHIR99021) conditions. Error bars ± s.d. are calculated on thebasis of three measurements. (b) Histogram showing relative expressionof endogenous β-catenin/Tcf-regulated genes Axin2, brachyury (T ) andCdx1 on treatment with PBS or CHIR99021 (3 µM). Data are mean ± s.d.of three biological replicates. P values were calculated using a two-tailedStudent t -test.

markers Gata4, Foxa2 and Cxcr4 (chemokine (C–X–C motif) receptor4; Fig. 7b,c). In β-cat fl/fl embryoid bodies, endodermal cells stainedpositive for Gata4, E-cadherin, and Cxcr4 and localized at the outerregion associated with a fibronectin-positive basement membrane(Fig. 7b). In β-cat1/1 embryoid bodies, the level of Gata4 stainingwas severely reduced, staining for fibronectin and E-cadherin wasvery dispersed and the Cxcr4-positive cells did not localize to theouter layer (Fig. 7b). In contrast, an outer layer with localizedGata4, E-cadherin and Cxcr4 staining was restored in β-cat rescWT

and β-cat resc1C embryoid bodies (Fig. 7b). The presence of Cxcr4indicates that definitive endoderm is being formed33. Foxa2-positivecells were detected in dissociated embryoid bodies derived fromβ-cat fl/fl , β-cat rescWT and β-cat resc1C mESCs, but not in embryoid

fl/fl Δ/Δ rescWT rescΔC

fl/fl Δ/Δ

HprtESC d2 d4 d6 d8 d2 d4 d6 d8ESC

Fgf5Nestin

Figure 6 Neuroectodermal differentiation potential of β-cat fl/fl , β-cat1/1,β-cat rescWT and β-cat resc1C embryoid bodies. (a) RT–PCR analyses ofectodermal marker genes Fgf5, Nes and Pax6 in mESCs and duringthe embryoid body differentiation time course of β-cat fl/fl and β-cat1/1

mESCs. (b,c) Immunofluorescence staining for TuJ-positive neurons (b) indifferentiated embryoid bodies at day 16, and in monolayer cultures ofmESCs at day 14 (c). Nuclei are stained for DAPI (blue). Scale bars, 50 µm.Uncropped images of blots are shown in Supplementary Fig. S8.

bodies derived from β-cat1/1 mESCs (Fig. 7c). Thus, our data indicatethat Tcf/Lef-mediated signalling activity is not required for endodermformation. Our data also indicate that the cell-adhesion function ofβ-catenin promotes neuron formation in vitro. In agreement with thein vitro data, we found that in vivo β-cat rescWT and β-cat resc1C mESCsshow a higher chimaeric embryonic contribution when comparedwith β-cat1/1 mESCs and that they can in principle contribute toall three germ layers, but were preferentially found in endodermal andectodermal layers (see Supplementary Fig. S6).

DISCUSSIONCanonical Wnt-signalling activation has been implicated in pluripo-tency and self-renewal maintenance in human ESCs and mESCs(refs 7,34–36). Nevertheless, its absolute requirement for mESCsself-renewal is still unclear. Whereas nuclear localization of β-cateninhas been reported in wild-type mESCs under standard conditions15,37,we and others failed to observe nuclear β-catenin or significantTcf/Lef-mediated transcriptional activity in wild-type ESCs (refs 7,15,34,38). However, the possibility of β-catenin having positiveeffects on ESC self-renewal in a Tcf/Lef-independent manner re-mains. This possibility was favoured in a recent study reportingthat β-cat−/− mESCs, generated previously19, showed defects instemness marker expression15. This β-cat−/− mESC line, however,exhibits an epiblast-like gene expression profile15. In contrast, theβ-cat1/1 mESCs described here, generated from fully pluripotentβ-cat fl/fl mESCs in vitro by Cre-mediated recombination, showedno alteration of self-renewal markers under serum and serum-freeconditions and only few differences by transcriptome analysis. Ourdata are in accordance with data in the accompanying study39, whichindependently established Ctnnb1-deficient mESCs. Collectively, ourdata show that mESC self-renewal does not require endogenousβ-catenin activity and as we have shown also does not depend on

ART I C L E S

d2ESC d4 d6 d8

herin/D

tive e

ressio

/Cxcr4

fl/flΔ/Δ

rescΔC

120100806040200

d2ESC d4 d6 d8

35302520151050

350300250200150100500

Gata6 Foxa2 Mixl1β-

resc wild type

d2ESC d4 d6 d8

Δ/Δ rescWT rescΔCfl/fl

Figure 7 Mesendodermal differentiation potential of β-cat fl/fl , β-cat1/1,β-cat rescWT and β-cat resc1C embryoid bodies. (a) Histograms showing relativeexpression levels of endodermal marker genes Gata6, Foxa2 and Mixl1 inmESCs and during embryoid body differentiation. Data are the mean oftwo biological replicates. (b) Immunofluorescence staining for β-catenin,Gata4/fibronectin (Fibro), E-cadherin and E-cadherin (E-cad)/Cxcr4 indifferentiated embryoid bodies at day 8. All cells were also stained withDAPI. Scale bars, 100 µm. (c) Immunofluorescence staining for Foxa2 onplated embryoid bodies at day 16. Cells were counterstained with DAPI.Scale bars, 50 µm.

plakoglobin in the absence of β-catenin. Furthermore, our two studiesdemonstrate that β-catenin-deficient cultures are LIF-dependent. Thisis in contrast to a recent report showing that β-cat−/− mESCsmaintainself-renewal in the absence of LIF, but depend on activin17. Activindependence is one of the hallmarks of EpiSCs, which express Oct4, butare LIF independent40. Thus, the β-cat−/− mESCs used in ref. 17 areprobably EpiSCs, explaining the differences in LIF dependency.In addition to its central role in Wnt signalling, β-catenin is

a component of adherens junctions connecting classical cadherinsthrough α-catenin to the actin cytoskeleton20. Plakoglobin can alsobind to cadherins and participate in adherens junctions20,41,42 andhas been shown to substitute there for β-catenin19,22,23,29. As inF9 teratocarcinoma cells22, membranous plakoglobin levels wereincreased in β-catenin-deficient mESCs. This was not associated withaltered transcription levels, ruling out a transcriptional feedbackand supporting a post-transcriptional mechanism through prolongedprotein stability due to augmented recruitment of plakoglobin toadherens junctions in the absence of β-catenin. Post-transcriptionalregulation of protein levels seems a common mechanism in cell

adhesion; for example α-catenin regulation by E-cadherin43. However,our study shows that plakoglobin cannot fully compensate for thelack of β-catenin. In agreement with the observation that α-cateninlevels influence the strength of E-cadherin bonds between cells44–46, wepropose that the α-catenin reduction in the E-cadherin–plakoglobincomplexes weakens mESC cell adhesion and furthermore ourdata indicate that plakoglobin and β-catenin may bind α-catenindifferentially. In accordance with other in vivo findings19,47–50, butcontrary to in vitro findings25,26,51, we found no evidence thatplakoglobin participates in Tcf/Lef-mediated signalling activity.Embryos lacking zygotic β-catenin activity show defects in

anterior–posterior patterning, mesoderm and definitive endodermformation19 and increased levels of ectodermal apoptosis29. Blastomereadhesion defects become apparent on removal of maternal β-catenin52,which is not substituted for by plakoglobin, as it is not present at earlypre-implantation stages, and associates with E-cadherin and α-cateninonly from the early morula stage onwards30. Wnt/β-catenin pathwayactivation occurs in the embryo at around E6.5 and in embryoidbodies around day 3–4 (refs 32,53). Thus, maternal β-catenin mayparticipate in cell adhesion in embryos lacking zygotic β-catenin,but not in canonical Wnt signalling. β-catenin-deficient embryoidbodies exhibited adhesion defects during differentiation, which wereassociated with plakoglobin downregulation. Furthermore, mutantembryoid bodies showed, similar to what has been observed inCtnnb1-mutant embryos, defects in endoderm induction, whereasectoderm induction occurred normally. The rescue of inductionand formation of definitive endoderm in embryoid bodies derivedfrom β-cat resc1C mESCs indicates that the cell-adhesion function ofβ-catenin is required at least for endoderm formation. Mesodermformation was not rescued in β-cat resc1C or in control β-cat rescWT

mESCs, as judged by the absence of brachyury (T ) expression (data notshown). This is probably due to the moderate Rosa26 transgene levels,which are probably too low to allow participation in signalling. Byaddition of the CAG promoter54 we augmented transgene expressionfrom the Rosa26 locus and rescued brachyury (T ) expression inembryoid bodies derived from Rosa26-CAG β-cat rescWT , but not fromRosa26-CAG β-cat resc1C mESCs (Supplementary Fig. S5). This is inagreement with the notion that brachyury (T ) expression is undertranscriptional β-catenin control55,56. Thus, mesoderm induction maynot require β-catenin cell-adhesion function to the same extent as itstranscriptional activity.The fact that loss of β-catenin affected neuronal differentiation

was unexpected, given that ectoderm induction occurred normally inβ-catenin-deficient embryoid bodies and in vivo and in vitro evidenceindicates that active canonical Wnt signalling inhibits neuronaldifferentiation16,53,57–59. Nevertheless, our findings are in agreementwith other in vitro data, showing that Wnt/β-catenin signalling mayactually promote neuronal differentiation60,61. Most importantly ourdata from the Rosa26 β-cat resc1C embryoid bodies support in vivofindings that β-catenin participating in cell adhesion plays a permissiverole in neuronal differentiation by supporting neuroepithelialformation62,63. Given that α-catenin has been implicated in braindevelopment64, we can however, not completely rule out thatneuronal differentiation defects are not in part due to the observedaltered α-catenin distribution (Fig. 1g and Supplementary Fig. S7).However, as nuclear levels were not altered (see Supplementary

ART I C L E S

Fig. S7a,b), we exclude a potential role in the nucleus65. Thepreviously proposed model implies, in agreement with our findings,that the number of functional adherens junctions controls braindevelopment, and that this may involve a Hedgehog (Hh)-signallingfeedback loop64. Whether the latter is also the case in our systemremains to be determined.Cell adhesion is an important aspect of embryonic development.

For bi-functional molecules, such as β-catenin, it is important todecipher their individual functional contributions in development.Our data indicate that β-catenin cell adhesion and not its Tcf/Lef-mediated signalling function is important for neuroepithelial andendoderm formation in embryoid bodies. Thus, despite plakoglobinupregulation in Ctnnb1mutants at E7.0 (ref. 19), cell-adhesion defectsmay contribute to some phenotypic aspects, as others have recentlyobserved63. In this context, it is interesting that Wnt3 mutants anddouble mutants for Lrp5/6 phenocopy Ctnnb1 mutants, with theexception that anterior visceral endoderm (AVE) movement towardsthe anterior still occurs19,66,67. Thus, the failure to properly position theanterior visceral endoderm in Ctnnb1mutants may be associated withdefects in cell adhesion. �

METHODSMethods and any associated references are available in the onlineversion of the paper at http://www.nature.com/naturecellbiology

Note: Supplementary Information is available on the Nature Cell Biology website

ACKNOWLEDGEMENTSWe thank W. Birchmeier (MDC, Berlin, Germany), R. Grosschedl (MPI, Freiburg,Germany) and A. Wutz (CSCR, Cambridge, UK) for reagents, R. Latham forWnt3aCM, R. Peachey, G. Resch, P. Pasierbeck, G. Stengl, V. Komnenovic andM. Zeba for help and technical advice, M. Radolf and H. Scheuch for help withmicroarray studies, C. Theussl and J. Wojciechowski for blastocyst injections, andA. Smith for helpful comments. Research in the laboratory of C.H. has beensupported by Boehringer Ingelheim, the project has been funded in part by the NoECells into Organs (LSHM-CT-2003-504468), N.L. was supported by the AustrianScience Fund (FWF Grant No. P19281-B16) andM.W. is supported by a grant fromthe Arthritis Research Campaign (ARC Grant No. 18075). R.T.M. is an investigatorof the HHMI and T.B. was supported by NIH grant R01 GM081619-01.

AUTHOR CONTRIBUTIONSN.L. carried out, analysed and interpreted experiments. M.W. and D.M. carried outpulldown studies. T.B. and R.T.M. generated and provided BAR/fuBAR lentiviruses,and commented on the paper. C.H. supervised the study and wrote the papertogether with N.L.

COMPETING FINANCIAL INTERESTSThe authors declare no competing financial interests.

Published online at http://www.nature.com/naturecellbiologyReprints and permissions information is available online at http://www.nature.com/reprints

1. Murry, C. E. & Keller, G. Differentiation of embryonic stem cells to clinically relevantpopulations: lessons from embryonic development. Cell 132, 661–680 (2008).

2. Doetschman, T. C., Eistetter, H., Katz, M., Schmidt, W. & Kemler, R. The invitro development of blastocyst-derived embryonic stem cell lines: formation ofvisceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol. 87,27–45 (1985).

3. Burkert, U., von Ruden, T. & Wagner, E. F. Early fetal hematopoietic developmentfrom in vitro differentiated embryonic stem cells. New Biol. 3, 698–708 (1991).

4. Smith, A. G. et al. Inhibition of pluripotential embryonic stem cell differentiation bypurified polypeptides. Nature 336, 688–690 (1988).

5. Williams, R. L. et al. Myeloid leukaemia inhibitory factor maintains thedevelopmental potential of embryonic stem cells. Nature 336, 684–687 (1988).

6. Ying, Q. L., Nichols, J., Chambers, I. & Smith, A. BMP induction of Id proteinssuppresses differentiation and sustains embryonic stem cell self-renewal incollaboration with STAT3. Cell 115, 281–292 (2003).

7. Sato, N., Meijer, L., Skaltsounis, L., Greengard, P. & Brivanlou, A. H. Maintenanceof pluripotency in human and mouse embryonic stem cells through activationof Wnt signaling by a pharmacological GSK-3-specific inhibitor. Nat. Med. 10,55–63 (2004).

8. Xu, R. H. et al. Basic FGF and suppression of BMP signaling sustain undifferentiatedproliferation of human ES cells. Nat. Methods 2, 185–190 (2005).

9. Daheron, L. et al. LIF/STAT3 signaling fails to maintain self-renewal of humanembryonic stem cells. Stem Cells 22, 770–778 (2004).

10. Reubinoff, B. E., Pera, M. F., Fong, C. Y., Trounson, A. & Bongso, A. Embryonic stemcell lines from human blastocysts: somatic differentiation in vitro. Nat. Biotechnol.18, 399–404 (2000).

11. Thomson, J. A. et al. Embryonic stem cell lines derived from human blastocysts.Science 282, 1145–1147 (1998).

12. Umehara, H. et al. Efficient derivation of embryonic stem cells by inhibition ofglycogen synthase kinase-3. Stem Cells 25, 2705–2711 (2007).

13. Mao, J. et al. Low-density lipoprotein receptor-related protein-5 binds to Axin andregulates the canonical Wnt signaling pathway. Mol. Cell 7, 801–809 (2001).

14. Logan, C. Y. & Nusse, R. The Wnt signaling pathway in development and disease.Annu. Rev. Cell Dev. Biol. 20, 781–810 (2004).

15. Anton, R., Kestler, H. A. & Kuhl, M. β-catenin signaling contributes to stemnessand regulates early differentiation in murine embryonic stem cells. FEBS Lett. 581,5247–5254 (2007).

16. Ying, Q. L. et al. The ground state of embryonic stem cell self-renewal. Nature 453,519–523 (2008).

17. Soncin, F. et al. Abrogation of E-cadherin-mediated cell–cell contact in mouseembryonic stem cells results in reversible LIF-independent self-renewal. Stem Cells27, 2069–2080 (2009).

18. Wagner, R. T., Xu, X., Yi, F., Merrill, B. J. & Cooney, A. J. Canonical Wnt/β-cateninregulation of liver receptor homolog-1 mediates pluripotency gene expression. StemCells 28, 1794–1804 (2010).

19. Huelsken, J. et al. Requirement for β-catenin in anterior–posterior axis formation inmice. J. Cell Biol. 148, 567–578 (2000).

20. Kemler, R. From cadherins to catenins: cytoplasmic protein interactions andregulation of cell adhesion. Trends Genet. 9, 317–321 (1993).

21. Buxton, R. S. & Magee, A. I. Structure and interactions of desmosomal and othercadherins. Semin. Cell Biol. 3, 157–167 (1992).

22. Fukunaga, Y. et al. Defining the roles of β-catenin and plakoglobin in cell–celladhesion: isolation of β-catenin/plakoglobin-deficient F9 cells. Cell Struct. Funct.30, 25–34 (2005).

23. Zhou, J. et al. Upregulation of γ-catenin compensates for the loss of β-catenin inadult cardiomyocytes. Am. J. Physiol. Heart Circ. Physiol. 292, H270–H276 (2007).

24. Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. & Birchmeier, W. β-Catenincontrols hair follicle morphogenesis and stem cell differentiation in the skin. Cell105, 533–545 (2001).

25. Williams, B. O., Barish, G. D., Klymkowsky, M. W. & Varmus, H. E. A comparativeevaluation of β-catenin and plakoglobin signaling activity. Oncogene 19,5720–5728 (2000).

26. Conacci-Sorrell, M. E. et al. Nr-CAM is a target gene of the β-catenin/LEF-1 pathwayin melanoma and colon cancer and its expression enhances motility and conferstumorigenesis. Genes Dev. 16, 2058–2072 (2002).

27. Biechele, T. L. & Moon, R. T. Assaying β-catenin/TCF transcription withβ-catenin/TCF transcription-based reporter constructs. Methods Mol. Biol. 468,99–110 (2008).

28. Sustmann, C., Flach, H., Ebert, H., Eastman, Q. & Grosschedl, R. Cell-type-specificfunction of BCL9 involves a transcriptional activation domain that synergizes withβ-catenin. Mol. Cell Biol. 28, 3526–3537 (2008).

29. Haegel, H. et al. Lack of β-catenin affects mouse development at gastrulation.Development 121, 3529–3537 (1995).

30. Ohsugi, M. et al. Expression and cell membrane localization of catenins duringmouse preimplantation development. Dev. Dyn. 206, 391–402 (1996).

31. Keller, G. M. In vitro differentiation of embryonic stem cells. Curr. Opin. Cell Biol.7, 862–869 (1995).

32. ten Berge, D. et al. Wnt signaling mediates self-organization and axis formation inembryoid bodies. Cell Stem Cell 3, 508–518 (2008).

33. Yasunaga, M. et al. Induction and monitoring of definitive and visceral endodermdifferentiation of mouse ES cells. Nat. Biotechnol. 23, 1542–1550 (2005).

34. Ogawa, K., Nishinakamura, R., Iwamatsu, Y., Shimosato, D. & Niwa, H. Synergisticaction of Wnt and LIF in maintaining pluripotency of mouse ES cells. Biochem.Biophys. Res. Commun. 343, 159–166 (2006).

35. Hao, J., Li, T. G., Qi, X., Zhao, D. F. & Zhao, G. Q. WNT/β-catenin pathwayup-regulates Stat3 and converges on LIF to prevent differentiation of mouseembryonic stem cells. Dev. Biol. 290, 81–91 (2006).

36. Singla, D. K., Schneider, D. J., LeWinter, M. M. & Sobel, B. E. wnt3a but not wnt11supports self-renewal of embryonic stem cells. Biochem. Biophys. Res. Commun.345, 789–795 (2006).

37. Takao, Y., Yokota, T. & Koide, H. β-catenin up-regulates Nanog expression throughinteraction with Oct-3/4 in embryonic stem cells. Biochem. Biophys. Res. Commun.353, 699–705 (2007).

38. Kielman, M. F. et al. Apc modulates embryonic stem-cell differentiation bycontrolling the dosage of β-catenin signaling. Nat. Genet. 32, 594–605 (2002).

ART I C L E S

39. Wray, J. et al. Inhibition of glycogen synthase kinase-3 alleviates Tcf3 repressionof the pluripotency network and increases embryonic stem cell resistance todifferentiation. Nat. Cell Biol. 13, 838–845 (2011).

40. Brons, I. G. et al. Derivation of pluripotent epiblast stem cells from mammalianembryos. Nature 448, 191–195 (2007).

41. Cowin, P., Kapprell, H. P., Franke, W. W., Tamkun, J. & Hynes, R. O. Plakoglobin:a protein common to different kinds of intercellular adhering junctions. Cell 46,1063–1073 (1986).

42. Peifer, M., McCrea, P. D., Green, K. J., Wieschaus, E. & Gumbiner, B. M. Thevertebrate adhesive junction proteins β-catenin and plakoglobin and the Drosophilasegment polarity gene armadillo form a multigene family with similar properties.J. Cell Biol. 118, 681–691 (1992).

43. Nagafuchi, A., Takeichi, M. & Tsukita, S. The 102 kd cadherin-associated protein:similarity to vinculin and posttranscriptional regulation of expression. Cell 65,849–857 (1991).

44. Breen, E., Clarke, A., Steele, G. Jr. & Mercurio, A. M. Poorly differentiated coloncarcinoma cell lines deficient in α-catenin expression express high levels of surfaceE-cadherin but lack Ca(2+)-dependent cell–cell adhesion. Cell Adhes. Commun. 1,239–250 (1993).

45. Bajpai, S., Feng, Y., Krishnamurthy, R., Longmore, G. D. & Wirtz, D. Loss of α-catenindecreases the strength of single E-cadherin bonds between human cancer cells.J. Biol. Chem. 284, 18252–18259 (2009).

46. Bajpai, S. et al. α-Catenin mediates initial E-cadherin-dependent cell–cellrecognition and subsequent bond strengthening. Proc. Natl Acad. Sci. USA 105,18331–18336 (2008).

47. Kofron, M., Spagnuolo, A., Klymkowsky, M., Wylie, C. & Heasman, J. The roles ofmaternal α-catenin and plakoglobin in the early Xenopus embryo. Development 124,1553–1560 (1997).

48. Ben-Ze’ev, A. & Geiger, B. Differential molecular interactions of β-cateninand plakoglobin in adhesion, signaling and cancer. Curr. Opin. Cell Biol. 10,629–639 (1998).

49. Miller, J. R. & Moon, R. T. Analysis of the signaling activities of localizationmutants of β-catenin during axis specification in Xenopus. J. Cell Biol. 139,229–243 (1997).

50. Teuliere, J. et al. β-catenin-dependent and -independent effects of 1N-plakoglobinon epidermal growth and differentiation. Mol. Cell Biol. 24, 8649–8661 (2004).

51. Maeda, O. et al. Plakoglobin (γ-catenin) has TCF/LEF family-dependent transcrip-tional activity in β-catenin-deficient cell line. Oncogene 23, 964–972 (2004).

52. De Vries, W. N. et al. Maternal β-catenin and E-cadherin in mouse development.Development 131, 4435–4445 (2004).

53. Lindsley, R. C., Gill, J. G., Kyba, M., Murphy, T. L. & Murphy, K. M. Canonical Wntsignaling is required for development of embryonic stem cell-derived mesoderm.Development 133, 3787–3796 (2006).

54. Niwa, H., Yamamura, K. & Miyazaki, J. Efficient selection forhigh-expression transfectants with a novel eukaryotic vector. Gene 108,193–199 (1991).

55. Arnold, S. J. et al. Brachyury is a target gene of the Wnt/β-catenin signaling pathway.Mech. Dev. 91, 249–258 (2000).

56. Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N. & McMahon, A. P. T (Brachyury)is a direct target of Wnt3a during paraxial mesoderm specification. Genes Dev. 13,3185–3190 (1999).

57. Aubert, J., Dunstan, H., Chambers, I. & Smith, A. Functional gene screening inembryonic stem cells implicates Wnt antagonism in neural differentiation. Nat.Biotechnol. 20, 1240–1245 (2002).

58. Yoshikawa, Y., Fujimori, T., McMahon, A. P. & Takada, S. Evidence that absence ofWnt-3a signaling promotes neuralization instead of paraxial mesoderm developmentin the mouse. Dev. Biol. 183, 234–242 (1997).

59. Verani, R. et al. Expression of the Wnt inhibitor Dickkopf-1 is required for theinduction of neural markers in mouse embryonic stem cells differentiating inresponse to retinoic acid. J. Neurochem. 100, 242–250 (2007).

60. Murashov, A. K. et al. Directed differentiation of embryonic stem cells into dorsalinterneurons. FASEB J. 19, 252–254 (2005).

61. Otero, J. J., Fu, W., Kan, L., Cuadra, A. E. & Kessler, J. A. β-catenin signalingis required for neural differentiation of embryonic stem cells. Development 131,3545–3557 (2004).

62. Junghans, D., Hack, I., Frotscher, M., Taylor, V. & Kemler, R. β-catenin-mediatedcell-adhesion is vital for embryonic forebrain development. Dev. Dyn. 233,528–539 (2005).

63. Hierholzer, A. & Kemler, R. β-catenin-mediated signaling and cell adhesion inpostgastrulation mouse embryos. Dev. Dyn. 239, 191–199 (2010).

64. Lien, W. H., Klezovitch, O., Fernandez, T. E., Delrow, J. & Vasioukhin, V. αE-catenincontrols cerebral cortical size by regulating the hedgehog signaling pathway. Science311, 1609–1612 (2006).

65. Giannini, A. L., Vivanco, M. & Kypta, R. M. α-catenin inhibits β-catenin signalingby preventing formation of a β-catenin · T-cell factor · DNA complex. J. Biol. Chem.275, 21883–21888 (2000).

66. Kelly, O. G., Pinson, K. I. & Skarnes, W. C. The Wnt co-receptors Lrp5 and Lrp6 areessential for gastrulation in mice. Development 131, 2803–2815 (2004).

67. Liu, P. et al. Requirement for Wnt3 in vertebrate axis formation. Nat. Genet. 22,361–365 (1999).

METHODS DOI: 10.1038/ncb2260

METHODSmESC establishment, culture conditions and blastocyst injections.Individual 3.5-day-old blastocysts isolated from β-cat fl/fl females intercrossedwith β-cat fl/fl males were seeded on irradiated MEFs in four-well plates inESC medium (high-glucose DMEM, 15% FBS, 2mM l-glutamine, 2mM peni-cillin/streptomycin, 1mM sodium pyruvate, 1× MEM non-essential amino acids,0.1mM β-mercaptoethanol and 1,000Uml−1 LIF). After 5–7 days, the inner cellmass was dissociated using 0.05% trypsin–EDTA and plated on MEFs. From thesecultures, colonies with ESC-like morphology were selected, eventually adapted forfeeder-free conditions and further characterized. β-cat1/1 mESCs were establishedfrom the fully pluripotent NLβ-12 β-cat fl/fl mESC line through infection withadenoviral-mediated Cre (University of Iowa) at a multiplicity of infection (MOI)of 150 for 5×104 mESCs. After 24 h, individual mESCs were seeded in 96-well platesand PCR genotyped (primers: 5′-AGAATCACGGTGACCTGGGTTAAA-3′, 5′-CAGACAGACAGCACCTTCAGCACTC-3′, 5′-CAGCCAAGGAGAGCAGGTGA-GG-3′). Two mESC clones of each genotype, β-cat fl/fl and β-cat1/1, were furthercharacterized. For serum-free cultures, mESCs were cultured in N2B27 medium(StemCellSciences) supplemented with 1,000Uml−1 EsgroLIF (Chemicon), 3 µMCHIR99021 and 1 µM PD0325901 (both StemGent). Blastocyst injections werecarried out with the mESC clone NLβ-12 (on feeder, passage 18). The resultinghigh-grade chimaera was crossed to a C57Bl/6mouse and the offspring was analysedby PCR for germline transmission of the Ctnnb1 floxed allele. Blastocyst injections(of 10–15mESCs per blastocyst) were also carried out for β-cat rescWT and β-cat resc1C

mESC clones stably marked with histone 2B (H2B) fused to green fluorescentprotein (GFP; Addgene plasmid 11680; ref. 68). Embryos were recovered six dayslater, staged and visually examined for their grade of chimaerism using an LSM 710spectral confocal microscope (Zeiss).

Rosa26 and stablepCAGGSrescuemESCsand siRNAexperiments. Targetinginto the Rosa26 locus was carried out using a modified Rosa26 targeting vec-tor, pR26hygro (5′homology arm–SA–XbaI–SV40polyA–loxP–PGKhygro–loxP–3′

homology arm–PGKDTA; provided by A. Wutz) into which either wild-typefull-length mouse β-catenin or amino-terminal Myc-tagged human versions ofC-terminal truncated (1C) or M6 β-catenin (expression plasmids provided byR. Grosschedl) had been inserted into the XbaI site by blunt-end cloning. Forthe Rosa26-CAG rescue lines, Myc-tagged wild-type and 1C β-catenin were firstcloned behind the CAG-promoter; fragments containing the CAGpromoter and theβ-catenin variants were then isolated and inserted into the XbaI site of pR26hygroby blunt-end cloning. Correctly targeted mESCs were identified by Southernblotting using Rosa26 5′ and 3′ external probes. For stable CAG-mESC lines,open reading frames were inserted by blunt-end cloning into the XhoI site of amodified pCAGGS vector containing a PGK neomycin selection cassette. Individualneomycin-resistant clones were established and tested by western blotting for theirβ-catenin levels. For transient siRNA transfections,mESCswere seeded onto six-wellplates at 2.5× 104 cells per well the day before Lipofectamine-2000- (Invitro-gen) mediated transfection with 150 nM Jup (5′-ACACCUACGACUCGGGCAU-3′, 5′-CCAAGCUGCUCAACGAUGA-3′, 5′-GGAACUACAGCUACGAGAA-3′, 5′-UGAGUGUAGAUGACGUCAA-3′) or Lmna (5′-UGACCAUGGUUGAGGACAA-3′) OnTarget siRNA mix (Dharmacon).

Generationof stableBAR-reporter lines and luciferase assays. Stable BAR andfuBAR (found-unresponsive β-catenin-activated reporter) mESCs were establishedby infecting mESCs with pBARLS and pFuBARLS lentiviruses followed bypuromycin selection for seven days. For TOPFLASH/FOPFLASH luciferase reporterassays, BAR and fuBARmESCs were seeded onto 12-well plates at a concentration of5×104 cells per well. TheWnt pathway was activated the next day by treatment with200 ngml−1 rWnt3a (R&D Systems), 50%Wnt3aCM from stableWnt3a-producingL-cells, 2 µMBIO (Calbiochem) or 3 µMCHIR99021 respectively. Luciferase assayswere carried out in triplicate after 24 h using a Dual-Glo luciferase assay (Promega)and the Synergy Fluorescence Plate Reader using at least two biological samples.

Embryoid body and neuron differentiation cultures. For embryoid bodydifferentiation, 1 × 106 feeder-independent mESCs were plated onto 15 cmlow-attachment plates (Corning) and cultured in mESC medium without LIF(differentiation medium). For the hanging-drop method, 1×103 cells were platedper drop of differentiation medium and transferred after 60 h to low-attachmentplates (Corning). Embryoid bodies were collected at indicated time points, fixedin 4% paraformaldehyde and processed for immunocytochemical staining orembedded in OCT medium (TissueTek) for cryosectioning. For high-densitymonolayer differentiation, 4× 104 mESCs per square centimetre were plated onlaminin-coated coverslips in N2B27 medium (StemCellSciences) and cultured for14 days. Medium was renewed every second day. TuJ-positive cells were counted inrandom fields.

Alkaline phosphatase staining, immunohistochemistry and TEM. Alkalinephosphatase staining was carried out using the alkaline phosphatase kit accordingto the manufacturer’s instructions (Sigma Aldrich). Immunohistochemistry wascarried out on mESCs or embryoid bodies seeded on gelatin-covered 12mmglass coverslips (Novodirect) after 20min fixation with 4% paraformaldehyde,followed by 10min permeabilization in PBS with 0.5% Triton-X and a 1 h blockingstep with PBS containing 2% BSA. For immunohistochemistry on cryosections,embryoid bodies from hanging-drop cultures were fixed for 30min in 4%paraformaldehyde, embedded in OCT and sectioned at 8 µm. Incubation withprimary antibodies against Nanog, Cxcr4 (both 1:100; Abcam), β-catenin (anti-C-terminus 1:250; BD Transduction; anti-N-terminus 1:200; Alexis Biochemicals),E-cadherin, plakoglobin, PECAM1 (all 1:200; BD-Transduction), Oct3/4 (1:100),Foxa2 (1:100), TuJ (1:200), Gata4 (1:500; all from Santa Cruz) and fibronectin(1:200; Sigma) was carried out for 1 h at room temperature or overnight at 4 ◦Cin PBS containing 2% BSA. Incubation with corresponding secondary anti-mouse,anti-rabbit or anti-goat antibodies coupled with Alexa488 or Alexa674 (1:1,000;Molecular Probes) was carried out for 1 h at room temperature in the darkin PBS containing 2% BSA. To stain nuclei, samples were incubated for 5minin 10 µgml−14,6-diamidino-2-phenylindole (DAPI; Sigma) and mounted withProLong Gold antifade reagent (Molecular Probes). Images were taken using theLSM 510 Meta/Axiovert200M confocal microscope. For TEM, mESCs were grownfor two days on gelatinized 12mm ultraviolet-sterilized Aclar coverslips, fixed in2% glutaraldehyde for 1 h, rinsed three times with PBS, treated with 2% OsO4,rinsed with PBS and dehydrated for 10min each in a graded series of ethanolconcentrations (40, 60, 80, 95, 100%). For embedding, coverslips were incubatedin a 100% ethanol/epoxy resin mixture (1:1) for 30min at room temperature,followed by two 30min incubations of the coverslips on 100% epoxy resin, afterwhich the coverslips were placed onto resin-filled lids of BEEM capsules andpolymerized for 48 h at 60 ◦C. Resin blocks were sectioned on a Leica Ultracut UCTmicrotome. Sections were collected on metal grids and post-stained with Reynoldslead citrate (PbNO3)2 and uranyl acetate. Images were taken on an FEIMorgagni 268electron microscope.

PCR analyses, microarrays, western blots and co-immunoprecipitation.RNA was isolated using the RNeasy Kit (Qiagen). A quantity of 1–2 µg RNAwas used to prepare complementary DNAs using the SuperscriptII first-strandcDNA synthesis system (Invitrogen). Amounts equivalent to 10–20 ng of theinitial total RNA input were used as templates for real-time PCR and PCRwith reverse transcription (RT–PCR) analyses using gene primer pairs spanningexon–intron boundaries. Real-time PCR was carried out using SYBR greenI nucleicacid gel stain (Roche) and TAKARA rTaq at least in duplicate. Products wereanalysed by agarose gel electrophoresis and melting curves. Values were calculatedusing the comparative threshold cycle (1C(t )) method and normalized to HPRT(hypoxanthine–guanine phosphoribosyltransferase) values; for relative expressionlevels shown in histograms the values of control fl/fl mESCs were always set to 1. Forsemiquantitative RT–PCR, GAPDH (glyceraldehyde 3-phosphate dehydrogenase)and HPRT were used as controls. All primers are listed in Supplementary Table S2.In-house microarray platforms were used to compare total RNA from β-cat fl/fl

and β-cat1/1 mESCs. Cyanine-3 (Cy3)- and Cy5-labelled complementary RNAwas prepared from 3–5 µg of total RNA by oligo-dT-primed reverse transcription.Activation/repression ratios for individual spots were calculated using GenePixPro5-chip software. Two biological replicas were analysed.

For western blots and immunoprecipitation analyses, protein was extractedfrom cultured mESCs or embryoid bodies. Protein concentrations were determinedusing Bradford assays (Biorad). For western blotting assays, unless specifiedotherwise, 10–20 µg extract was loaded per lane. For nuclear extracts, cells werefractionated according to ref. 69 or the NE-PER Kit (Pierce) was used fornuclear and cytoplasmic protein extractions. For immunoprecipitation analysesGammabind Plus Sepharose Beads (Amersham) and 1–2mg of pre-cleared lysatewere used. Incubations with 2 µg and 10 µg antibodies against E-cadherin andα-catenin, respectively, were carried out at 4 ◦C overnight. Primary antibodieswere directed against β-catenin (1:2,000; anti-C-terminus, BD Transduction;anti-N-terminus, Alexis Biochemicals), plakoglobin (1:6,000; BD-Transduction),E-cadherin (BD-Transduction), α-catenin (Chemicon), tubulin (1:6,000; Sigma),Stat3, phospho-(Tyr 705)-Stat3, Myc-tag (Cell Signaling), proteasome 20S-C2(Abcam) and HP1α (Cell Signaling), and were used at a dilution of 1:1,000, unlessstated otherwise.

68. Kanda, T., Sullivan, K. F. & Wahl, G. M. Histone-GFP fusion protein enablessensitive analysis of chromosome dynamics in living mammalian cells. Curr. Biol.8, 377–385 (1998).

69. Neumann, S. et al. Nesprin-2 interacts with α-catenin and regulates Wnt signalingat the nuclear envelope. J. Biol. Chem. 285, 34932–34938 (2010).

NATURE CELL BIOLOGY

S U P P L E M E N TA RY I N F O R M AT I O N

WWW.NATURE.COM/NATURECELLBIOLOGY 1

DOI: 10.1038/ncb2260

Figure S1 NLβ-12 β-catfl/fl ESCs are fully pluripotent. (a) Chimeras generated from blastocyst injections of NLβ-12 β-catfl/fl mESCs, with PCR genotyping results shown below. Estimated grade of chimerism based on coat color for the chimeric pups #1, #4 and #30 is indicated below. Note: pups #10 and

#40 are not shown in the picture. (b) Litter from chimeric animal #1 (80% chimeric) after cross with C57Bl/6, showing for pup #1 transmission of the floxed allele through the germ line, based on coat color and genotyping PCR shown below.

Figure S1: NLβ-12 β-catfl/fl ESCs are fully pluripotent. (a) Chimeras generated from blastocyst

injections of NLβ-12 β-catfl/fl mESCs, with PCR genotyping results shown below. Estimated grade

of chimerism based on coat color for the chimeric pups #1, #4 and #30 is indicated below. Note: pups #10 and #40 are not shown in the picture. (b) Litter from chimeric animal #1 (80% chimeric) after cross with C57Bl/6, showing for pup #1 transmission of the floxed allele through the germ line, based on coat color and genotyping PCR shown below.

2 WWW.NATURE.COM/NATURECELLBIOLOGY

Figure S2 Alkaline phosphatase staining on β-catfl/fl and β-cat∆/∆ mESCs cultured in the following media LIF+2i, 2i (PD0325901+CHIR99021), LIF+PD0325901 and LIF+CHIR99021 for 5 days. Scale bar 200 µm.

Figure S2 Alkaline phosphatase staining on β-catfl/fl and β-cat∆/∆ mESCs cultured in the following

media LIF+2i, 2i (PD0325901+CHIR99021), LIF+PD0325901 and LIF+CHIR99021 for 5 days. Scale bar 200 µm.

Figure S3 Quantification of morphological changes upon control lamin A/C siRNA and plakoglobin siRNA treatment. (a) Phase contrast images of β-catfl/fl, β-cat∆/∆, β-catrescWT and β-catresc∆C mESC cultures 48 hours after treatment with control lamin A/C or plakoglobin siRNA. Scale bar 200 µm. (b) Quantification of the percentage of mESC colonies showing morphological changes 48 hours after siRNA treatment; with their appearance being either

spread (indicated by red color), similar to phase contrast image of β-cat∆/∆ mESCs treated with plakoglobin siRNA shown in (A), or compact (indicated by blue color). (c) Histogram showing relative expression levels of Nanog, Oct4 and Sox2 on day 4 of culturing (n=2), and growth curve showing population doublings over 4 days of β-catfl/fl and β-cat∆/∆ mESC cultures treated with lamin A/C or plakoglobin siRNA performed in triplicates.

Figure S3 Quantification of morphological changes upon control lamin A/C siRNA and plakoglobin siRNA treatment. (a) Phase contrast images of β-catfl/fl, β-cat∆/∆, β-catrescWT and β-catresc∆C mESC

cultures 48 hours after treatment with control lamin A/C or plakoglobin siRNA. Scale bar 200 µm. (b) Quantification of the percentage of mESC colonies showing morphological changes 48 hours after siRNA treatment; with their appearance being either spread (indicated by red color), similar to phase contrast image of β-cat∆/∆ mESCs treated with plakoglobin siRNA shown in (A), or compact

(indicated by blue color). (c) Histogram showing relative expression levels of Nanog, Oct4 and Sox2 on day 4 of culturing (n=2), and growth curve showing population doublings over 4 days of β-

catfl/fl and β-cat∆/∆ mESC cultures treated with lamin A/C or plakoglobin siRNA performed in

triplicates.

Figure S4 Characterization of β-catenin rescued mESCs with regard to cell-adhesion. (a) Confocal images (scale bar 50 µm) of immunofluorescent staining for β-catenin and β-catenin/DAPI on β-catfl/fl, β-cat∆/∆, and Rosa26 β-catrescWT, β-catresc∆C and β-catrescM6 mESCs. (b) Western blot analyses for E-cadherin, α-catenin, β-catenin (WT, ∆C, M6), plakoglobin and tubulin showing input and E-cadherin immunoprecipitates (IP) in β-catfl/fl, β-cat∆/∆,

β-catrescWT, β-catresc∆C and β-catrescM6 mESCs. (c) Western blot showing β-catenin and plakoglobin protein levels in β-catfl/fl, β-cat∆/∆, and pCAGGS and Rosa26 rescued mESCs compared to proteasome20S. (d) Western blot analyses for E-cadherin, α-catenin, β-catenin, plakoglobin and tubulin showing input and α-catenin immunoprecipitates in β-catfl/fl and β-cat∆/∆ mESCs.

Figure S4 Characterization of β-catenin rescued mESCs with regard to cell-adhesion. (a) Confocal

images (scale bar 50 µm) of immunofluorescent staining for β-catenin and β-catenin/DAPI on β-

catfl/fl, β-cat∆/∆, and Rosa26 β-catrescWT, β-catresc∆C and β-catrescM6 mESCs. (b) Western blot

analyses for E-cadherin, α-catenin, β-catenin (WT, ∆C, M6), plakoglobin and tubulin showing input

and E-cadherin immunoprecipitates (IP) in β-catfl/fl, β-cat∆/∆, β-catrescWT, β-catresc∆C and β-catrescM6

mESCs. (c) Western blot showing β-catenin and plakoglobin protein levels in β-catfl/fl, β-cat∆/∆, and

pCAGGS and Rosa26 rescued mESCs compared to proteasome20S. (d) Western blot analyses for E-cadherin, α-catenin, β-catenin, plakoglobin and tubulin showing input and α-catenin

immunoprecipitates in β-catfl/fl and β-cat∆/∆ mESCs.

Figure S5 (related to Figure 7a): Histograms showing relative expression levels of endodermal markers Foxa2, Mixl1, Gata6 (n=1 each) and of the mesodermal marker Brachyury (n=2) in β-catfl/fl, β-cat∆/∆, and Rosa26-CAG β-catrescWT, β-catresc∆C mESCs and during EB differentiation.

Figure S6 In vivo contribution analysis of mutant β-cat∆/∆, and Rosa26 β-catrescWT, β-catresc∆C mESCs. Chimeric E8.0-8.5 embryos generated by injection of H2B-GFP marked mutant mESCs. Embryos are oriented head to the left, tail to the right. (a) Chimeric embryo showing contribution of β-cat∆/∆ mESCs primarily to the head fold, with very few GFP-positive cells in the trunk region. (b) Chimeric embryo showing large contribution of Rosa26 β-catrescWT mESCs to the headfolds, trunk and tail regions.

(c,d) Chimeric embryos showing large (c) and medium (d) contribution of Rosa26 β-catresc∆C mESCs to the headfolds, trunk and tail regions. Note: low contribution or absence of GFP-positive cells in the mesoderm layer (white arrowheads in c, d). Overview image (upper images) were taken with 10x, images in the boxed regions were taken with 25x objective. (e) Table summarizing the data from the analyses of chimeric embryos.

Figure S6 In vivo contribution analysis of mutant β-cat∆/∆, and Rosa26 β-catrescWT, β-catresc∆C

mESCs. Chimeric E8.0-8.5 embryos generated by injection of H2B-GFP marked mutant mESCs. Embryos are oriented head to the left, tail to the right. (a) Chimeric embryo showing contribution of β-cat∆/∆ mESCs primarily to the head fold, with very few GFP-positive cells in the trunk region. (b)

Chimeric embryo showing large contribution of Rosa26 β-catrescWT mESCs to the headfolds, trunk

and tail regions. (c,d) Chimeric embryos showing large (c) and medium (d) contribution of Rosa26 β-catresc∆C mESCs to the headfolds, trunk and tail regions. Note: low contribution or absence of

GFP-positive cells in the mesoderm layer (white arrowheads in c, d). Overview image (upper images) were taken with 10x, images in the boxed regions were taken with 25x objective. (e) Table summarizing the data from the analyses of chimeric embryos.

Figure S7 Distribution of α-catenin analysed by immunofluorescence and western blots. Line scan data for α-catenin are shown below each image. The red arrow indicates the scanned line. (a) Immunofluorescent staining and western blot of membranous/cytoplasmic (mem/cyt) and nuclear (nuc) fractions for α-catenin of β-catfl/fl and β-cat∆/∆ mESCs under serum+LIF conditions. (b)

Immunofluorescent staining and western blot of membranous/ cytoplasmic (mem/cyt) and nuclear (nuc) fractions for a-catenin of β-catfl/fl and β-cat∆/∆ mESCs that have been differentiating for 4 days in N2B27 medium. (c) Immunofluorescent staining for α-catenin in Rosa26 β-catrescWT and β-catresc∆C mESCs that have been differentiating for 4 days in N2B27 medium.

Figure S7 Distribution of α-catenin analysed by immunofluorescence and western blots. Line scan

data for α-catenin are shown below each image. The red arrow indicates the scanned line.

(a) Immunofluorescent staining and western blot of membranous/cytoplasmic (mem/cyt) and nuclear (nuc) fractions for α-catenin of β-catfl/fl and β-cat∆/∆ mESCs under serum+LIF conditions.

(b) Immunofluorescent staining and western blot of membranous/ cytoplasmic (mem/cyt) and nuclear (nuc) fractions for α-catenin of β-catfl/fl and β-cat∆/∆ mESCs that have been differentiating

for 4 days in N2B27 medium. (c) Immunofluorescent staining for α-catenin in Rosa26 β-catrescWT

and β-catresc∆C mESCs that have been differentiating for 4 days in N2B27 medium.

Figure S8 Full scan data of western blots. The bands shown in the figures are indicated by the boxed regions.

Supplementary data:

Gene Entrez GeneID Fold change Log fold change Adj. P value

l7Rn6 67669 +1.953190 0.965833 0.00221

H19 14955 +2.055409 1.039425 0.00462

Rhox5/Pem 18617 +1.684209 0.752071 0.00818

Trpv6 64177 -1.685105 -0.752829 0.02326

Daam1 208846 -1.842641 -0.881775 0.04218

Table S1 related to Figure 1: Differentially expressed genes between β-catfl/fl and β-cat∆/∆ ESCs.

a Gene For Rev

Mixl1 AGTTGCTGGAGCTCGTCTTC CTCCCAGATCTCCCTGAGTG

Gata6 GCCAACTGTCACACCACAAC CCTCTTGGTAGCACCAGCTC

Gata4 CTGTGCCAACTGCCAGACTA GCGATGTCTGAGTGACAGGA

Gapdh CAAATGGGGTGAGGCCGGTGCTGAGTAT CGGCATCGAAGGTGGAAGAGTGGGAGTT

Pax6 AGGGGGAGAGAACACCAACT GGTTGCATAGGCAGGTTGTT

Fgf5 GCGACGTTTTCTTCGTCTTC GAAGTGGGTGGAGACGTGTT

Nestin GATCGCTCAGATCCTGGAAG GCTCTGGGAGGACACCAGTA

Brachyury CTCTAAGGAACCACCGGTCA CCATTGCTCACAGACCAGAG

Foxa2 GTTAAAGTATGCTGGGAGCCG CGCCCACATAGGATGACATG

b Gene For Rev

Mixl1 AGTTGCTGGAGCTCGTCTTC AGGGCAATGGAGGAAAACTC

Gata6 ATTCACCAGCAGCGACTAGCAG TCCAACCTGACTTTTGATTCCTCG

Foxa2 GTTAAAGTATGCTGGGAGCCG CGCCCACATAGGATGACATG

Brachyury CTCTAAGGAACCACCGGTCA CCATTGCTCACAGACCAGAG

Cdx1 ACGCCCTACGAATGGATG CTTGGTTCGGGTCTTACCG

Axin2 GCAGGAGCCTCACCCTTC TGCCAGTTTCTTTGGCTCTT

Nanog CCTCAGCCTCCAGCAGATGC CCGCTTGCACTTCACCCTTTG

Oct4 GAAGCAGAAGAGGATCACCTTG TTCTTAAGGCTGAGCTGCAAG

Sox2 GGCAGCTACAGCATGATGCAGGAGC CTGGTCATGGAGTTGTACTGC

Rex1 GGCCAGTCCAGAATACCAGA GAACTCGCTTCCAGAACCTG

Plakoglobin CTGTGTGCCCTCTGTAAGCA GAACTGTCCTCGCCTGAGAC

Hprt AGCTACTGTAATGATCAGTCAACG AGAGGTCCTTTTCACCAGCA

Table S2 Primer sequences for semiquantitative PCR (a) and qPCR (b).

Differential requirement for the dual functions of β-catenin in embryonic stem cell self-renewal...

Documents

Transcript of Differential requirement for the dual functions of β-catenin in embryonic stem cell self-renewal...

Fletcher Residential Limited - Auckland Council · Three Kings Renewal Stormwater Management Plan – Option 15H1 π Prepared for Fletcher Residential Limited π September 2014 PATTLE

1. Stone Renewal relates to090/DM/18 [Turn over 5 9. Graticule-A network of lines representing paralles latitude and perpendicular of longitude forming a (A) Map Projection (B) Road

Embryonic Development of a Snakeflぁ lnocellia japonica ...aesj.co-site.jp/vol41/2006_Vol.41_37.pdfThe c1 ypeolabrum differentiates as paired structures， which are observed to initially

RESEARCH Open Access Wheat germ oil enrichment in broiler … · 2017-04-06 · RESEARCH Open Access Wheat germ oil enrichment in broiler feed with α-lipoic acid to enhance the antioxidant

Estrogens &progestin Synthesis Gonads & adrenal glands Functions Conception, embryonic maturation & development of primary & 2ndary sexual characteristic.

Histology, Epithelial TissueEpithelial tissue Gr. ἐπί, epi, upon + θηλή, thēlē, nipple Origin –from all three germ layers of the embryo The tissue that: covers surfaces

F-box Protein FBXL16 Binds PP2A-B55α and Regulates … · F-box Protein FBXL16 Binds PP2A-B55 and Regulates Differentiation of Embryonic Stem Cells along the FLK1 Lineage* S Narimon

ΠΑΡΑΔΟΣΗ ΟΛΟΚΛΗΡΟΥ ΤΟΥ ΓΕΡΜΑΝΙΚΟΥ ΣΤΟΛΟΥ … germ stolou stin agglia-21 nov 1918.pdfΣΤΗΝ ΑΓΓΛΙΑ ΜΕΤΑ ΤΟΝ Α΄ΠΑΓΚΟΣΜΙΟ

Severe Sepsis/ Septic Shock - mums.ac.ir · With the confirmation of germ theory by Semmelweis, Pasteur, and others, sepsis was recast as a systemic infection, often described as

Early Embryonic Development3cell, biology, pdf, book, medical, journal,

Primary malignant Germ-Cell tumors of the anterior ... · fullness along the right hilum and mediastinum that obscures the hilar anatomy. Bild 2 CT – axial plan of a large Yolk

Restriction enzyme digestion of heterochromatin in ... paper/Tiwari...3.3 Hoechst 33258 fluorescence pattern of ovarian nurse, follicles and embryonic blastoderm cells The Hoechst

CLEVELAND SCHOLARSHIP PROGRAM 201 RENEWAL FORM

TGF-β-Activated Kinase 1 (Tak1) Mediates Agonist-Induced Smad Activation and Linker Region Phosphorylation in Embryonic Craniofacial Neural Crest-Derived Cells

Poisson Processes - Stochastic Processeshalweb.uc3m.es/esp/Personal/personas/rjjimene... · The Poisson Process as a renewal process Let T 1;T 2;::: be a sequence of i.i.d. nonnegative

Change the engineer life by batch system renewal

€¦ · XLS file · Web view · 2017-09-19... from the rat embryonic hippocampus [1]. Aucubin significantly reversed the elevated gene and protein expression of MMP-3, MMP-9, MMP-13,

March 1995 Embryonic Development and Larvae of Genus · after fertilization (Fig. 1 D-1) , a kupffer's vesicle appears a pair of optic cups have been formed and the embryo

Post-translational modifications of proteins in gene …HeLa and 2.9% in human embryonic stem cells HUES9 － compared to serine and threonine phosphorylation14, 15). Turn-over in

Stage-specific embryonic antigen-3 (SSEA-3) and 3GalT5 are ... · bythe analysisof SSEA-3 and the tworelated globo-series epitopes SSEA4 and globo-H in stem cells (embryonic stem