Food Chemistry 148 (2014) 381–387

Contents lists available at ScienceDirect

Food Chemistry

journal homepage: www.elsevier .com/locate / foodchem

Two xylose-tolerant GH43 bifunctional b-xylosidase/a-arabinosidasesand one GH11 xylanase from Humicola insolens and their synergyin the degradation of xylan

0308-8146/$ - see front matter � 2013 Elsevier Ltd. All rights reserved.http://dx.doi.org/10.1016/j.foodchem.2013.10.062

⇑ Corresponding author. Address: Key Laboratory for Feed Biotechnology of theMinistry of Agriculture, Feed Research Institute, Chinese Academy of AgriculturalSciences, No. 12 Zhongguancun South Street, Beijing 100081, PR China. Tel.: +86 1082106053; fax: +86 10 82106054.

E-mail addresses: binyao@caas.cn, yaobin@caas.cn (B. Yao).1 These authors contributed equally to this work.

Xinzhuo Yang a,1, Pengjun Shi a,1, Huoqing Huang a, Huiying Luo a, Yaru Wang a, Wei Zhang b, Bin Yao a,⇑a Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR Chinab Biotechnology Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, PR China

a r t i c l e i n f o a b s t r a c t

Article history:Received 7 June 2013Received in revised form 24 August 2013Accepted 14 October 2013Available online 25 October 2013

Keywords:Humicola insolens Y1b-XylosidaseXylanaseXylose toleranceSynergistic action

Two b-xylosidases of family 43 (Xyl43A and Xyl43B) and one xylanase of family 11 (Xyn11A) were iden-tified from the genome sequence of Humicola insolens Y1, and their gene products were successfullyexpressed in heterologous hosts. The optimal activities of the purified Xyl43A, Xyl43B, and Xyn11A werefound at pH 6.5–7.0 and 50–60 �C. They were stable over a pH range of 5.0–10.0 and temperatures of50 �C and below. Xyl43A and Xyl43B had the activities of b-xylosidase, a-arabinosidase and xylanase,and showed xylose tolerance up to 79 and 292 mM, respectively. Xyn11A and Xyl43A or Xyl43B showedsignificant synergistic effects on the degradation of various xylans, releasing more reduced sugars (up to1.29 folds) by simultaneous or sequential addition. This study provides several enzymes for synergisticdegradation of xylan and contributes to the formulation of optimised enzyme mixtures for the efficienthydrolysis of plant biomass.

� 2013 Elsevier Ltd. All rights reserved.

1. Introduction

Hemicelluloses are the second most abundant plant polysac-charides, after cellulose, in nature. Due to their potential role assustainable energy sources, hemicelluloses are increasinglybecoming an important concern (Saha, 2003a). Heterogeneousxylan, the major carbohydrate of hemicellulose, is composed of abackbone of b-1,4-D-xylose substituted with acetyl, L-arabinofur-anosyl, galactosyl, glucuronyl, and 4-O-methylglucuronyl groups(Bastawde, 1992). Its complete degradation requires the synergis-tic action of a variety of enzymes, including xylanase, b-xylosidase,a-glucuronidase, a-arabinofuranosidase, and acetylxylan esterase(Chávez, Bull, & Eyzaguirre, 2006). Among them, xylanase andb-xylosidase play a crucial role in the hydrolysis of the xylan back-bone (Kambourova et al., 2007; Polizeli et al., 2005), in whichxylanase cleaves the b-1,4-glycosidic bond between xylose resi-dues to release xylooligosaccharides, and b-xylosidase further de-grades short xylooligosaccharides to liberate xylose.

The functions of b-xylosidase include but are not limited toxylooligosaccharide degradation; it also contributes to the allevia-tion of end product inhibition of xylanases (Shi et al., 2013). Thus,it is useful for many biotechnological applications, especially in thefood, bioconversion and pulp and paper industries (Jordan &Wagschal, 2010). Many b-xylosidases of various sources have beenpurified, cloned, and biochemically characterised. Based on theamino acid sequence similarities, b-xylosidases have been classi-fied into the glycoside hydrolase (GH) families 3, 39, 43, 52 and54. Fungal b-xylosidases are mostly grouped into GH 3 (http://www.cazy.org/Glycoside-Hydrolases.html; Henrissat & Davies,1997), and only a few GH 43 b-xylosidases have been reportedfrom filamentous fungi, including Cochliobolus carbonum (Wegener,Ransom, & Walton, 1999), Penicillium herquei IFO 4674 (Ito et al.,2003), Aspergillus oryzae RIB40 (Suzuki et al., 2010), Paecilomycesthermophila J18 (Teng, Jia, Yan, Zhou, & Jiang, 2011), andThermomyces lanuginosus CAU44 (Chen et al., 2012).

The thermophilic fungus Humicola insolens Y1 has been re-ported to be an excellent producer of xylanolytic enzymes, andthree thermophilic GH 10 xylanases have been cloned and charac-terised (Du et al., 2013). In this study, two bi-functional xylosidase/arabinosidases and one GH11 xylanase were identified in strain Y1.These three enzymes were heterologously expressed and charac-terised. Their synergistic effects on the degradation of various xy-lans was also determined.

382 X. Yang et al. / Food Chemistry 148 (2014) 381–387

2. Materials and methods

2.1. Strains, media, vectors and chemicals

H. insolens Y1 GCMCC 4573 was grown in a wheat bran medium,as described previously (Du et al., 2013). Escherichia coli Trans1-T1and the plasmid pEASY-T3 (TransGen, Beijing, China) were used forgene cloning. E. coli BL21 (DE3) and vectors pET-28a(+) from Nova-gen (San Diego, CA, USA) were used for recombinant plasmid con-struction. Pichia pastoris GS115 and vector pPIC9 from Invitrogen(Carlsbad, CA, USA) were used for gene expression.

Birchwood xylan, beechwood xylan, barley b-glucan, carboxy-methyl cellulose sodium (CMC-Na), p-nitrophenyl-a-L-arabinofu-ranoside (pNPA), and 4-nitrophenyl b-D-xylopyranoside (pNPX)were purchased from Sigma–Aldrich (St. Louis, MO, USA). Solubleand insoluble wheat arabinoxylan were obtained from Megazyme(Wicklow, Ireland). The DNA purification kit, LA Taq DNA polymer-ase and restriction endonucleases were purchased from TaKaRa(Otsu, Japan). The total RNA isolation system kit and T4 DNA ligasewere purchased from Promega (Madison, WI, USA). All chemicalswere of analytical grade and commercially available.

2.2. Cloning of the cDNA genes

The two full-length GH 43 xylosidase genes, xyl43A and xyl43B,and one GH 11 xylanase gene, xyn11A, were identified from thegenome sequence of H. insolens Y1 (whole genome sequencing inprogress). The total RNA was extracted from the mycelia after3 days’ growth on wheat bran agar plate and purified using thePromega SV Total RNA Isolation System, according to the manufac-turer’ instructions. The cDNAs were synthesised in vitro using theReverTra Ace-a-™ kit (TOYOBO, Osaka, Japan) with the total RNAas the template. The full-length cDNAs of the three genes, withoutsignal peptide-coding sequence, were amplified using specificprimers with restriction sites (Table 1), which were designed basedon their DNA sequences. The PCR products with the appropriatesize were ligated into the pGEM-T Easy vector for sequencing.

2.3. Sequence analysis

Vector NTI Advance 10.0 software (Invitrogen) was used toevaluate the sequence similarities and to predict the molecularmass of the protein. BLASTn and BLASTp programs (http://www.ncbi.nlm.nih.gov/BLAST/) were used to analyse the nucleo-tide and deduce the amino acid sequences, respectively. The onlinesoftware FGENESH (http://linux1.softberry.com/berry.phtml) wasused to predict the transcription initiation sites, introns and exons.SignalP4.0 server (http://www.cbs.dtu.dk/services/SignalP/) andNetNGlyc 1.0 Server (http://www.cbs.dtu.dk/services/NetNGlyc/)were used to predict the signal peptide and the potential N-glyco-sylation sites, respectively.

Table 1Oligonucleotide primers used for this work.

Primers Primer sequence (50?30)a Size (bp)

Xyl43A-F GGGCATATGGCGCCCCTCATCACCAACATCTAC 33

Xyl43A-R GGGAAGCTTTTAGTGGTGGTGGTGGTGGTGCTCAGGCTTCTCCGTCACGATC

52

Xyl43B-F GGGCATATGCCCCAAGTCCGTAACCCTATCC 31

Xyl43B-R GGGAAGCTTTCAGAATCTCATAGCGATCGCTCGGG 35

Xyn11A-F GGGGAATTCAGCCCGCTTGAGGCCCTC 27

Xyn11A-R GGGGCGGCCGCTTAATCCAGCGACC 25

a Restriction sites incorporated into primers are shown underlined.

2.4. Heterologous expression and purification of Xyl43A, Xyl43B, andXyn11A

The cDNA sequences of xyl43A and xyl43B were digested withNdeI and HindIII, and inserted into the expression vector pET-28a(+). The recombinant plasmids, pET-xyl43A and pET-xyl43B,were individually transformed into E. coli BL21(DE3) competentcells. Protein expression was induced at 30 �C using 0.6 mM isopro-pyl b-D-1-thiogalactopyranoside (IPTG) for 4 h, followed by cellcollection with centrifugation at 12,000g, 4 �C for 10 min. The pel-let (5 g) was resuspended in 25 ml of lysis buffer (20 mM Tris–HCl,pH 7.0), then sonicated with an Ultrasonic Cell Disruptor (Scientz,Ningbo, China) on ice with 100 short bursts at 200 W for 6 s fol-lowed by intervals of 15 s for cooling. Cell debris was removedby centrifugation. The supernatants were subjected to Ni2+–NTAchromatography with a linear 20–300 mM imidazole gradient in50 mM Tris–HCl, 0.5 M NaCl, pH 7.6. The fractions exhibiting en-zyme activities were pooled, concentrated, and assayed by sodiumdodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE).The protein concentration was determined using the Bradford as-say, with bovine serine albumin as the standard.

The full-length cDNA of xyn11A was digested with EcoRI andNotI, and cloned into the pPIC9 vector in-frame fusion of the a-fac-tor signal peptide. The recombinant plasmid, pPIC9-xyn11A, waslinearised using BglII and transformed into P. pastoris GS115 com-petent cells by electroporation. The positive transformants wereselected for fermentation in a 1-l Erlenmayer flask as describedby Luo et al. (2012). The cell-free culture supernatants were col-lected, concentrated, and loaded onto the HiTrap Q Sepharose XLFPLC column (GE Healthcare, Uppsala, Sweden), equilibrated withbuffer A (20 mM Tris–HCl, pH 8.0). Proteins were eluted with a lin-ear NaCl gradient (0–1.0 M) in the same buffer at a flow rate of3 ml/min. Fractions exhibiting xylanase activity were collected,concentrated and subjected to SDS–PAGE analysis. The proteinconcentration was then determined. To remove N-glycosylation,the purified Xyn11A was deglycosylated by endo-b-N-acetylgluco-saminidase H (Endo H) at 37 �C for 2 h according to the manufac-turer’s instructions (New England Biolabs, Hitchin, UK).

2.5. Enzyme activity assays

The b-xylosidase or a-L-arabinofuranosidase activity was as-sayed as described previously (Shi et al., 2010). Reaction solutionseach containing an appropriately diluted enzyme sample and1 mM of either pNPA or pNPX were incubated at 50 �C, pH 7.0,for 10 min in 100 mM McIlvaine buffer. One unit of enzymeactivity was defined as the amount of enzyme that released 1 lmolof p-nitrophenol per min and measured at 405 nm.

The 3,5-dinitrosalicylic acid (DNS) method was used to assayxylanase activity (Miller, 1959). The reaction system consisted of900 ll of 1% (w/v) birchwood xylan in McIlvaine buffer (pH 7.0)and 100 ll of the appropriately diluted enzyme solution. The reac-tion mixture was incubated at 50 �C for 10 min, then 1.5 ml of DNSreagent was added to terminate the reaction. The mixture wasboiled for exactly 5 min and cooled down to room temperature.One unit of xylanase activity was defined as the amount of enzymethat released 1 lmol of reducing sugar from the substrate equiva-lent to xylose per minute under the assay conditions. Each assaywas performed in triplicate.

2.6. Biochemical characterisation

The optimal pH for enzyme activity was determined at 50 �Cover 10 min in buffers over a pH range of 4.0–12.0. The buffersused were 100 mM citric acid–Na2HPO4 (pH 4.0–8.0), 100 mMTris–HCl (pH 8.0–9.0), and 100 mM glycine–NaOH (pH 9.0–12.0).

X. Yang et al. / Food Chemistry 148 (2014) 381–387 383

The pH stability was estimated by measuring the residual enzymeactivity under the standard conditions (pH 7.0, 50 �C, 10 min) afterpre-incubation of the enzymes in buffers between pH 2.0–12.0 at37 �C for 1 h without the substrate.

The optimal temperature was examined at the optimal pH bymeasuring the enzyme activity over the temperature range of 20and 80 �C. The thermostabilities of Xyl43A and Xyl43B were car-ried out after pre-incubation at the optimal pH and at 50 �C or60 �C without substrate for various time periods, and 60 �C and70 �C for Xyn11A. The residual enzyme activities were measuredunder the assay conditions.

To determine the effects of metal ions and chemical reagents onthe enzyme activities, a final concentration of 5 mM of various me-tal ions and chemical reagents (Na+, K+, Li+, Ag+, Cu2+, Ni2+, Mn2+,Ca2+, Pb2+, Co2+, Zn2+, Mg2+, Fe3+, Cr3+, SDS, EDTA, and b-mercap-toethanol) were added to the reaction system individually andcompared to the blank control without any addition.

2.7. Substrate specificities and kinetic parameters

The substrate specificities of Xyl43A and Xyl43B were deter-mined under standard assay conditions (pH 6.5 or 7.0 at 50 �C)with 2 mM p-nitrophenyl derivatives (pNPA, pNPX, 4-nitrophenyla-D-galactopyranoside, 2-nitrophenyl b-D-galactopyranoside, 4-nitrophenyl a-D-glucopyranoside, 4-nitrophenyl a-L-arabinopyr-anoside, p-nitrophenyl acetate, or 4-nitrophenyl a-D-glucuronide),or 1% (w/v) birchwood xylan, beechwood xylan, water-solublewheat arabinoxylan, sugar beet arabinan, AZCL-arabinan (deb-ranched), or xylooligosaccharides.

The substrate specificity of Xyn11A was investigated in thepresence of the following substrates (1%; w/v): birchwood xylan,beechwood xylan, soluble/insoluble wheat arabinoxylan, barleyb-glucan, CMC-Na, and Avicel.

The Km, Vmax and kcat values for Xyl43A and Xyl43B with 1–10 mM pNPX as the substrate were determined in 100 mMNa2HPO4–citric acid, pH 7.0 at 50 �C for 5 min. And the Km, Vmax

and kcat values for Xyn11A were carried out in McIlvaine buffer(pH 7.0) at 50 �C containing 1–10 mM birchwood xylan as thesubstrate. Each experiment was repeated three times and eachexperiment included three replicates. The data were calculated usingthe Lineweaver–Burk method with a non-linear regression computerprogram GraFit (Version 7, Erithacus Software, Horley, UK).

2.8. Xyl43A and Xyl43B tolerance to xylose

The effects of various xylose concentrations on the b-xylosidaseactivities of Xyl43A and Xyl43B were investigated as described byYan et al. (2008). The proper amounts of enzymes, substrate pNPXand varying amounts of xylose (50–400 mM) were incubated at50 �C for 10 min. The residual b-xylosidase activities were mea-sured according to the standard assay method. The Ki value of xy-lose was defined as the amount of xylose required to inhibit 50% ofthe b-xylosidase activity, and calculated according to a Linewe-aver–Burk plot.

2.9. Enzyme synergism

The synergic actions of Xyl43A, Xyl43B and Xyn11A on thehydrolysis of birchwood xylan, beechwood xylan, and water-soluble wheat arabinoxylan were tested as described by Raweesri,Riangrungrojana, and Pinphanichakarn (2008). All reactions werecarried out at 37 �C in 100 mM Na2HPO4–citric acid, pH 7.0, con-taining 900 ll of 0.5% (w/v) substrate and 100 ll of enzyme(s)(1.0 U each of Xyl43A or Xyl43B, and/or 0.25 U Xyn11A). After12 h incubations, the first reactions were stopped in a boilingwater bath for 10 min. When cooled down to 37 �C, this process

was repeated when one or two enzymes were added sequentially.The reaction system containing each substrate without anyenzyme was treated as the blank control. The xylose equivalentsreleased (mM) were determined using the DNS method, withxylose as the standard. The degree of synergy was defined as theratio of xylose equivalents released when enzymes were incubatedsimultaneously or sequentially to the sum of the xylose equiva-lents released by each enzyme alone. Differences between enzymecombinations were evaluated using one-way ANOVA with aTukey’s test in OriginPro 8.

2.10. Nucleotide sequence accession numbers

The nucleotide sequences for the two GH43 b-xylosidase genes,xyl43A and xyl43B, and the GH11 xylanse gene Xyn11A from H. inso-lens Y1 were deposited into the GenBank database under the acces-sion numbers KC962399, KC962400, and KC962401, respectively.

3. Results and discussion

3.1. Sequence analysis

Two b-xylosidase coding genes, xyl43A (984 bp) and xyl43B(1617 bp), and one xylanase coding gene, xyn11A (732 bp), wereidentified in the genome sequence of H. insolens Y1. xyl43A andxyl43B had no introns and encoded polypeptides of 327 and 538amino acids, respectively. The xyn11A cDNA was 666 bp in length,and encoded 221 amino acids. The deduced b-xylosidases had noputative signal peptides, while the deduced Xyn11A had a putativesignal peptide at the N-terminus (residues 1–20). The calculatedmolecular masses were 37.1 kDa for Xyl43A, 61.8 kDa for Xyl43B,and 22.8 kDa for Xyn11A, respectively. Xyn11A had one putativeN-glycosylation site (Asn89).

Homology comparison of the deduced amino acid sequence ofXyl43A, with other known proteins, showed that it was most sim-ilar to a hypothetical GH43 xylosidase-like protein of Chaetomiumthermophilum var. thermophilum DSM 1495 (EGS22671.1) (91%identity) and had sequence identities of 73–75% to experimentallyverified b-xylosidases from P. thermophila J18 (PtXyl43;ADM33794.1), P. herquei IFO 4674 (S2; BAC75546.1), A. oryzaeRIB40 (BAE55732) and T. lanuginosus CAU44 (Tlxyl43,ADW66247.1). The deduced amino acid sequence of xyl43B exhib-ited the highest identity of 89% with a GH43 protein from Myceli-ophthora thermophila ATCC 42464 (XP_003663644.1) and had theidentity of over 60% to 60 proteins in the NCBI databases, but noneof them have been experimentally verified. The results indicatedthat Xyl43A and Xyl43B were typical of GH43 b-xylosidases. How-ever, the sequences of Xyl43A and Xyl43B were only 11.3% identi-cal, based on the analysis of AlignX from Vector NTI. In ourprevious study, two GH 43 a-L-arabinofuranosidases from Paeniba-cillus sp. E18 also had a low sequence identity (Shi et al., 2013). Itsuggests that some members of GH43 have a far phylogenic rela-tionship with each other, even having similar functions and fromthe same microbial source.

Deduced Xyn11A had highest identity of 86% with a probablexylanase from Chaetomium globosum CBS 148.51 (XP_00122846.1), followed by an experimentally verified xylanase (XYN186)from Alternaria sp. HB186 (ABG33753.1; 57%). The homology-modelled structure of Xyn11A displayed a classic b-jelly-roll archi-tecture, in which two predicted conserved catalytic residues,Glu113 (a catalytic nucleophile) and Glu205 (a catalytic acid-base),were located on b-strands 9 and 14, respectively (Paës, Berrin, &Beaugrand, 2012). Analysis of solvent-exposed amino acidsrevealed a high frequency of positively charged residues on thesurface.

1 2 3

13095

7255

43

34

26

170

kDa1 2 3

13095

72

5543

34

26

17

kDaA B

Fig. 1. SDS–PAGE analysis of b-xylosidases Xyl43A and Xyl43B and xylanaseXyn11A. (A) Purified recombinant b-xylosidases Xyl43A and Xyl43B. Lanes: (1) themolecular mass standards; (2) Xyl43B (62.0 kDa); (3) Xyl43A (37.0 kDa). (B)Xylanase Xyn11A. Lanes: (1) the molecular mass standards; (2) purified recombi-nant Xyn11A (25.0 and 23.0 kDa); (3) deglycosylated Xyn11A with Endo H(23.0 kDa).

384 X. Yang et al. / Food Chemistry 148 (2014) 381–387

3.2. Expression and purification of recombinant enzymes

Xyl43A and Xyl43B were successfully expressed in E. coli, andtheir activities in extracellular and cellular fractions were com-pared. Major portions of the total activity were found in the extra-cellular fractions of Xyl43A (>90%) and the intracellular fractions ofXyl43B (>80%), respectively. Without signal peptide in the expres-sion vector or in the recombinant protein sequence, a large amountof Xyl43A was secreted into the culture medium. This phenome-non has also been observed in other GH43 b-xylosidases, such asTlXyl43 from T. lanuginosus CAU44 (Chen et al., 2012) and PtXyl43from P. thermophila (Teng et al., 2011). Comparative secretomeanalysis, using the Secretome 2.0 Sever (http://www.cbs.dtu.dk/services/SecretomeP-2.0/), indicated that Xyl43A should be anon-classical secretory protein (Chen et al., 2012). After 4-h IPTGinduction, Xyl43A and Xyl43B had b-xylosidase activities of5.6 ± 0.6 and 4.7 ± 0.4 U/ml, respectively. The recombinantenzymes were purified to electronic homogeneity using Ni2+–NTA resin, and showed the apparent molecular masses of approx-

Table 2Properties of Xyl43A, Xyl43B and some fungal counterparts.

Microbial source Enzyme Optimal activity Specific actmg)

pH Temperature(�C)

Humicola insolens Y1 Xyl43Aa 6.5 50 20.5H. insolens Y1 Xyl43Ba 7.0 50 1.7Aspergillusoryzae XylBa 7.0 30 6.1Penicillium herquei IFO 4674 S2a 6.5 30 225Paecilomyces thermophila PtXyl43a 7.0 55 45.4Thermomyces lanuginosus CAU44 TlXyl43a 6.5 55 45.4P. thermophilab – 6.5 55 43.4Fusarium proliferatum (NRRL

26517)b– 4.5 60 53.0

H. insolensb – 5.5 70 193

Humicola grisea var. thermoideab – 6.0 50 175H. grisea var. thermoideab – 6.5 55 19.6

a GH43 b-xylosidases expressed in Escherichia coli.b b-Xylosidase purified from fungi.c Detected but not determined.

imately 37.0 kDa for Xyl43A and 62.0 kDa for Xyl43B in SDS–PAGEgel (Fig. 1A), which were consistent with their calculated molecu-lar masses.

The cDNA fragment of xyn11A, without the signal peptide-cod-ing sequence, was expressed in P. pastoris. Positive transformantswere screened by xylanase activity. After induction with methanolfor 72 h, the culture supernatant showed the highest xylanaseactivity of 206.5 U/ml, which was significantly higher than thatof GH10 xylanases from H. insolens Y1 (Du et al., 2013). SDS–PAGEshowed that purified recombinant Xyn11A had two bands ofapproximately 25.0 and 23.0 kDa. After deglycosylation with EndoH, the band at 25.0 kDa disappeared, and only one band (23.0 kDa)migrated on the gel, which was essentially identical to its calcu-lated molecular weight (Fig. 1B). N-Glycosylation is very commonin recombinant xylanases when expressed in P. pastoris (Sagtet al., 2000). Deduced Xyn11A has one putative N-glycosylationsite, which must have been N-glycosylated during heterologousexpression in P. pastoris.

3.3. Properties of purified recombinant enzymes

The effects of pH and temperature on the activities of Xyl43A,Xyl43B, and Xyn11A were examined and compared with other fun-gal counterparts. The same as most characterised GH43 b-xylosid-ases from fungi that are more active at acidic to neutral pH andstable at acidic to alkaline ranges (Table 2), Xyl43A and Xyl43Bexhibited their maximum activities at pH 6.5 and 7.0, respectively(Fig. 2A). Xyl43A was stable at pH 5.0–12.0, and Xyl43B was stableover a narrower range, at pH 6.0–10.0; both enzymes retained over50% activity at the pH ranges specified (Fig. 2B). The optimal tem-perature of the purified Xyl43Aand Xyl43B were both 50 �C(Fig. 2C), which was higher than the b-xylosidases (30 �C) from A.oryzae (Suzuki et al., 2010) and P. herquei (Ito et al., 2003), similarto the b-xylosidases from T. lanuginosus CAU44 (Chen et al., 2012),P. thermophila (Yan et al., 2008; Teng et al., 2011), and Hylaranagrisea var. thermodiea (Almeida, Polizeli, Terenzi, & Atilio Jorge,1995; Iembo, Azevedo, & Bloch, 2006), but lower than the heterodi-meric xylosidase (70 �C) from H. insolens (Mozolowski & Connerton,2009). The recombinant enzymes were stable at temperatures of50 �C and below, and Xyl43A showed a slightly better stability thanXyl43B at 50 �C (Fig. 2D).

For recombinant Xyn11A, the optimal pH for enzymatic activitywas 7.0 (Fig. 2A). Compared with most GH11 fungal xylanases thathave an acidic pH optima (2.0–6.0) and lose their activities at pHs

ivity (U/ Km

(mM)Vmax

(lmol/min/mg)

Ki

(mM)References

12.2 203.8 79 This work1.29 2.18 292 This work0.48 42.6 – Suzuki et al. (2010)- - – Ito et al. (2003)4.5 90.2 – Teng et al. (2011)3.9 107.6 63 Chen et al. (2012)4.3 - 139 Yan et al. (2008)0.77 - 5 Saha (2003b)

1.74 22.2 – Mozolowski and Connerton(2009)

0.49 - – Almeida et al. (1995)1.37 13.0 NDc Iembo et al. (2006)

0

20

40

60

80

100

120

4 5 6 7 8 9 10 11 12pH

Rel

ativ

e ac

tivity

(%)

Xyl43A Xyl43B Xyn11A

0

20

40

60

80

100

120

2 3 4 5 6 7 8 9 10 11 12pH

Rel

ativ

e ac

tivity

(%)

Xyl43A Xyl43B Xyn11A

0

20

40

60

80

100

120

20 30 40 50 60 70 80Tempreture (°C)

Rel

ativ

e ac

tivity

(%)

Xyl43A Xyl43B Xyn11A

020406080

100120

0 10 20 30 40 50 60Time (min)

Rel

ativ

e ac

tivity

(%)

Xyl43A 40°C Xyl43A 50°C Xyl43B 40°C

Xyl43B 50°C Xyn11A 50°C Xyn11A 60°C

A B

C D

Fig. 2. Characterisation of purified Xyl43A, Xyl43B and Xyn11A. (A) Effect of pH on enzyme activities. (B) pH stabilities of xylanases. (C) Effect of temperature on enzymeactivities. (D) Thermostability assay of enzymes. Each value in the panel represents the means ± SD (n = 3).

Table 3Effect of metal ions and chemical reagents (5 mM) on the activities of purified b-xylosidases Xyl43A and Xyl43B and xylanase Xyn11A from H. insolens Y1.

Chemicals Relative activity (%)a

Xyl43A Xyl43B Xyn11A

Control 100 ± 0.3 100 ± 0.4 100 ± 0.5Ag+ 0 13.2 ± 1.1 86.7 ± 0.7Li+ 71.9 ± 0.7 82.6 ± 0.9 109 ± 1.2Pb2+ 28.7 ± 0.5 124 ± 2.1 91.7 ± 0.8Ca2+ 151 ± 0.6 99.3 ± 1.2 91.2 ± 0.6Cu2+ 16.7 ± 0.1 1.8 ± 0.1 85.7 ± 0.4Cr3+ 10.3 ± 0.3 78.9 ± 0.7 81.0 ± 2.1Co3+ 10.5 ± 0.7 0 103 ± 1.1Mn2+ 127 ± 1.6 113 ± 1.1 117 ± 0.9Fe3+ 27.4 ± 0.2 95.1 ± 0.8 103 ± 0.2Ni2+ 13.0 ± 0.3 0 109 ± 0.4Mg2+ 61.5 ± 0.3 53.6 ± 0.5 96.8 ± 0.7Zn2+ 0 0 102 ± 1.4EDTA 6.9 ± 0.6 86.9 ± 1.4 93.3 ± 0.2SDS 2.4 ± 0.1 1.7 ± 0.2 52.6 ± 0.8b-Mercaptoethanol 101 ± 1.4 26.5 ± 0.7 162 ± 1.8

a Values represent the mean ± SD (n = 3) relative to untreated control samples.

X. Yang et al. / Food Chemistry 148 (2014) 381–387 385

greater than 8.0 (Polizeli et al., 2005), Xyn11A was an alkali-toler-ant enzyme, exhibiting 50.6% of activity at pH 9.0, and 26.9% evenat pH 10.0. Only a few GH11 xylanases showed a similar alkali-tol-erant property, such as xylanase I from Fusarium oxysporum F3(Christakopoulos, Nerinckx, Kekos, Macris, & Claeyssens, 1996),XynII from Acrophialophora nainiana (Salles, Cunha, Fontes, Sousa,& Filho, 2000), and Xyn2 from H. grisea var. thermodiea (Paëset al., 2012). Xyn11A was highly stable over a broad pH range ofpH 4.0–12.0, retaining more than 70% of its initial enzyme activi-ties (Fig. 2B). The enzyme had maximal activities at 60 �C(Fig. 2C), and was stable at temperatures of 50 �C and below(Fig. 2D), which were similar to other family 11 xylanases frommesophilic fungi.

The effects of various metal ions and chemical reagents on theenzyme activities of Xyl43A, Xyl43B, and Xyn11A are shown in Ta-ble 3. Xyl43A activity was significantly inhibited by most of the

tested chemicals, except for Mn2+, Ca2+, and b-mercaptoethanol,while Mn2+, Pb2+, Ca2+, and Fe3+ had no negative effects on Xyl43Bactivity. Apparent activation by Mn2+ and Ca2+ has been reported inb-xylosidases from P. thermophila J18 (Yan et al., 2008), H. griseavar. thermoidea (Iembo et al., 2006), Fusarium proliferatum (Saha,2003b), and Scytalidium thermophilum (Zanoelo, Polizeli, Terenzi,& Jorge, 2004). These two metal ions might activate and protectthe active centre of b-xylosidases. Different from most xylanasesthat are sensitive to SDS, Xyn11A was resistant to all tested chem-icals and retained an activity of 52.5% in the presence of 5 mM SDS.Considering this SDS tolerance was important in detergent andtextile solutions, Xyn11A might represent a potential candidatein these industries (Polizeli et al., 2005).

3.4. Tolerance of Xyl43A and Xyl43B to xylose

b-Xylosidase is the key enzyme to convert xylooligosaccharidesto xylose, the main end-product of xylan. Thus, xylose is a stronginhibitor of b-xylosidase. Some fungal b-xylosidases, such as thosefrom Aureobasidium pullulans (Ohta, Fujimoto, Fujii, & Wakiyama,2010), Trichoderma reesei (Ximenes, Silveira, & Filho, 1996),F. proliferatum (Saha, 2003b) and H. grisea var. thermoidea (Almeidaet al., 1995), are sensitive to xylose and exhibit Ki values as low as 2to 10 mM. Compared with these b-xylosidases, Xyl43A and Xyl43Bwere highly tolerant to xylose, with Ki values of 79 and 292 mM,respectively (Table 2). Similar tolerance to xylose has beenreported in TlXyl43 (Ki 63 mM; Chen et al., 2012), PtXyl43 (Ki

139 mM; Yan et al., 2008), and the b-xylosidase from S. thermophilum(Ki > 200 mM; Zanoelo et al., 2004), and Tth xynB3 from T. thermarum(Ki 1000 mM; Shi, Li, et al., 2013). The tolerance to high concentra-tions of xylose makes these b-xylosidases potential for applicationsin conversion of hemicellulose.

3.5. Substrate specificities and kinetic parameters

Both Xyl43A and Xyl43B were most active on pNPX (100%),moderate on pNPA (23.7% and 56.6%, respectively), and weak on

Table 4Simultaneous or sequential hydrolysis reactions by Xyn11A, Xyl43A and Xyl43B against three xylan substrates.a

Enzyme added Birchwood xylanb Beechwood xylanc Wheat arabinoxyland

First reaction Second reaction Xylose equivalents(mM)

Synergye Xylose equivalents(mM)

Synergy Xylose equivalents(mM)

Synergy

Xyn11A None 6.88 ± 0.88 – 7.90 ± 0.71 – 6.61 ± 0.41 –Xyl43A None 0.65 ± 0.15 – 0.87 ± 0.20 – 0.45 ± 0.09 –Xyl43B None 0.51 ± 0.25 – 0.59 ± 0.18 – 0.54 ± 0.05 –Xyn11A + Xyl43A None 9.19 ± 0.71 1.22⁄ 10.16 ± 0.70 1.16⁄ 7.42 ± 0.66 1.05⁄

Xyn11A + Xyl43B None 8.72 ± 0.56 1.18⁄ 8.29 ± 0.54 0.98⁄ 7.67 ± 0.43 1.07⁄

Xyn11A + Xyl43A+Xyl43B None 9.32 ± 0.34 1.16⁄ 8.57 ± 0.77 0.91⁄ 7.97 ± 0.19 1.05⁄

Xyn11A Xyl43A 9.06 ± 0.22 1.21⁄ 10.56 ± 0.80 1.20⁄ 7.49 ± 0.49 1.06⁄

Xyn11A Xyl43B 9.50 ± 0.01 1.29⁄ 10.38 ± 0.84 1.22⁄ 7.90 ± 0.67 1.11⁄

Xyn11A Xyl43A + Xyl43B 9.38 ± 0.75 1.17⁄ 10.89 ± 0.01 1.16⁄ 7.88 ± 0.76 1.04⁄

Xyl43A Xyn11A 8.64 ± 0.14 1.15⁄ 10.27 ± 0.48 1.17⁄ 7.31 ± 0.45 1.04⁄

Xyl43B Xyn11A 8.19 ± 0.17 1.11⁄ 7.70 ± 0.21 0.91⁄ 7.35 ± 0.70 1.03⁄

Xyl43A + Xyl43B Xyn11A 8.37 ± 0.18 1.05⁄ 10.36 ± 0.13 1.11⁄ 7.72 ± 0.62 1.02⁄

a Simultaneous reactions refer to the reactions with two or three enzymes added simultaneously; sequential reactions refer to the reactions with enzymes addedsequentially.

b Birchwood xylan: the arabinose:xylose ratio of �1:90.c Beechwood xylan:the arabinose:xylose ratio of �1:90.d Water-soluble wheat arabinoxylan: the arabinose:xylose:other sugars ratio of �37:61:2.e Synergy degree is defined as the ratio of xylose equivalents from simultaneous or sequential enzyme combinations to the sum of that released by the individual enzymes.

The data marked with ⁄ means the enzymatic reaction is significant at P < 0.05 (Tukey’s test by OriginPro 8).

386 X. Yang et al. / Food Chemistry 148 (2014) 381–387

beechwood xylan (15.9% and 5.7%, respectively) and birchwood xy-lan (15.2% and 2.7%, respectively). The enzymes were able to attackxylooligosacchardies with degrees of polymerisation of 2–5, releas-ing the amounts of reducing sugars in the order of xylopen-tose > xylotetraose > xylotriose > xylobiose, i.e. the rate of xylosereleased from xylooligosacchardies increased with the chainlength. No activity was detected in the presence of CMC-Na, sugarbeet arabinan, AZCL-arabinan (debranched), 4-nitrophenyl a-D-galactopyranoside, 2-nitrophenyl b-D-galactopyranoside, and 4-nitrophenyl a-D-glucopyranoside. The results indicated thatXyl43A and Xyl43B were bifunctional b-xylosidase/a-L-arabinosid-ases with a low level of xylanase activity. As the members of GH43are heterogeneous, their substrate specificities are varied. Forexample, PtXyl43 from P. thermophila J18 showed a high activityagainst pNPX (100%) followed by pNPA (23.4%) (Yan et al., 2008);b-xylosidase S2 from P. herquei and XylB from A. oryzae acted solelyon pNPX (Ito et al., 2003; Suzuki et al., 2010). Compared with thesecounterparts, Xyl43A and Xyl43B had broader substrate specifici-ties and showed b-xylosidase, a-L-arabinosidase and xylanaseactivities.

The Km, Vmax, and kcat values of purified Xyl43A and Xyl43Busing pNPX as the substrate (Table 2) were 12.2 and 1.29 mM,203.8 and 2.18 lmol/min/mg, 330.5 and 2.1/min, respectively.Xyl43A had the highest kcat/Km ratio, 16.6 folds of that of Xyl43B,and degraded the substrates more efficiently. Most fungal GH43b-xylosidases have a Km value between 0.2 and 10 mM. The Km va-lue of Xyl43A (12.2 mM) was much higher, but Xyl43B’s Km valuewas within this range. The results indicated that Xyl43B has a high-er affinity to pNPX than Xyl43B.

The specific activities of Xyl43A and Xyl43B were 20.5 and1.7 U/mg, respectively, which were lower than the b-xylosidasefrom P. thermophila J18 (43.4 U/mg; Yan et al., 2008), TlXyl43 fromT. lanuginosus CAU44 (45.4 U/mg; Chen et al., 2012), and b-xylosi-dase S2 from P. herquei (224.6 U/mg; Ito et al., 2003).

Purified recombinant Xyn11A was most active on soluble wheatarabinoxylan (100%), moderate on beechwoodxylan (78.3%) andbirchwoodxylan (77.6%), and weak on insoluble wheat arabinoxy-lan (24.5%). It had no activity against barley b-glucan, CMC-Na, andAvicel. Using birchwood xylan as the substrate, the Km, Vmax, andspecific activity values of Xyn11A were 2.7 mM, 2100 lmol/min/mg, and 1275 U/mg. Thus, the alkaline-active, cellulose activity-

free Xyn11A with a high specific activity is generally preferredfor the biobleaching of paper pulp.

3.6. Xylan degradation by enzyme synergy

Cooperation between b-xylosidase and xylanase has the abilityto enhance the reducing sugar released from xylans, probably byrelieving end product inhibition (Kambourova et al., 2007). In thisstudy, both xylasidases (Xyl43A and Xyl43B) and GH11 xylanaseXyn11A had the ability to degrade the three tested xylan substrates(Table 4). Whether these enzyme combinations have synergistic ef-fects on xylan degradation was determined by simultaneous orsequential addition. Different enzyme combinations showed sig-nificant effects on xylan degradation (P < 0.05). Of the three simul-taneous reactions, the enzyme combination of Xyn11A and Xyl43Areleased more reducing sugars from birchwood xylan and beech-wood xylan, and the combination Xyn11A and Xyl43B was the bestfor wheat arabinoxylan. This difference might ascribe to the activ-ities of Xyl43A and Xyl43B towards different xylan substrates. Allcombinations of sequential or simultaneous enzyme additionshad very significant synergistic effects on birchwood xylan andwheat arabinoxylan degradation (1.04- to 1.29-fold), with thegreatest synergy found when first incubated with Xyn11A aloneand then with Xyl43A or Xyl43B. Similar observations have beenreported for the b-xylosidases from Bacillus thermantarcticus andP. thermophila (Lama, Calandrelli, Gambacorta, & Nicolaus, 2004;Yan et al., 2008). The reason might be that the small fragment-products of xylanase, such as xylooligosacchardies with non-reducing ends, were preferred substrates of b-xylosidase (Teleman,Tenkanen, Jacobs, & Dahlman, 2002). For beechwood xylan, thegreatest synergy under the same conditions was found. The syner-gistic effects on xylans can be attributed to the further hydrolysisof xylan products by b-xylosidase. However, Xyn11A followed bythe combination of Xyl43A and Xyl43B showed lower synergismthan that of Xyl43A or Xyl43B alone, suggesting that Xyl43A andXyl43B might compete with each other. Moreover, first additionof Xyl43B alone or simultaneous addition of Xyl43B and other en-zymes inhibited the degradation of beechwood xylan. The reasonmight be that Xyl43B bound on beechwood xylan, which furtherprotected the substrate from the attack of Xyn11A.

X. Yang et al. / Food Chemistry 148 (2014) 381–387 387

4. Conclusion

We identified two GH43 b-xylosidase and one GH 11 xylanasegenes in H. insolens Y1 and expressed their gene products inE. coli or P. pastoris. The recombinant proteins shared similar enzy-matic characteristics. Xyl43A and Xyl43B were both bifunctionalb-xylosidase/a-arabinosidases with little xylanase activities, andhad a high xylose tolerance. When degraded xylans were in eithera simultaneous or sequential combination, Xyn11A and Xyl43Aand/or Xyl43B released reducing sugars as high as 1.29 folds ofthe sum of that released by each enzyme. This study contributesto the formulation of optimised enzyme mixtures for the efficienthydrolysis of plant biomass.

Acknowledgments

This work was supported by National High TechnologyResearch and Development Program of China (863 Program, GrantNos. 2012AA022208 and 2012AA022105), and the National ScienceFoundation for Distinguished Young Scholars of China (Grant No.31225026).

References

Almeida, E. M., Polizeli, M. D. L., Terenzi, H. F., & Atilio Jorge, J. (1995). Purificationand biochemical characterisation of b-xylosidase from Humicola grisea var.thermoidea. FEMS Microbiology Letters, 130, 171–175.

Bastawde, K. (1992). Xylan structure, microbial xylanases, and their mode of action.World Journal of Microbiology and Biotechnology, 8, 353–368.

Chávez, R., Bull, P., & Eyzaguirre, J. (2006). The xylanolytic enzyme system from thegenus Penicillium. Journal of Biotechnology, 123, 413–433.

Chen, Z., Jia, H., Yang, Y., Yan, Q., Jiang, Z., & Teng, C. (2012). Secretory expression ofa b-xylosidase gene from Thermomyces lanuginosus in Escherichia coli andcharacterisation of its recombinant enzyme. Letters in Applied Microbiology, 55,330–337.

Christakopoulos, P., Nerinckx, W., Kekos, D., Macris, B., & Claeyssens, M. (1996).Purification and characterisation of two low molecular mass alkaline xylanasesfrom Fusarium oxysporum F3. Journal of Biotechnology, 51, 181–189.

Du, Y., Shi, P., Huang, H., Zhang, X., Luo, H., Wang, Y., et al. (2013). Characterisationof three novel thermophilic xylanases from Humicola insolens Y1 withapplication potentials in the brewing industry. Bioresource Technology, 130,161–167.

Henrissat, B., & Davies, G. (1997). Structural and sequence-based classification ofglycoside hydrolases. Current Opinion in Structural Biology, 7, 637–644.

Iembo, T., Azevedo, M., & Bloch, C. Jr, (2006). Purification and partialcharacterisation of a new b-xylosidase from Humicola grisea var. thermoidea.World Journal of Microbiology and Biotechnology, 22, 475–479.

Ito, T., Yokoyama, E., Sato, H., Ujita, M., Funaguma, T., Furukawa, K., et al. (2003).Xylosidases associated with the cell surface of Penicillium herquei IFO 4674.Journal of Bioscience and Bioengineering, 96, 354–359.

Jordan, D. B., & Wagschal, K. (2010). Properties and applications of microbial b-D-xylosidases featuring the catalytically efficient enzyme from Selenomonasruminantium. Applied Microbiology and Biotechnology, 86, 1647–1658.

Kambourova, M., Mandeva, R., Fiume, I., Maurelli, L., Rossi, M., & Morana, A. (2007).Hydrolysis of xylan at high temperature by co-action of the xylanase fromAnoxybacillus flavithermus BC and the b-xylosidase/-arabinosidase fromSulfolobus solfataricus Oalpha. Journal of Applied Microbiology, 102, 1586–1593.

Lama, L., Calandrelli, V., Gambacorta, A., & Nicolaus, B. (2004). Purification andcharacterisation of thermostable xylanase and b-xylosidase by the thermophilicbacterium Bacillus thermantarcticus. Research in Microbiology, 155, 283–289.

Luo, H., Wang, K., Huang, H., Shi, P., Yang, P., & Yao, B. (2012). Gene cloning,expression, and biochemical characterisation of an alkali-tolerant b-mannanasefrom Humicola insolens Y1. Journal of Industrial Microbiology and Biotechnology,39, 547–555.

Miller, G. L. (1959). Use of dinitrosalicylic acid reagent for determination ofreducing sugar. Analytical Chemistry, 31, 426–428.

Mozolowski, G., & Connerton, I. (2009). Characterisation of a highly efficientheterodimeric xylosidase from Humicola insolens. Enzyme and MicrobialTechnology, 45, 436–442.

Ohta, K., Fujimoto, H., Fujii, S., & Wakiyama, M. (2010). Cell-associated b-xylosidasefrom Aureobasidium pullulans ATCC 20524: Purification, properties, andcharacterisation of the encoding gene. Journal of Bioscience and Bioengineering,110, 152–157.

Paës, G., Berrin, J. G., & Beaugrand, J. (2012). GH 11 xylanases:Structure/function/properties relationships and applications. BiotechnologyAdvances, 30, 564–592.

Polizeli, M. L., Rizzatti, A. C., Monti, R., Terenzi, H. F., Jorge, J. A., & Amorim, D. S.(2005). Xylanases from fungi: Properties and industrial applications. AppliedMicrobiology and Biotechnology, 67, 577–591.

Raweesri, P., Riangrungrojana, P., & Pinphanichakarn, P. (2008). L-Arabinofuranosidase from Streptomyces sp. PC22: Purification, characterisationand its synergistic action with xylanolytic enzymes in the degradation of xylanand agricultural residues. Bioresource Technology, 99, 8981–8986.

Sagt, C., Kleizen, B., Verwaal, R., De Jong, M., Müller, W., Smits, A., et al. (2000).Introduction of an N-glycosylation site increases secretion of heterologousproteins in yeasts. Applied and Environmental Microbiology, 66, 4940–4944.

Saha, B. C. (2003a). Hemicellulose bioconversion. Journal of Industrial Microbiologyand Biotechnology, 30, 279–291.

Saha, B. C. (2003b). Purification and properties of an extracellular b-xylosidase froma newly isolated Fusarium proliferatum. Bioresource Technology, 90, 33–38.

Salles, B. C., Cunha, R. B., Fontes, W., Sousa, M. V., & Filho, E. X. F. (2000). Purificationand characterisation of a new xylanase from Acrophialophora nainiana. Journal ofBiotechnology, 81, 199–204.

Shi, P., Chen, X., Meng, K., Huang, H., Bai, Y., Luo, H., et al. (2013). Distinct actions byPaenibacillus sp. strain E18 a-L-arabinofuranosidases and xylanase in xylandegradation. Applied and Environmental Microbiology, 79, 1990–1995.

Shi, H., Li, X., Gu, H., Zhang, Y., Huang, Y., Wang, L., et al. (2013).Biochemical properties of a novel thermostable and highly xylose-tolerantb-xylosidase/a-arabinosidase from Thermotoga thermarum. Biotechnology forBiofuels, 6, 27.

Shi, P., Tian, J., Yuan, T., Liu, X., Huang, H., Bai, Y., et al. (2010). Paenibacillus sp. strainE18 bifunctional xylanase-glucanase with a single catalytic domain. Applied andEnvironmental Microbiology, 76, 3620–3624.

Suzuki, S., Fukuoka, M., Ookuchi, H., Sano, M., Ozeki, K., Nagayoshi, E., et al. (2010).Characterisation of Aspergillus oryzae glycoside hydrolase family 43 b-xylosidase expressed in Escherichia coli. Journal of Bioscience andBioengineering, 109, 115–117.

Teleman, A., Tenkanen, M., Jacobs, A., & Dahlman, O. (2002). Characterisation of O-acetyl-(4-O-methylglucurono)xylan isolated from birch and beech.Carbohydrate Research, 337, 373–377.

Teng, C., Jia, H., Yan, Q., Zhou, P., & Jiang, Z. (2011). High-level expression ofextracellular secretion of a b-xylosidase gene from Paecilomyces thermophila inEscherichia coli. Bioresource Technology, 102, 1822–1830.

Wegener, S., Ransom, R. F., & Walton, J. D. (1999). A unique eukaryotic b-xylosidasegene from the phytopathogenic fungus Cochliobolus carbonum. Microbiology,145, 1089–1095.

Ximenes, F. A., Silveira, F. Q. P., & Filho, E. X. F. (1996). Production of b-xylosidaseactivity by Trichoderma harzianum strains. Current Microbiology, 33, 71–77.

Yan, Q. J., Wang, L., Jiang, Z. Q., Yang, S. Q., Zhu, H. F., & Li, L. T. (2008). A xylose-tolerant b-xylosidase from Paecilomyces thermophila: Characterisation and itsco-action with the endogenous xylanase. Bioresource Technology, 99,5402–5410.

Zanoelo, F. F., Polizeli, M. L., Terenzi, H. F., & Jorge, J. A. (2004). Purification andbiochemical properties of a thermostable xylose-tolerant b-D-xylosidase fromScytalidium thermophilum. Journal of Industrial Microbiology and Biotechnology,31, 170–176.