Download - Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

Transcript

Page 1: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

بسم الله الرحمن الرحیم

1

Page 2: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

2

Expression of N-terminal seven amino acids peptide of

fibrin (β–peptide) on surface of M13KO7 phage

Supervisor: Dr. Hossein KhanahmadAref Farrokhi [email protected]

Page 3: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

3

Introduction

Page 4: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

4

Vascular accidents

• Acute myocardial infarction

• Cerebrovascular accident (CVA) or acute cerebral infarction

• Pulmonary thromboembolism

Page 5: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

5

Page 6: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

6

Fibrinolytic drugs for therapy

Urokinase (UK) Streptokinase (SK) Recombinant Tissue plasminogen activator

(rTPA)

Side effects:

• Low efficiency • Hemorrhage

Page 7: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

7

Clot targeting for preventing

side effects and elevating the

fibrinolysis efficiency Local enrichment using fibrin targeting : Specific anti fibrin antibody(MA-15C5), 59D8): Chemical conjugation Fusion protein(Ab-E)

Nanobody

Scfv FabWhole

Ab

Fv fragmen

t

Page 8: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

8

Material and methods

Page 9: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

9

Page 10: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

10

fibrinogen beta chain isoform 1 preproprotein

[Homo sapiens]

Beta-peptide as an antigen

Gly-His-Arg-Pro-Leu-Asp-LysFSARGHRPLDKKREE

45-52

NCBI Reference Sequence: NP_005132.2

Page 11: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

11

Page 12: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

12

Bam HI

2220

BsrG I

10211119 bp

7550 bp

GTCTGTACACCGTTCATCTGTCC

TGGATCCTCATTAAAGCCAGAA

Page 13: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

13

1301..1522

1579..2853

gene="V" CDS 843..1106

Page 14: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

14

After overlap PCR

1. Agarose gel electrophoresis of PCR product2. Gel extraction3. Ligation between ABC fragment and plasmid

backbone

1179 bp

8729 bp7550 bp

Page 15: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

15

Page 16: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

16

After transformation to top10

Plasmid extraction from transformed top10 bacteria

Transformation of phage genome to TG1

PCR on recombinant phage genome

Confirmation by sequencing

Obtaining phages from culture for SDS PAGE

Page 17: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

17

SDS PAGE

Page 18: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

18

Page 19: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

19

Page 20: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

20

Thank you for your attention

Page 21: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

21

Page 22: Expression of N-terminal seven amino acids peptide of fibrin (β–peptide) on surface of M13KO7 phage

22

Top Related

Peptide Mapping Infographic · Title: Peptide Mapping Infographic Subject: Infographic 72150 Keywords: ST72150; ST 72150; HRAM; MS; MS/MS; Mass Spectrometry; High Resolution Accurate

Peptide Mapping Infographic · Title: Peptide Mapping Infographic Subject: Infographic 72150 Keywords: ST72150; ST 72150; HRAM; MS; MS/MS; Mass Spectrometry; High Resolution Accurate

Antibacterial Properties of hLf1-11 Peptide onto Titanium ...

Antibacterial Properties of hLf1-11 Peptide onto Titanium ...

Bacterial phage 3

Bacterial phage 3

Peptide ligation by chemoselective aminonitrile coupling in ......Our model unites prebiotic aminonitrile synthesis and biological a-peptides, suggesting short N -acyl peptide nitriles

Peptide ligation by chemoselective aminonitrile coupling in ......Our model unites prebiotic aminonitrile synthesis and biological a-peptides, suggesting short N -acyl peptide nitriles

Dependence of Self-Assembled Peptide Hydrogel Network ... · PDF fileDependence of Self-Assembled Peptide Hydrogel Network Structure on ... (VDPPT) that folds into a facially amphiphilic

Dependence of Self-Assembled Peptide Hydrogel Network ... · PDF fileDependence of Self-Assembled Peptide Hydrogel Network Structure on ... (VDPPT) that folds into a facially amphiphilic

Chemistry of Peptide Materials · 2013-06-06 · PyBOP (Benzotriazol-1-yloxy)tripyrrolidinophosphonium SPPS Solid-phase peptide synthesis TBTU 2-(1H-1,2,3-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium

Chemistry of Peptide Materials · 2013-06-06 · PyBOP (Benzotriazol-1-yloxy)tripyrrolidinophosphonium SPPS Solid-phase peptide synthesis TBTU 2-(1H-1,2,3-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium

T4 | s %O>bunshi4.bio.nagoya-u.ac.jp/~bunshi4/class/13bunshiiden/...T4 | s %O> | 19 11. Photograph of phage T2 plaques on a lawn of E. coli bacteria T2 phage T2 mutant phage T2 r :

T4 | s %O>bunshi4.bio.nagoya-u.ac.jp/~bunshi4/class/13bunshiiden/...T4 | s %O> | 19 11. Photograph of phage T2 plaques on a lawn of E. coli bacteria T2 phage T2 mutant phage T2 r :

Interactions between an amyloid beta peptide, …...peptide-cell membrane interactions are influenced by the peptide conformation, amount of peptide in interaction with cell membrane,

Interactions between an amyloid beta peptide, …...peptide-cell membrane interactions are influenced by the peptide conformation, amount of peptide in interaction with cell membrane,