ARTICLE

Characterization of IncA/C conjugative plasmid harboringblaTEM-52 and blaCTX-M-15 extended-spectrum β-lactamasesin clinical isolates of Escherichia coli in Tunisia

C. Chouchani & A. El Salabi & R. Marrakchi &L. Ferchichi & T. R. Walsh

Received: 17 August 2011 /Accepted: 27 August 2011 /Published online: 22 September 2011# Springer-Verlag 2011

Abstract To characterize the extended-spectrum β-lactamases (ESBLs) as well as their genetic environment indifferent isolates of Escherichia coli from patients withrepeated urinary tract infections, large multidrug resistance(MDR) plasmids have been found. Definitive evidence forthe presence of an A/C incompatibility complex (IncA/C)plasmid in the MDR isolates was provided by the probing ofplasmids extracted from the clinical isolates. Conjugationexperiments showed that bla genes were transferred byconjugation from the ten E. coli clinical isolates to E. coliXL1-Blue recipient. A comparative restriction fragment lengthpolymorphism (RFLP) analysis of these plasmids showed thatthey are genetically similar, while the overall similarity ofthese plasmids supports the likelihood of recent movements

among these E. coli isolates. Polymerase chain reaction(PCR) amplification and sequencing of the amplicons showedthat the IncA/C plasmids harbor two ESBLs, identified asTEM-52 and CTX-M-15. Analysis of the plasmid DNAsurrounding the blaCTX-M-15 gene in the clinical isolates understudy revealed a partially truncated fragment of ISEcp1 tnpAtransposase. This result indicates the variety of genetic eventsthat have enabled associations between ISEcp1 sequencesand blaCTX-M-15 genes in these clinical isolates.

Introduction

Resistance to extended-spectrum β-lactam antibiotics ismainly caused by extended-spectrum β-lactamases(ESBLs), such as blaTEM, blaSHV, and blaCTX-M [1].Classical ESBLs have evolved from the broad-spectrumTEM-1- and TEM-2-type enzymes by amino acid sub-stitutions [2, 3]. Recently, the number of known TEM-typeESBL variants isolated from clinical strains has increasedand continues to rise; it is an indication of the ongoingevolution of these enzymes (Jacoby G. and Bush K.; http://www.lahey.org/Studies/). Several types of non-TEM andnon-SHV ESBLs (e.g., CTX-M, PER, VEB, GES, TLA,BES, and BEL) have also emerged in Gram-negativebacteria [2, 3]. CTX-M-type β-lactamases were firstdescribed in 1989 and are likely to spread successfully; todate, 86 variants have been found (http://www.lahey.org/Studies/). They are clustered in five subgroups (1, 2, 8, 9,and 25), according to their amino acid homology [4, 5].

The CTX-M-type β-lactamases represent a rapidlyemerging group with a typical phenotype of ESBLresistance [5]. In the past few years, ESBLs of the CTX-M type have been increasingly reported in members of theEnterobacteriaceae family worldwide [6]. Currently, the

C. Chouchani (*) : R. MarrakchiInstitut Supérieur des Sciences et Technologies del’Environnement de Borj-Cedria, Technopôle de Borj-Cedria,Université de Carthage,BP-1003, Hammam-Lif 2050, Tunisiae-mail: chdoula77@yahoo.fr

A. El Salabi : T. R. WalshDepartment of Infection, Immunity & Biochemistry,School of Medicine, Cardiff University,Heath Park,Cardiff CF14 4XN, UK

R. MarrakchiFaculté des Sciences de Tunis, Campus Universitaire,2092 El-Manar II, Tunisia

L. FerchichiLaboratoire de Bactériologie, Hôpital Régionale de Kasserine,1200 Kasserine, Tunisia

T. R. WalshCentre for Clinical Research, University of Queensland,Herston, QLD 4169, Australia

Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087DOI 10.1007/s10096-011-1410-z

CTX-M β-lactamases are almost certainly the mostwidespread ESBLs [5].

Several resistance mechanisms have apparently beeninvolved in the acquisition of blaCTX-M genes. Insertionsequences (IS) IS26, ISEcp1 and ISCR1, in associationwith class 1 integron structures, as well as phage-relatedelements, seem to have played a prominent role in theseprocesses [6]. Moreover, ISEcp1 elements and other ISconstitute an alternative promoter region [7], leading toincreased and enhanced expression of clinically relevantblaCTX-M genes, which are only weakly expressed in theirnatural reservoirs [7, 8].

In nosocomial isolates, blaCTX-M genes are mostly locatedon large plasmids ranging in size from 40 to over 200 kb [9].They belong to a wide variety of incompatibility groups (Incgroups), mostly IncF, I, N, P, and H, but IncA/C and L/Mhave also been found [10]. A large number of them areconjugative, facilitating intra- and interspecies spread [11].Here, we report on the phenotypic and genotypic analyses ofa collection of ESBL-producing E. coli isolates in aTunisian hospital. We elucidate the first dissemination ofIncA/C plasmids harboring blaTEM-52 and blaCTX-M-15 encod-ing genes among E. coli clinical isolates and their geneticenvironment in Tunisia. Analysis of the genetic environmentof blaCTX-M genes can reveal details of their acquisition inregard to their origin and further dissemination.

Materials and methods

Bacterial isolates and susceptibility testing

ESBL-producing isolates of E. coli (EC1, EC2, EC3,TEC4, EC5, EC6, EC7, EC8, EC9, and EC10) wereisolated from patients with urinary tract infections (UTIs)admitted to Kasserine Hospital, Tunisia, and who weretreated with amoxicillin–clavulanic acid for 5 months. Thebacteria were identified by the Phoenix automated pheno-typic identification criteria (Becton Dickinson, Oxford,UK). The minimum inhibitory concentrations (MICs) ofthe antimicrobial agents amoxicillin, amoxicillin–clavulanicacid, piperacillin, cefotaxime, cefotaxime plus clavulanicacid, ceftazidime, ceftazidime plus clavulanic acid, cefe-pime, aztreonam, and imipenem were determined by theEtest (AB Biodisk, Solna, Sweden), according to themanufacturer’s instructions. The ESBL phenotype wasdetermined with the corresponding Etest strips; cefotaxime,ceftazidime, and cefepime with clavulanic acid.

Amplification and sequencing of blaTEM and blaCTX-M genes

The occurrence of blaTEM and blaCTX-M resistance geneswas detected by polymerase chain reaction (PCR) amplifi-

cation. The primers used for PCR amplification are shownin Table 1. The bacterial DNA of the ten isolates wasprepared by suspending one loop of a fresh colony in500 μl of sterile distilled water and heated at 95°C for10 min. PCR amplification of the blaTEM and blaCTX-Mgenes was carried out under the following conditions: 95°Cfor 5 min, followed by 35 cycles of 95°C for 1 min, 60°Cfor 1 min, 72°C for 1 min, and 72°C for 10 min.

The amplicons were purified and sequencing wasperformed using corresponding primers specific for theblaTEM and blaCTX-M genes according to the method ofSanger et al. [16], using an automated sequencer (ABIPRISM 377, PerkinElmer, Shelton, CT, USA).

Conjugation experiments

The transference of resistance mechanisms was conductedusing E. coli XL1-Blue MRF’ Kan strains (StratageneEurope, Amsterdam, The Netherlands) as a recipient.Overnight mating experiments were performed at 37°Cwithout shaking, and the transconjugants TEC1, TEC2,TEC3, TEC4, TEC5, TEC6, TEC7, TEC8, TEC9, andTEC10, obtained respectively from EC1, EC2, EC3, TEC4,EC5, EC6, EC7, EC8, EC9, and EC10, were selected onMacConkey agar plates supplemented with ampicillin(50 mg/L) and kanamycin (50 mg/L).

Plasmid isolation and gel hybridization

E. coli plasmids were isolated using the QIAGEN PlasmidMaxi Kit (QIAGEN, West Sussex, UK), according to themanufacturer’s instructions. Plasmid profiles were deter-mined on 0.8% agarose gels prepared in Tris–Borate–EDTA buffer, pH 8.0, stained with ethidium bromide, andphotographed with an Imagemaster digital camera.

The gel was then dried overnight on a Whatman blottingfilter paper (15 cm×15 cm), and then rehydrated, denaturedusing a denaturing buffer (0.5 M NaOH, 1.5 M NaCl) for30 min at room temperature, and neutralized using aneutralizing solution (0.5 M Tris-HCl, pH 7.5, 1.5 M NaCl)for 30 min at room temperature. The gel was thentransferred to a hybridization tube containing prehybridiza-tion solution (6X SSC, 0.1% (W/V) polyvinylpyrrolidine(PVP), 1 ml of 0.5% (W/V) SDS, 400 μl of 0.1% (W/V)Ficoll, 400 μl of milk, and 300 μl of 150 μg/ml denaturedspermatozoid DNA), incubated overnight at 65°C.

IncA/C plasmid probe labeling

In order to determine if the resistance genes were present onan IncA/C plasmid, PCR-based analysis was performedusing a positive control, in the form of the IncA/C plasmid(kindly provided by Professor Timothy R. Walsh, Department

1082 Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087

of Medical Microbiology, School of Medicine, CardiffUniversity, UK). The conserved regions of the above IncA/Cplasmid were amplified using specific primers (Table 1). 15 μlof the purified template PCR product was mixed with 8 μl ofDNA-free water and 10 μl of random 9-mer primers (AgilentTechnologies – Stratagene – USA Products) and added into ascrew-capped Eppendorf tube. The mixture was firstly boiledin a water bath for 5 min and, immediately following, 10 μlof 5X dCTP buffer (Agilent Technologies – Stratagene –USA Products), 2.5 μl of the radioactive phosphorus 32P(PerkinElmer, Boston, MA, USA), and 1 μl of Exo(−)Klenow (Agilent Technologies – Stratagene – USA Products)were added to the mixture and transferred to a jar made of leadand incubated at 37°C for 15 min to allow the production ofradio-labeled IncA/C plasmid template DNA. The radio-labeled product was then pipetted into a silica gel column(NICK™columns Sephadex, G-50 DNA Grade, illustra, GEHealthcare Life Sciences, UK). The column was then washedtwice, once with 320 μl of washing buffer (0.1 M Tris-HclBuffer, PH 7.5), followed by 430 μl of the same washingbuffer to elute the purified radio-labeled gene. The radio-labeled PCR product was then boiled in a water bath for 6 minto denature the double-stranded template DNA. The probewas then added to the incubated gel in the hybridization tubeand incubated overnight at 65°C.

In-gel hybridization

The hybridized gel was subsequently probed with a radio-labeled IncA/C plasmid template DNA and incubatedovernight. After probing, the gel was then washed twice,once with 2X SSC (Sodium Citrate), 0.1% (W/V) SDS andonce with 0.1X SSC, 0.1% (W/V) SDS. The gel was thenwrapped in cling film and Hyperfilm™ (Amersham, GEHealthcare Life Sciences, UK) was firmly pressed on thegel in a cassette and frozen at −80°C for 18 h. Developerand fixer were used to detect the appearance of any radio-labeled spot on the Hyperfilm™.

Plasmid restriction fragment length polymorphisms(RFLPs)

Plasmid DNA extracted from E. coli EC1 to EC10 wasisolated as previously described. The similarity ofplasmid DNAs was evaluated by analyzing the RFLPpattern of plasmid DNAs using HindIII restriction enzyme(Invitrogene™, Life Technologies, Paisley, UK). Thefragments were separated by electrophoresis on a 0.8%agarose gel. The DNA fragments were then visualized using50 mg/L ethidium bromide.

In order to detect the distribution of blaCTX-M-15

among the plasmids, the RFLP gel was hybridized withblaCTX-15 probe using the same method as describedpreviously.

Genetic environment of blaCTX-M-15

The genetic environment upstream and downstream ofblaCTX-M-15 genes was characterized using the primers listedin Table 1 to detect sequences associated with blaCTX-M-15

genes. Amplifications of the blaCTX-M-15 gene, ISEcp1, andgenes surrounding blaCTX-M-15 were carried out under thefollowing conditions: 95°C for 5 min, followed by 35 cyclesof 95°C for 1 min, 60°C for 1 min, 72°C for 1 min, and 72°Cfor 10 min. Sequencing was carried out using specific primersaccording to the method of Sanger et al. [16], using anautomated sequencer (ABI PRISM 377, PerkinElmer,Shelton, CT).

Clinical data

The medical records of all patients with ESBL-producing E.coli were reviewed retrospectively by an infectious diseasesspecialist. The data included reasons for hospitalizationsand antibiotic treatments during the preceding 5 months.The source and date of isolation of the ESBL-producing E.coli were collected.

Table 1 Primers used for the polymerase chain reaction (PCR) amplification of bla genes and insertion sequences (IS) elements and A/Cincompatibility complex (IncA/C) plasmids

Target Primer name Primer sequence (5′–3′) Product size (bp) Reference

blaTEM TEM-F ATGAGTATTCAACATTTCCG 998 [12]TEM-R TTAATCAGTGAGGCACCTAT

blaCTX-M CTX-F TCTTCCAGAATAAGGAATCCC 909 [13]CTX-R CCGTTTCCGCTATTACAAAC

ISEcp1 element IS-F GTGCCCAAGGGGAGTGTATG 615 [14]IS-R ACATTACTGGTGCTGCACAT

IncA/C Inc A/C-F CAATGGCCTAATAGGCATGCCCAT 915 [15]IncA/C-R CCTGGAGGGCTACCATTTCCGGCAG

Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087 1083

Results

Antibiotic resistance profiles

The antibiotic susceptibility profiles of all E. coli isolates andof their corresponding ESBL-producing transconjugantsshowed resistance to several of the β-lactam antibioticstested; the isolates were sensitive to gentamycin, tobramycin,kanamycin, ciprofloxacin, and imipenem (Table 2). Amoderate degree of resistance to ceftazidime, aztreonam,and cefepime was also observed. The MIC of cefotaximewas higher than that of ceftazidime, suggesting the expressionof a CTX-M-type enzyme.

β-Lactamase gene distribution

PCR amplification produced amplicons of 998 bp and909 bp for blaTEM and blaCTX-M, respectively. Thepurification and sequencing of the amplicons obtained fromthe ten isolates of E. coli showed the occurrence of theblaCTX-M-15 gene in all isolates. Multi-sequence alignmentof the sequence obtained from blaTEM amplicons showed100% similarity with blaTEM-52.

Plasmid identification

The plasmid profile showed that all isolates harborplasmids with a molecular size of about 70 kb (Fig. 1).Probing of the plasmid separation gel showed that theygave positive bands. These results suggest that the plasmidsharbored by the E. coli isolates are IncA/C plasmids.

Plasmid transferability study

All E. coli recipients (transconjugants) showed the sameantibiotic resistance profile against amoxicillin–clavulanateacid, ampicillin, cefotaxime, ceftazidime, and cefuroxime,and an additional resistance to kanamycin. These resultsshow that the resistance determinants expressed by E. coliisolates are located on conjugative plasmids and have beentransferred from donors to recipients. These results suggest thatthe IncA/C plasmid was transferred into the recipient’s strainsand confirmed that this plasmid was mobilized by pRA1.

The resistance of several E. coli isolates to gentamicinand tobramycin did not transfer to the E. coli recipient,suggesting that these resistances were encoded by achromosomally encoded gene.

Table 2 The minimum inhibitory concentrations (MICs) (in μg/ml) of key antibiotics for CTX-M-15 and TEM-52 producing Escherichia coliisolates (EC) and their transconjugants (Tc EC)

AMC AMP CTX CAZ CXM CIP GM TOB IMP KAN

EC1 >16/2 >16 >16 8 >16 0.125 4 2 0.5 0.125

Tc EC1 >16/2 >16 >16 8 >16 0.125 0.125 0.5 0.125 >16

EC2 >16/2 >16 >16 8 >16 0.125 2 4 0.25 0.25

Tc EC2 >16/2 >16 >16 8 >16 0.125 0.125 0.5 0.125 >16

EC3 >16/2 >16 >16 8 >16 0.125 2 2 0.5 0.25

Tc EC3 >16/2 >16 >16 4 >16 0.125 0.125 0.5 0.125 >16

EC4 >16/2 >16 >16 16 >16 0.125 2 2 1 0.125

Tc EC4 >16/2 >16 >16 16 >16 0.125 0.125 0.5 0.125 >16

EC5 >16/2 >16 >16 8 >16 0.125 1 0.5 0.5 0.125

Tc Ec5 >16/2 >16 >16 8 >16 0.125 0.125 0.5 0.125 >16

EC6 >16/2 >16 >16 16 >16 0.125 2 2 0.25 0.125

Tc EC6 >16/2 >16 >16 16 >16 0.125 0.125 0.5 0.125 >16

EC7 >16/2 >16 >16 8 >16 0.125 0.5 2 0.5 0.25

Tc EC7 >16/2 >16 >16 8 >16 0.125 0.125 0.5 0.125 >16

EC8 >16/2 >16 >16 16 >16 0.125 2 2 0.5 0.125

Tc EC8 >16/2 >16 >16 16 >16 0.125 0.125 0.5 0.125 >16

EC 9 >16/2 >16 >16 16 >16 0.125 1 1 0.25 0.25

Tc EC9 >16/2 >16 >16 16 >16 0.125 0.125 0.5 0.125 >16

EC10 >16/2 >16 >16 8 >16 0.125 1 1 0.5 0.125

Tc EC10 >16/2 >16 >16 8 >16 0.125 0.125 0.5 0.125 >16

E. coli XL1 Blue <½ 0.125 0.125 0.25 0.25 0.125 0.125 0.5 0.125 >16

AMC: amoxicillin–clavulanate acid; AMP: ampicillin; CTX: cefotaxime; CAZ: ceftazidime; CXM: cefuroxime; CIP: ciprofloxacin; GM:gentamicin; TOB: tobramycin; IMP: imipenem; KAN: kanamycin

1084 Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087

RFLPs and plasmid similarity

As the blaCTX-M-15 and blaTEM-52 genes were detected andencoded by IncA/C conjugative plasmids in the clinicalisolates of E. coli, an attempt was then made to assesswhether or not these plasmids were genetically related,thus, raising the possibility of intra- or inter-speciestransmission between the patients. The RFLP patterns ofthe E. coli plasmids carrying blaCTX-M-15 and blaTEM-52

obtained with HindIII were very similar to each other orexactly the same, although the host bacterial species werevaried in regard to their resistance profiles, suggesting thepossibility of intercellular horizontal transfer of the plasmidamong the E. coli species in the intensive care unit (ICU) ofKasserine Hospital.

The autoradiography of RFLP gel showed that allplasmids harbored blaCTX-M-15 genes with a high copynumber and suggest the fast mobilization and disseminationof this gene among Enterobacteriaceae species (Fig. 2).

Genetic environment of the blaCTX-M-15 encoding gene

The insertion sequence ISEcp1 has been detected upstreamand in the same orientation as the blaCTX-M-15 gene in all ofthe selected isolates, but differing in size as well as distancefrom blaCTX-M-15. The plasmids bearing blaCTX-M-15 werecarried 48 bp upstream of blaCTX-M-15, the insertionsequences of ISEcp1 giving different sizes. Analysis of

the amplified surrounding sequence of blaCTX-M-15 revealeda partially truncated fragment of ISEcp1 tnpA transposase.

Clinical data report

The medical records for all patients with ESBL-producing E.coli were reviewed retrospectively. The patients comprisedeight men and two women, with age between 60 and65 years, and have a history of recurrent UTIs and kidneystones, suffering from UTIs and have been under treatmentwith amoxicillin–clavulanic acid for a long time.

Discussion

We report the first identification of both blaCTX-M-15 andblaTEM-52 plasmid encoding genes in ten different isolatesof E. coli collected from patients admitted to the ICU ofKasserine Hospital, Tunisia.

The patients had a history of recurrent UTIs and kidneystones, which may have favored the in vivo transmission ofthe plasmid harboring the blaCTX-M-15 and blaTEM-52 genesbetween E. coli isolates. There are few examples showingputative in vivo transmission of ESBL genes. Mugnaioli etal. reported a putative in vivo transmission of blaCTX-M-1

between E. coli and Citrobacter amalonaticus and Morga-nella morganii, which highlights the ability of CTX-M-typeESBL genes to spread among different species of Enter-

Fig. 1 a Electrophoresis ofplasmid DNAs extracted fromthe Escherichia coli isolates.b Autoradiography of hybrid-ized plasmid DNAs with IncA/Cprobe. M marker; 1 isolate EC1;2 isolate EC2; 3 isolate EC3;4 isolate EC4; 5 isolate EC5;6 isolate EC6; 7 isolate EC7;8 isolate EC8; 9 isolate EC9;10 isolate EC10

Fig. 2 a Digested fragments byHindIII of plasmid DNAs. bAutoradiography of hybridizeddigested fragments of plasmidDNAs with CTX-M-15 probe.M marker; 1 isolate EC1;2 isolate EC2; 3 isolate EC3;4 isolate EC4; 5 isolate EC5;6 isolate EC6; 7 isolate EC7;8 isolate EC8; 9 isolate EC9;10 isolate EC10

Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087 1085

obacteriaceae [17]. As expected in this study, the transfer ofresistance to cefotaxime and ceftazidime was detected in allof the transconjugants examined; in our hands, theconjugation efficiencies for E. coli clinical isolates wereon the order of 10−5 and 10−6. Nevertheless, thesefrequencies were lower than those reported for the IncA/Cplasmids (i.e., 10−3) [18, 19]. In our study, definitiveevidence for the presence of an IncA/C plasmid in themultidrug resistance (MDR) isolates was provided by theprobing of plasmids extracted from the clinical isolates. Theability of E. coli to develop multiple antibiotic resistancephenotypes via the acquisition of IncA/C plasmids and theassociation of resistance genes with mobile elements,including integrons and transposons, has been welldocumented [19, 20].

TEM-52, harbored by the IncA/C plasmid, first reportedin Tunisia, was known to be able to hydrolyze cefotaximeand cefpirome at a high rate. There are a few reportsdescribing the prevalence of this ESBL worldwide. TEM-52 was first reported by Poyart et al.; the enzymaticparameters of TEM-52 and TEM-3 were found to be verysimilar, except for those for moxalactam, for which theaffinity of TEM-52 (Ki, 0.16 mM) was 10-fold higher thanthat of TEM-3 (Ki, 1.9 mM). Allelic replacement analysisrevealed that the combination of Lys104, Thr182, andSer238 was responsible for the increase in the MICs ofmoxalactam for the TEM-52 producers [21].

Recently, TEM-52 was detected in Great Britain in acollection of E. coli isolated from 388 broiler chickencaecal samples from 22 abattoirs [22], and it was alsodetected in Portugal in a collection of E. coli isolated fromanimals that could pass through the food chain to humans.In this collection, the blaTEM-52 gene was found with avariety of other resistance genes (cmlA, tetA, aadA, sul1,sul2, and sul3) [23].

blaCTX-M-15, harbored by the same IncA/C plasmid, wasalso found in these clinical isolates of E. coli. Analysis ofthe surrounding sequence of blaCTX-M-15 in the clinicalisolates under study revealed a partially truncated fragmentof ISEcp1 tnpA transposase. This result indicates the varietyof genetic events that have enabled associations betweenISEcp1 sequences and blaCTX-M-15 genes in these clinicalisolates. Although ISEcp1 is associated with a variety ofblaCTX-M genes, the genetic environment of these resistancegenes may vary among different blaCTX-M genes [24]. It hasbeen shown that ISEcp1B may recognize a variety ofsimilar DNA sequences to the right inverted repeat during amobilization process, and that the insertion site of ISEcp1B-mediated transposition could be different [25]. We hypoth-esized that blaCTX-M-15 genes and ISEcp1 sequences musthave been in close contact somewhere in order to enable theformation of these hybrid genetic structures. ISEcp1sequences may provide a higher level of expression of the

plasmid-located blaCTX-M-15 genes, although it has beenshown that several enterobacterial species of the Kluyveragenus are a natural reservoir of blaCTX-M-like genes [26].

The same structure has been previously detected up-stream of blaCTX-M-32. ISEcp1 was found between the IS5and blaCTX-M-32, with all elements required for its function[27]. The IS1 has also previously been detected upstream ofthe blaCTX-M genes and was found to disrupt the ISEcp1element [6]. The IS, such as ISEcp1, are an importantsource of genetic plasticity in prokaryotes [7, 8]. Indeed,the mechanism of mobilization generated by ISEcp1 seemsto correspond to a normal transposition mechanism and notto a one-ended transposition mechanism, as suggestedpreviously [8], but, in reality, one-ended transpositionrequires only a single copy of an IS element but does notrequire specific inverted repeat sequences [28]. Transposi-tion usually requires IR sequences located at both ends of atransposon that are recognized by a transposon-encodedtransposase [29].

In summary, the putative transmission of an IncA/Cconjugative plasmid carrying blaCTX-M-15 and blaTEM-52 genesbetween E. coli species was described in patients whosuffered from repeated UTIs. Analysis of the DNA sequencesurrounding blaCTX-M-15 genes revealed a structure formed byISEcp1 able to more easily partake in the insertion andtransmission of resistance mechanisms between E. colispecies or between the Enterobacteriaceae family.

Acknowledgments This work was supported by the IslamicDevelopment Bank (IDB), offering a Post-Doc Scholarship to Dr.Chedly Chouchani at the Department of Infection, Immunity &Biochemistry, School of Medicine, Cardiff University, Cardiff, UK.

Many thanks go to the Tunisian Ministry of Higher Education andScientific Research for the helpful assistance.

Many thanks are also presented to the Director of KasserineHospital for his helpful assistance to obtain the clinical isolates.

Competing interests None declared.

Ethics approval Not required.

References

1. Paterson DL, Bonomo RA (2005) Extended-spectrum β-lactamases: a clinical update. Clin Microbiol Rev 18:657–686

2. Bradford PA (2001) Extended-spectrum β-lactamases in the 21stcentury: characterization, epidemiology, and detection of thisimportant resistance threat. Clin Microbiol Rev 14:933–951

3. Bush K, Jacoby GA, Medeiros AA (1995) A functionalclassification scheme for beta-lactamases and its correlation withmolecular structure. Antimicrob Agents Chemother 39:1211–1233

4. Tzouvelekis LS, Tzelepi E, Tassios PT, Legakis NJ (2000) CTX-M-type β-lactamases: an emerging group of extended-spectrumenzymes. Int J Antimicrob Agents 14:137–142

1086 Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087

5. Bonnet R (2004) Growing group of extended-spectrum β-lactamases: the CTX-M enzymes. Antimicrob Agents Chemother48:1–14

6. Eckert C, Gautier V, Arlet G (2006) DNA sequence analysis of thegenetic environment of various blaCTX-M genes. J AntimicrobChemother 57:14–23

7. Karim A, Poirel L, Nagarajan S, Nordmann P (2001) Plasmid-mediated extended-spectrum β-lactamase (CTX-M-3 like) fromIndia and gene association with insertion sequence ISEcp1. FEMSMicrobiol Lett 201:237–241

8. Poirel L, Decousser JW, Nordmann P (2003) Insertion sequenceISEcp1B is involved in expression and mobilization of a blaCTX-Mβ-lactamase gene. Antimicrob Agents Chemother 47:2938–2945

9. Saladin M, Cao VT, Lambert T, Donay JL, Herrmann JL, Ould-Hocine Z, Verdet C, Delisle F, Philippon A, Arlet G (2002)Diversity of CTX-M beta-lactamases and their promoter regionsfrom Enterobacteriaceae isolated in three Parisian hospitals.FEMS Microbiol Lett 209:161–168

10. Novais A, Cantón R, Moreira R, Peixe L, Baquero F, Coque TM(2007) Emergence and dissemination of Enterobacteriaceae isolatesproducing CTX-M-1-like enzymes in Spain are associated withIncFII (CTX-M-15) and broad-host-range (CTX-M-1, -3, and -32)plasmids. Antimicrob Agents Chemother 51:796–799

11. Rodríguez MM, Power P, Radice M, Vay C, Famiglietti A, GalleniM, Ayala JA, Gutkind G (2004) Chromosome-encoded CTX-M-3from Kluyvera ascorbata: a possible origin of plasmid-borneCTX-M-1-derived cefotaximases. Antimicrob Agents Chemother48:4895–4897

12. Chouchani C, Berlemont R, Masmoudi A, Galleni M, Frere JM,Belhadj O, Ben-Mahrez K (2006) A novel extended-spectrumTEM-type β-lactamase, TEM-138, from Salmonella entericaserovar Infantis. Antimicrob Agents Chemother 50:3183–3185

13. Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K,Walsh TR (2009) Characterization of a new metallo-beta-lactamase gene, bla(NDM-1), and a novel erythromycin esterasegene carried on a unique genetic structure in Klebsiella pneumoniaesequence type 14 from India. Antimicrob Agents Chemother53:5046–5054

14. Chouchani C, Marrakchi R, Ferchichi L, El Salabi A, Walsh TR(2011) VIM and IMP metallo-β-lactamases and other extended-spectrum β-lactamases in Escherichia coli and Klebsiella pneumo-niae from environmental samples in a Tunisian hospital. APMIS119:725–732. doi:10.1111/j.1600-0463.2011.02793.x

15. McIntosh D, Cunningham M, Ji B, Fekete FA, Parry EM, ClarkSE, Zalinger ZB, Gilg IC, Danner GR, Johnson KA, Beattie M,Ritchie R (2008) Transferable, multiple antibiotic and mercuryresistance in Atlantic Canadian isolates of Aeromonas salmonicidasubsp. salmonicida is associated with carriage of an IncA/Cplasmid similar to the Salmonella enterica plasmid pSN254. JAntimicrob Chemother 61:1221–1228

16. Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing withchain-terminating inhibitors. Proc Natl Acad Sci USA 74:5463–5467

17. Mugnaioli C, Luzzaro F, De Luca F, Brigante G, Amicosante G,Rossolini GM (2005) Dissemination of CTX-M-type extended-spectrum β-lactamase genes to unusual hosts. J Clin Microb43:4183–4185

18. Poole TL, Edrington TS, Brichta-Harhay DM, Carattoli A,Anderson RC, Nisbet DJ (2009) Conjugative transferability ofthe A/C plasmids from Salmonella enterica isolates that possessor lack bla(CMY) in the A/C plasmid backbone. FoodbornePathog Dis 6:1185–1194

19. Call DR, Singer RS, Meng D, Broschat SL, Orfe LH, AndersonJM, Herndon DR, Kappmeyer LS, Daniels JB, Besser TE (2010)blaCMY-2-positive IncA/C plasmids from Escherichia coli andSalmonella enterica are a distinct component of a larger lineage ofplasmids. Antimicrob Agents Chemother 54:590–596

20. Walsh TR (2006) Combinatorial genetic evolution of multi-resistance. Curr Opin Microbiol 9:476–482

21. Poyart C, Mugnier P, Quesne G, Berche P, Trieu-Cuot P (1998) Anovel extended-spectrum TEM-type β-lactamase (TEM-52) asso-ciated with decreased susceptibility to moxalactam in Klebsiellapneumoniae. Antimicrob Agents Chemother 42:108–113

22. Randall LP, Clouting C, Horton RA, Coldham NG, Wu G,Clifton-Hadley FA, Davies RH, Teale CJ (2011) Prevalence ofEscherichia coli carrying extended-spectrum β-lactamases (CTX-Mand TEM-52) from broiler chickens and turkeys in Great Britainbetween 2006 and 2009. J Antimicrob Chemother 66:86–95

23. Sousa M, Torres C, Barros J, Somalo S, Igrejas G, Poeta P (2011)Gilthead seabream (Sparus aurata) as carriers of SHV-12 andTEM-52 extended-spectrum beta-lactamases-containing Escher-ichia coli isolates. Foodborne Pathog Dis (in press). doi:10.1089/fpd.2011.0866

24. Lartigue MF, Poirel L, Nordmann P (2004) Diversity of geneticenvironment of blaCTX-M genes. FEMS Microbiol Lett 234:201–207

25. Poirel L, Lartigue MF, Decousser JW, Nordmann P (2005)ISEcp1B-mediated transposition of blaCTX-M in Escherichia coli.Antimicrob Agents Chemother 49:447–450

26. Humeniuk C, Arlet G, Gautier V, Grimont P, Labia R, Philippon A(2002) β-lactamases of Kluyvera ascorbata, probable progenitorsof some plasmid-encoded CTX-M types. Antimicrob AgentsChemother 46:3045–3049

27. Cartelle M, del Mar Tomas M, Molina F, Moure R, Villanueva R,Bou G (2004) High-level resistance to ceftazidime conferred by anovel enzyme, CTX-M-32, derived from CTX-M-1 through asingle Asp240-Gly substitution. Antimicrob Agents Chemother48:2308–2313

28. Mötsch S, Schmitt R, Avila P, de la Cruz F, Ward E, Grinsted J(1985) Junction sequences generated by “one-ended transposition”.Nucleic Acids Res 13:3335–3342

29. Craig NL (1996) Transposition. In: Neidhardt FC, Curtiss R III,Ingraham JL, Lin ECC, Low KB, Magasanik B, Reznikoff WS,Riley M, Schaechter M, Umbarger HE (eds) Escherichia coli andSalmonella: cellular and molecular biology, vol. 2. ASM Press,Washington, pp 2339–2362

Eur J Clin Microbiol Infect Dis (2012) 31:1081–1087 1087