[6] Dierksen KP, Tagg JR. Haemolysin-deficient variants of
Streptococcus pyogenes and S. dysgalactiae subsp. equisimi-
lis may be overlooked as aetiological agents of pharyngitis.
J Med Microbiol 2000;/49:/811�6.
[7] Taylor MB, Barkham T. Fatal case of pneumonia caused by a
non-haemolytic strain of Streptococcus pyogenes. J Clin
Microbiol 2002;/40:/2311�2.
[8] James L, McFarland RB. An epidemic of pharyngitis due to a
non-haemolytic group A streptococcus at Lowry Air Force
base. N Engl J Med 1971;/284:/750�2.
[9] Weightman NC, Barnham MRD. Report of unusual clinical
appearance in bacteraemia with non-haemolytic M-type 58
Streptococcus pyogenes. Indian J Med Res 2004;/
119(Suppl):/17�21.
[10] Cimolai N, Trombley C, Bhanju NM. Non-haemolytic
Streptococcus pyogenes causing invasive infection. Clin
Pediatr (Phila) 2002;/41:/453.
[11] Colebrook L, Elliott SD, Maxted WR, Morley CW, Mortell
M. Infection by non-haemolytic group A streptococci.
Lancet 1942;/2:/30�1.
[12] Betschel SD, Borgia SM, Barg NL, Low DE, De Azavedo
JC. Reduced virulence of group A streptococcal Tn916
mutants that do not produce streptolysin S. Infect Immun
1998;/66:/1671�9.
[13] Efstratiou A. Group A streptococci in the 1990s. J Anti-
microb Chemother 2000;/45:/3�12.
[14] Carapetis JR, McDonald M, Wilson NJ. Acute rheumatic
fever. Lancet 2005;/366:/155�68.
First detection of a VIM-1 metallo-b-lactamasein a carbapenem-resistant Citrobacter freundii clinical isolatein an acute hospital in Germany
JAN WEILE1, HARALD RAHMIG2, SABINE GFROERER3, KLAUS SCHROEPPEL1,
CORNELIUS KNABBE1 & MILORAD SUSA1
From the 1Department of Clinical Chemistry and Laboratory Medicine, Robert Bosch Hospital, Stuttgart, 2Department for
Anaesthesiology and Intensive Care Medicine, Hospital Waiblingen, Waiblingen, and 3Institute for Laboratory Medicine,
Marien Hospital, Stuttgart, Germany
AbstractWe report the first detection of a carbapenem-resistant Citrobacter freundii clinical strain in Germany. It was isolated froman abscess of a patient with acute necrotic pancreatitis in an acute hospital. PCR and sequencing experiments revealed thatthe carbapenem resistance was mediated by a VIM-1 metallo-b-lactamase, located on a plasmid encoded class 1 integron.Carbapenem resistance in Enterobacteriaceae is so far a rare event and 1 of the major therapeutic concerns in the future.
Introduction
Carbapenems such as imipenem, meropenem and
ertapenem possess the broadest spectrum of all
b-lactam antibiotics, showing excellent phamacody-
namic behaviour and stability against the vast variety
of b-lactamases. Especially their stability against
so-called extended-spectrum b-lactamases (ESBLs),
which are 1 of the major therapeutic concerns during
recent y with increasing prevalence [1], lead to
the frequent use of carbapenems for the initial,
calculated antibiotic therapy of severe infections
such as sepsis or pneumonia caused by Gram-
negative bacteria. Since they are quite often the
last resort in the treatment of multidrug-resistant
pathogens, carbapenem resistance needs to be
carefully monitored for surveillance and control
of resistance development [2]. Carbapenem resis-
tance is mainly due both to membrane permeability
alterations and the production of metallo-b-
lactamases (MBL) that belong to Ambler class
B enzymes [3]. These class B enzymes require
zinc ions for enzyme activity and demonstrate a
primary structure quite different from those of
class A (TEM) and C enzymes (AmpC). They
possess 1 or 2 zinc ions in the catalytic centre
of the enzyme and show the broadest substrate
spectrum of all known b-lactamases due to the lack
of target sites [4]. Besides penicillins and cephalos-
Correspondence: J. Weile, Department of Clinical Chemistry and Laboratory Medicine, Robert Bosch Hospital, Auerbachstrasse 110, 70376 Stuttgart,
Germany. Tel: �/49 0 711 8101 3734. Fax: �/49 0 711 8101 3618. E-mail: [email protected]
264 Case reports
(Received 13 June 2006; accepted 15 June 2006)
ISSN 0036-5548 print/ISSN 1651-1980 online # 2007 Taylor & Francis
DOI: 10.1080/00365540600868388
Scan
d J
Infe
ct D
is D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Mel
bour
ne o
n 09
/14/
14Fo
r pe
rson
al u
se o
nly.
porins they also confer resistance against carbape-
nems. Only the monobactam aztreonam is not
hydrolized by metallo-b-lactamases. Four distinct
types of MBLs - IMP, VIM, SPM, and GIM
enzymes - are known to date [5,6]. The imp and
vim genes were predominantly found in non-fer-
menting species such as Pseudomonas aeruginosa or
Acinetobacter baumannii. Nevertheless, the overall
prevalence of carbapenemases has remained low in
Enterobacteriaceae [7]. However, an increase of
reports from recent y being associated with carba-
penem resistance from other important clinical
genera emphasizes the clinical importance of carba-
penemases. An increased occurrence especially of
imp genes in Klebsiella pneumoniae and Serratia
marcescens was noted [7�9]. They were mostly
found to be part of mobile gene cassettes inserted
in class 1 integrons. Therefore, a horizontal resis-
tance gene transfer to other Gram-negative genera is
quite likely.
Case report
An 80-y-old female with 3 d of diffuse abdominal
pain and vomiting was presented to the emergency
department. Physical examination revealed that
the patient had peritoneal signs, a slightly elevated
WBC count, increased inflammatory marker
and elevated pancreatic enzymes. A CT scan re-
vealed an exudative pancreatitis without necrosis.
The patient was admitted to the ICU and supportive
as well an antimicrobial therapy with imipenem/
cilastin (3 g/d) administered. Two weeks later
the patient status deteriorated with increased
septic signs. She underwent respiratory support
and CT revealed necrotizing pancreatitis. A routine
laboratory examination was performed with
expiration of necrotic tissue and abscess drainage.
Bacteroides sp. was yielded on an intraoperative
specimen and blood culture. Antibiotic therapy
with imipenem/cilastin was continued for the
next 10 d without improvement. Thereafter,
Pseudomonas aeruginosa and Citrobacter freundii,
both resistant to imipenem, were isolated from
drainage effluent. The patient was treated with
ciprofloxacin (800 mg/d, parenteral) for the next
14 d and the abscess was washed with colistin
(5*106 U/d). The patient showed significant im-
provement and was discharged to a normal ward
after 45 d in the ICU.
Microbiology
Species identification and antibiotic susceptibility
testing by microdilution and E-test were performed
by standard laboratory tests according to CLSI
guidelines. The isolates were cultured on blood
agar for subsequent analyses.
Sequence analyses. PCR amplification of the vim
gene was performed, using vim consensus primers
(vim_for TGATACAGCGTGGGGTGCGAAAAA;
vim_rev GTGCCCCGGAATGACGAACTGTG).
The PCR conditions consisted of 4 min initial
denaturation at 95C, 35 cycles of 30 s at 95C,
30 s at 55C, and 1 min at 72C, respectively, followed
by 5 min at 72C for terminal elongation. The
expected PCR product had a size of 430 bp
and was confirmed by lab-on-a-chip capillary
electrophoresis. Sequencing of the PCR product
was performed via capillary sequencing. Both
strands were sequenced using the same primers as
for vim PCR amplification. The genetic context was
further investigated by primer walking and sequen-
cing [10].
Results and discussion
The C. freundii clinical isolate was resistant
against all b-lactam antibiotics including the carba-
penems imipenem, meropenem and ertapenem
except for the monobactam aztreonam (piperacillin
�/64 mg/ml, cefotaxime �/32 mg/ml, ceftazidime
�/16 mg/ml, cefepime �/16 mg/ml, imipenem �/32
mg/ml, meropenem �/32 mg/ml, ertapenem �/32 mg/
ml, aztreonam B/8 mg/ml, ciprofloxacin B/1 mg/ml,
levofloxacin B/2 mg/ml). This result suggested the
presence of a MBL since it was in complete
accordance with the substrate spectrum of, e.g.
VIM MBL. Therefore, subsequent PCR analysis
was performed and sequencing experiments revealed
the presence of a vim-1 MBL gene in the C. freundii
isolate. The genetic context was further investigated
and showed that the detected vim-1 gene was part of
a plasmid encoded class 1 integron containing 3 gene
cassettes. Besides the vim-1 gene, genes for the
aminoglycoside modifying enzymes, aac(6 ?)-Ib and
aph(3 ?), were identified. The genetic analysis of the
imipenem resistance phenotype of the P. aeruginosa
strain isolated in parallel showed that this resistance
was mediated by a mutation in the mexT gene
[11,12], leading to the loss of the outer membrane
porin OprD. Additionally, no vim genes were
detected and the strain did not carry any plasmid.
This result excludes the possibility of a horizontal
MBL gene transfer from the P. aeruginosa isolate to
the C. freundii isolate.
To our knowledge, this is the first confirmed
description of a VIM-1 MBL in a member of the
Enterobacteriaceae family in Germany. The finding
demonstrates the worldwide observed ongoing
Case reports 265
Scan
d J
Infe
ct D
is D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Mel
bour
ne o
n 09
/14/
14Fo
r pe
rson
al u
se o
nly.
spread of MBLs in Enterobacteriaceae and empha-
sizes the need of an epidemiological surveillance at a
genetic level to monitor and control this major
therapeutic concern.
Acknowledgements
The authors would like to thank the PathoGenoMik
Project of the German Ministry for Education and
Research (BMBF) and the Robert Bosch Founda-
tion for financial support.
References
[1] Bradford PA. Extended-spectrum {beta}-lactamases in the
21st century: Characterization, epidemiology, and detection
of this important resistance threat. Clin Microbiol Rev 2001;/
14:/933�51.
[2] Livermore DM, Woodford N. Carbapenemases: a problem
in waiting? Curr Opin Microbiol 2000;/3:/489�95.
[3] Ambler RP, Coulson AF, Frere JM, Ghuysen JM, Joris B,
Forsman M, et al. A standard numbering scheme for class A
beta-lactamases. Biochem J 1991;/15:/269�70.
[4] Poirel L, Nordmann P. Acquired carbapenem-hydrolyzing
beta-lactamases and their genetic support. Curr Pharm
Biotechnol 2002;/3:/117�27.
[5] Livermore DM. Multiple mechanisms of antimicrobial
resistance in Pseudomonas aeruginosa: our worst nightmare?
Clinical Infectious Diseases 2002;/34:/634�40.
[6] Toleman MA, Simm AM, Murphy TA, Gales AC, Bieden-
bach DJ, Jones RN, et al. Molecular characterization of
SPM-1, a novel metallo-beta-lactamase isolated in Latin
America: report from the SENTRY antimicrobial surveil-
lance programme. J Antimicrob Chemother 2002;/50:/673�9.
[7] Lartigue M-F, Poirel L, Nordmann P. First detection of a
carbapenem-hydrolyzing metalloenzyme in an Enterobacter-
iaceae isolate in France. Antimicrob Agents Chemother
2004;/48:/4929�30.
[8] Henrichfreise B, Wiegand I, Sherwood KJ, Wiedemann B.
Detection of Vim-2 metallo-beta-lactamase in Pseudomonas
aeruginosa from Germany. Antimicrob Agents Chemother
2005;/49:/1668�9.
[9] Lee K, Lim JB, Yum JH, Yong D, Chong Y, Kim JM, et al.
bla(VIM-2) cassette-containing novel integrons in
metallo-beta-lactamase-producing Pseudomonas aeru-
ginosa and Pseudomonas putida isolates disseminated in a
Korean hospital. Antimicrob Agents Chemother 2002;/46:/
1053�8.
[10] Levesque RC, Piche L, Larose C, Roy PH. PCR mapping
of integrons reveals several novel combinations of
resistance genes. Antimicrob Agents Chemother 1995;/39:/
185�91.
[11] Maseda H, Saito K, Nakajima A, Nakae T. Variation of the
mexT gene, a regulator of the MexEF-oprN efflux pump
expression in wild-type strains of Pseudomonas aeruginosa.
FEMS Microbiol Lett 2000;/192:/107�12.
[12] Ochs MM, McCusker MP, Bains M, Hancock REW.
Negative regulation of the Pseudomonas aeruginosa outer
membrane porin OprD selective for imipenem and basic
amino acids. Antimicrob Agents Chemother 1999;/43:/1085�90.
Infective endocarditis of the tricuspid valve caused by Staphylococcusaureus after ear piercing
ALES KOVARIK, MAREK SETINA, MIREK SULDA, PETRA PAZDERKOVA &
ALES MOKRACEK
From the Kardiocentrum Nemocnice Ceske Budejovice, Czech Republic
AbstractRight-sided endocarditis usually involves the tricuspid valve, predominantly in intravenous drug abusers, in patients withanti-arrhythmic devices or central venous lines, and in patients with skin or genitourinary infection and with congenital heartdisease [1]. We describe a case of a 15-y-old patient, who had tricuspid valve endocarditis in a morphologically normal valveafter having his ear pierced, without history of parenteral drug addiction and vascular catheter use. Progression of vegetationsize and development of tricuspid valve regurgitation in spite of the intensive antibiotic treatment eventually requiredsurgical intervention.
Correspondence: A. Kovarik, Kardiocentrum Nemocnice Ceske Budejovice, Bozeny Nemcove 54, 370 87 Ceske Budejovice, Czech Republic. E-mail:
266 Case reports
(Received 14 June 2006; accepted 16 June 2006)
ISSN 0036-5548 print/ISSN 1651-1980 online # 2007 Taylor & Francis
DOI: 10.1080/00365540600868396
Scan
d J
Infe
ct D
is D
ownl
oade
d fr
om in
form
ahea
lthca
re.c
om b
y U
nive
rsity
of
Mel
bour
ne o
n 09
/14/
14Fo
r pe
rson
al u
se o
nly.
Top Related