Download - Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Transcript
Page 1: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Antimicrobial susceptibility and molecular epidemiology of

extended-spectrum β-lactamase producing Enterobacteriaceae

in New Zealand, 2013

Helen Heffernan

Kristin Dyet

Rosemary Woodhouse

Deborah Williamson

Antibiotic Reference Laboratory,

Health Group

December 2014

Client Report

FW14059

Page 2: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 December 2014

DISCLAIMER

This report or document ("the Report") is given by the Institute of Environmental Science

and Research Limited ("ESR") solely for the benefit of the Ministry of Health, Public

Health Service Providers and other Third Party Beneficiaries as defined in the Contract

between ESR and the Ministry of Health, and is strictly subject to the conditions laid out in

that Contract.

Neither ESR nor any of its employees makes any warranty, express or implied, or assumes

any legal liability or responsibility for use of the Report or its contents by any other person

or organisation.

Page 3: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 December 2014

ACKNOWLEDGMENTS

The authors thank the following people for their assistance with this survey and report:

Diagnostic microbiology laboratories for referring isolates and data for the annual

ESBL-E surveys.

Jenny Szeto and Erandi Malliyawadu, Antibiotic Reference Laboratory, ESR, for the

technical work.

Chris Lewis, Ministry of Health, for providing patient ethnicity data from the National

Minimum Dataset.

Dr Tim Blackmore and Dr Michelle Balm, Capital and Coast District Health Board;

and Grant Storey, Ministry of Health, for peer review of the report.

Page 4: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 December 2014

CONTENTS

LIST OF TABLES ................................................................................................................ i

LIST OF FIGURES .............................................................................................................. i

SUMMARY .......................................................................................................................... ii

RECOMMENDATIONS .................................................................................................... iv

1 INTRODUCTION ........................................................................................................ 1

2 METHODS ................................................................................................................... 3

2.1 Isolates and patient information .......................................................................... 3 2.2 Antimicrobial susceptibility testing .................................................................... 4 2.3 Preparation of DNA template ............................................................................. 5

2.4 Determination of ESBL type ............................................................................... 5 2.5 Molecular typing ................................................................................................. 6

2.5.1 Rationale and multiple-locus variable number tandem repeat analysis .. 6 2.5.2 E. coli phylogenetic grouping ................................................................. 9 2.5.3 Identification of E. coli multilocus sequence type 131 ........................... 9 2.5.4 Multilocus sequence typing ................................................................... 10

2.6 Data analysis ..................................................................................................... 11

3 RESULTS ................................................................................................................... 12

3.1 Isolates and patients .......................................................................................... 12 3.2 Antimicrobial susceptibility .............................................................................. 13 3.3 ESBL types ....................................................................................................... 14

3.4 Molecular types ................................................................................................. 15

3.4.1 E. coli types .......................................................................................... 15

3.4.2 K. pneumoniae types ............................................................................. 19

4 DISCUSSION ............................................................................................................. 21

REFERENCES ................................................................................................................... 25

APPENDIX ......................................................................................................................... 29

Page 5: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae, 2013 i December 2014

LIST OF TABLES

Table 1. Primers used for the detection and sequencing of ESBL genes............................ 6

Table 2. PCR conditions used for the detection of ESBL genes......................................... 6

Table 3. VNTR loci and primers used for their amplification ............................................ 8

Table 4. Primers used for the identification of E. coli phylogenetic groups ....................... 9

Table 5. E. coli phylogenetic group assignment based on results of PCR amplification of

the chuA, yjaA and DNA fragment TspE4C2 9

Table 6. Primers used for the identification of ST131 E. coli .......................................... 10

Table 7. Antimicrobial susceptibility among clinical isolates of all ESBL-producing

isolates, Escherichia coli and Klebsiella spp. ..................................................... 13

Table 8. Distribution of ESBL types by species ............................................................... 15

Table 9. Species distribution among the 352 clinical ESBL-producing Enterobacteriaceae

............................................................................................................................. 29

Table 10. Clinical source of the 352 ESBL-producing Enterobacteriaceae ....................... 29

Table 11. Age and sex of patients from whom the 352 clinical ESBL-producing

Enterobacteriaceae were obtained ....................................................................... 29

Table 12. Age and ethnicity of patients from whom the 352 clinical ESBL-producing

Enterobacteriaceae were obtained ....................................................................... 30

Table 13. Categorisation of patients based on their current or recent hospitalisation history

and species of ESBL-producing Enterobacteriaceae .......................................... 30

Table 14. District health board domicile of the patients ..................................................... 31

Table 15. Distribution of minimum inhibitory concentrations (MICs) among clinical

isolates of ESBL-producing Escherichia coli (n=224), Klebsiella spp. (n=111)

and other Enterobacteriaceae (n=17) .................................................................. 32

Table 16. Common antibiotic resistance patterns ............................................................... 34

Table 17. MLVA profiles among Escherichia coli isolates and association of MLVA types

with phylogenetic group and ST131 ................................................................... 35

Table 18. MLVA profiles among Klebsiella pneumoniae isolates ..................................... 37

LIST OF FIGURES

Figure 1. Prevalence of MLVA types found in E. coli and K. pneumoniae....................... 17 Figure 2. Maximum parsimony tree of the MLVA types among the 224 ESBL-producing

E. coli isolates.. ................................................................................................... 18 Figure 3. Maximum parsimony tree of the MLVA types among the 107 ESBL-producing

K. pneumoniae isolates. ...................................................................................... 20

Page 6: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae, 2013 ii December 2014

SUMMARY

Resistance to third-generation cephalosporins, particularly due to extended-spectrum β-

lactamase (ESBL) production, has become endemic among Enterobacteriaceae, such as

Escherichia coli and Klebsiella pneumoniae, in several regions of the world. While the

incidence of ESBL-producing Enterobacteriaceae (ESBL-E) is relatively low in New

Zealand, rates are increasing. This survey was undertaken to provide contemporary

information on the antimicrobial susceptibility and molecular epidemiology of ESBL-E in

New Zealand.

A random sample of 352 clinical ESBL-E isolates was selected from isolates referred to

the Institute of Environmental Science and Research (ESR) as part of the 2013 annual

ESBL-E survey. Basic patient demographic data and hospitalisation history data was

provided by the referring laboratories or obtained from the National Minimum Dataset.

Antimicrobial susceptibility was determined by agar dilution, the ESBL type identified by

PCR and sequencing, and molecular typing of E. coli and K. pneumoniae was performed

by multiple-locus variable tandem repeat analysis (MLVA). E. coli were further

characterised to identify phylogenetic groups and isolates belonging to multilocus

sequence type 131 (ST131).

63.6% (224) of the 352 ESBL-E isolates were E. coli, 31.5% (111) were Klebsiella spp.,

and the remaining 4.8% (17) were other Enterobacteriaceae species. The majority (88.6%)

of isolates were from urine. 75.6% of patients were female and 64.1% of patients were

≥65 years of age. Patients with ESBL-producing E. coli (ESBL-E. coli) were almost

evenly split between community patients and those in a healthcare facility, whereas 83.3%

of patients with ESBL-producing Klebsiella spp. (ESBL-Klebsiella spp.) were healthcare

facility patients.

The majority of ESBL-E were multiresistant, with the most common resistance pattern

being resistance to amoxicillin-clavulanate, ciprofloxacin, co-trimoxazole/trimethoprim

and gentamicin. 93.3% of ESBL-E. coli were susceptible to nitrofurantoin, although most

ESBL-Klebsiella spp. were resistant. 84.9% and 96.3% of ESBL-E were susceptible to the

oral agents mecillinam and fosfomycin, respectively. All ESBL-E were susceptible to

continued

Page 7: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae, 2013 iii December 2014

meropenem, 98.9% were ertapenem susceptible, 94.9% piperacillin/tazobactam

susceptible, and 98.0% tigecycline susceptible. Generally, ESBL-Klebsiella spp. were less

susceptible than ESBL-E. coli to most antimicrobials.

97.2% of ESBLs identified were CTX-M types, with the remainder being SHV or VEB

types. While both group 1 and group 9 CTX-M ESBLs were common in ESBL-E. coli,

only group 1 CTX-Ms were common among ESBL-Klebsiella spp. There were no clear

associations between patient ethnic groups and CTX-M type.

71.4% of the ESBL-E. coli belonged to phylogenetic group B2, 20.1% belonged to

group D, 6.3% to group A, and 2.2% to group B1. The E. coli ST131 clone accounted for

an estimated 54.4% of ESBL-E. coli. All ST131 E. coli had a CTX-M-type ESBL, with an

almost equal split between group 1 and group 9 CTX-M types. Ciprofloxacin resistance

was more prevalent among ST131 ESBL-E. coli than other ESBL-E. coli.

Based on MLVA typing, there was considerable strain diversity among both the 224

ESBL-E. coli, with 62 MLVA types identified, and the 107 ESBL-producing

K. pneumoniae, with 36 MLVA types identified. However, the Simpson’s index of

diversity suggested that the ESBL-K. pneumoniae were less clonally diverse than the

ESBL-E. coli.

In conclusion, this survey showed that ESBL-E in New Zealand are usually multiresistant

but generally retain susceptibility to several antimicrobial classes including carbapenems,

piperacillin/tazobactam, tigecycline, the oral agents mecillinam and fosfomycin, and in the

case of ESBL-E. coli, also nitrofurantoin. In line with global trends, CTX-M-type ESBLs

are dominant in New Zealand and the pandemic E. coli ST131 clone accounted for just

over half of the ESBL-E. coli.

We recommend that surveys to provide contemporary information on the antimicrobial

susceptibility and molecular epidemiology of ESBL-E should be repeated at regular

intervals or preferably become a routine part of the regular national ESBL-E surveys.

Page 8: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae, 2013 iv December 2014

RECOMMENDATIONS

1 Surveys such as this one should be repeated periodically or preferably become an

integral part of the regular national extended-spectrum β-lactamase-producing

Enterobacteriaceae (ESBL-E) surveys to enhance the usefulness of the regular

surveys.

2 Future surveys could be further enhanced by:

obtaining patient hospitalisation history data from the National Minimum

Dataset to enable a more accurate description of the epidemiology of ESBL-E in

healthcare vs community settings;

full identification of the ESBL types;

identification of sub-clones of ST131 ESBL-producing Escherichia coli; and

using DNA microarrays to identify virulence factors in ESBL-E in

New Zealand.

Page 9: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 1 December 2014

1 INTRODUCTION

Enterobacteriaceae, particularly Escherichia coli and Klebsiella pneumoniae, are major

human pathogens, in both community and healthcare settings. Over the past decade, the

prevalence of antimicrobial-resistant Enterobacteriaceae has increased considerably in

many parts of the world.1 Most notably, resistance to third-generation cephalosporins

(eg, ceftriaxone, ceftazidime), particularly due to extended-spectrum β-lactamase (ESBL)

production, has become endemic in several regions. For example, data from a recent

World Health Organization report described resistance rates of over 50% to third-

generation cephalosporins in E. coli isolates from several countries in the South-East Asia

and Western Pacific regions.1 In New Zealand, data from annual national surveys

demonstrate an increase in the incidence of ESBL-producing Enterobacteriaceae (ESBL-E)

over the past decade, with marked geographic variation in incidence rates.2 However,

based on aggregate national susceptibility data, the overall prevalence of ESBL production

in E. coli bloodstream isolates has remained stable in New Zealand over the past decade at

<5%, whereas the reported prevalence of ESBL production in K. pneumoniae bloodstream

isolates is higher at 10–15%.3

Throughout the 1980s and 1990s, the most common globally reported types of ESBL were

either TEM- or SHV-type ESBLs.4 However, during the 2000s, the CTX-M-type ESBLs

rapidly emerged and spread to become the most commonly identified ESBL type

worldwide.5 The genes encoding CTX-M enzymes are usually located on mobile genetic

elements such as plasmids, thus facilitating their widespread dissemination.6 Based on

amino acid similarity, CTX-M enzymes cluster into five main groups, with the vast

majority belonging to CTX-M groups 1 and 9. The two most common CTX-M types

described to date are CTX-M-15 (belonging to group 1) and CTX-M-14 (belonging to

group 9). In particular, CTX-M-15 has emerged to become the most globally prevalent

CTX-M enzyme, and a strong association has been described between CTX-M-15-

producing E. coli and a global ‘pandemic’ clone of E. coli known as sequence type (ST)

131.6 The ST131 clone is noted for its ability to harbour numerous genes associated with

both antimicrobial resistance and virulence.7 In addition to -lactam resistance, ST131

E. coli isolates are also commonly resistant to fluoroquinolones.6,7 A 2006 molecular

epidemiological study of ESBL types in New Zealand identified CTX-M-type ESBLs as

the most common ESBL types in New Zealand. In this study, 81/83 (98%) of ESBL-E

Page 10: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 2 December 2014

isolates produced CTX-M enzymes, with the most common CTX-M types being CTX-M-

15 (78%, 63/81) and CTX-M-14 (14%, 11/81).8

Importantly, because the genes that encode ESBL production are often associated with

genes conferring resistance to other antimicrobials, such as fluoroquinolones and

aminoglycosides,7 therapeutic options for serious infections caused by ESBL-E are often

limited to antimicrobial agents such as carbapenems and amikacin. In addition, spread of

ESBL-E in community settings poses a challenge to oral antimicrobial treatment of

infections caused by such organisms, and suitable options may be limited to agents such as

fosfomycin and mecillinam. To date however, there are no national data on susceptibility

of ESBL-E to these agents, nor to newer agents such as tigecycline.

To provide contemporary information on antimicrobial resistance patterns and molecular

epidemiology of ESBL-E in New Zealand, we undertook extended phenotypic and

genotypic characterisation of nationally representative clinical isolates sent to the Institute

of Environmental Science and Research (ESR) as part of the 2013 annual ESBL-E survey.2

Specifically, the aims of this study were to:

Provide contemporary information on antimicrobial resistance amongst ESBL-E in

New Zealand, including resistance to agents such as fosfomycin, mecillinam and

tigecycline.

Determine the relative prevalence of specific ESBL types in clinical ESBL-E

isolates in New Zealand.

Identify the major clones of ESBL-producing E. coli (ESBL-E. coli) and ESBL-

producing K. pneumoniae (ESBL-K. pneumoniae) circulating in New Zealand,

including ST131 E. coli.

Page 11: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 3 December 2014

2 METHODS

2.1 Isolates and patient information

Among the 793 isolates received for the 2013 annual ESBL-E survey, 458 were from

clinical or diagnostic specimens rather than screening specimens.2 This total excludes

repeat ESBL-producing isolates of the same species from the same patient.

From the total 458 non-duplicate clinical isolates, a simple random sample of 352 isolates

was selected for this survey using the SAS survey select procedure, and stratified by

referring diagnostic laboratory and bacterial species.

When referring isolates for the 2013 annual ESBL-E survey, diagnostic laboratories

supplied epidemiological data including patient age, geographic location, hospitalisation

status, body site from which the ESBL-E was isolated, and if the isolate was obtained from

a diagnostic specimen or screen. Laboratories also supplied data on the susceptibility of

the isolates to several antibiotics, including co-trimoxazole and trimethoprim.

The patients from whom ESBL-E were isolated were categorised as public hospital

patients, long-term care facility (LTCF) residents or private hospital patients if,

respectively, they were in a public hospital (including emergency department or outpatient

clinic), LTCF or private hospital when ESBL-E was isolated or had been in such a

healthcare facility in the previous three months. All other patients were categorised as

community patients.

Information on patient ethnicity was obtained from the Ministry of Health’s National

Minimum Dataset. The ethnic groups presented are based on a prioritised classification of

ethnicity, with the Māori ethnic group at the top of the hierarchy, followed by Pacific

Peoples, Asian, Middle Eastern/Latin American/African (MELAA), and European or Other

(including New Zealander) ethnic groups. For some analyses, the Asian ethnic group was

subdivided into Indian and Other Asian based on level 2 ethnicity coding. More

information about ethnicity classification is available on the Ministry of Health web site:

http://www.health.govt.nz/publication/ethnicity-data-protocols-health-and-disability-

sector.

Page 12: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 4 December 2014

2.2 Antimicrobial susceptibility testing

All isolates were confirmed to produce ESBL at ESR by the Clinical and Laboratory

Standards Institute’s (CLSI’s) phenotypic confirmatory disc test,9 or a double-disc synergy

test with cefotaxime, ceftazidime, cefpodoxime and cefepime as substrates.10

Susceptibility to amoxicillin-clavulanate, ciprofloxacin, ertapenem, fosfomycin,

gentamicin, mecillinam, meropenem, nitrofurantoin, piperacillin-tazobactam and

tigecycline was determined by agar dilution according to CLSI methods.11 The tigecycline

pure substance and tazobactam used to prepare agar dilution plates were generously

donated by Wyeth Research (Monmouth Junction, New Jersey, United States). All other

antibiotic pure substances used for agar dilution were obtained from either Sigma-Aldrich

(Saint Louis, Missouri, United States) or Toku-E (Bellingham, Washington, United States).

Minimum inhibitory concentrations (MICs) were interpreted according to CLSI guidelines,

except for tigecycline MICs which were interpreted according to the European Committee

on Antimicrobial Susceptibility Testing (EUCAST) breakpoints.9,12 The MIC50 and MIC90

values were defined as the MICs at which at least 50% and 90%, respectively, of isolates

were inhibited.

The co-trimoxazole/trimethoprim susceptibility results presented in this report are those

reported by the referring laboratories. For some isolates susceptibility to both

cotrimoxazole and trimethoprim was reported. If an isolate was resistant to one agent but

intermediate or susceptible to the other, it was recorded as resistant to co-

trimoxazole/trimethoprim, and likewise if it was intermediate to one agent but susceptible

to the other, it was recorded as intermediate to co-trimoxazole/trimethoprim.

In keeping with previously described definitions, multidrug resistance was defined as non-

susceptibility to ≥3 of the following antibiotics or antibiotic classes: amoxicillin-

clavulanate, carbapenems (ertapenem or meropenem), cefoxitin, ciprofloxacin, folate

pathway inhibitors (co-trimoxazole or trimethoprim), fosfomycin, gentamicin, mecillinam,

nitrofurantoin, piperacillin-tazobactam or tigecycline.13 For this definition, the co-

trimoxazole/trimethoprim susceptibility was that reported by the referring laboratories;

Page 13: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 5 December 2014

cefoxitin susceptibility was that determined by disc susceptibility testing at ESR; and the

susceptibility to all other antibiotics/antibiotic classes was that determined by agar dilution

susceptibility testing at ESR.

2.3 Preparation of DNA template

Boiled lysis cell suspensions were used as a source of DNA template in all polymerase

chain reactions (PCRs). Plate cultures were used to prepare cell suspensions,

approximately equivalent to a 0.5 McFarland standard, in DNase/RNase-free water.

Suspensions were heated at 95˚C for 9 minutes. The neat supernatants were stored at

-20˚C and used as a source of DNA template.

2.4 Determination of ESBL type

Isolates were tested for the genes encoding CTX-M, TEM, SHV and VEB -lactamases

(ie, blaCTX-M, blaTEM, blaSHV and blaVEB) by PCR using the primers listed in Table 1 and the

amplification conditions specified in Table 2.

Initially all isolates were tested for the presence of blaCTX-M genes using a multiplex PCR

that detects the genes encoding CTX-M groups 1, 2, 8, 9 and 25.14 Isolates in which no

blaCTX-M gene was detected were tested for the presence of blaTEM and blaSHV genes. TEM

and SHV amplicons were sequenced to determine the TEM or SHV subtype. Isolates in

which no CTX-M, TEM or SHV ESBL genes were detected were tested for the presence of

blaVEB.

PCRs were performed in 25 µL reactions using AmpliTaq Gold 360 PCR Master Mix

(ATG360, Applied Biosystems, Carlsbad, California, United States) and 1.5 µL DNA

template. All primers were used at 0.1 µM, except those used to amplify blaTEM and blaSHV

genes which were used at 0.2 µM.

Page 14: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 6 December 2014

Table 1. Primers used for the detection and sequencing of ESBL genes

Primer name Target gene Primer sequence (5΄-3΄) Product

size (bp)

Reference

CtxMP1F1 blaCTX-M group 1 AAA AAT CAC TGC GCC AGT TC 415 14

CtxMP1R1 AGC TTA TTC ATC GCC ACG TT

CtxMP2F1 blaCTX-M group 2 CGA CGC TAC CCC TGC TAT T 552 14 CtxMP2R1 CCA GCG TCA GAT TTT TCA GG

CtxMP8F1 blaCTX-M group 8 TCG CGT TAA GCG GAT GAT GC 666 14 CtxMP8/25R1 AAC CCA CGA TGT GGG TAG C

CtxMP9F1 blaCTX-M group 9 CAA AGA GAG TGC AAC GGA TG 205 14 CtxMP9R1 ATT GGA AAG CGT TCA TCA CC

CtxMP25F1 blaCTX-M group 25 GCA CGA TGA CAT TCG GG 327 14 CtxMP8/25R1 AAC CCA CGA TGT GGG TAG C

TEM-12

blaTEM GTA TCC GCT CAT GAG ACA ATA 966 15

TEM-22 TCT AAA GTA TAT ATG AGT AAA C

SHV-12

blaSHV GCC GGG TTA TTC TTA TTT GTC GC 1017 16

SHV-22 TCT TTC CGA TGC CGC CGC CAG TCA

VebF2 blaVEB CGA CTT CCA TTT CCC GAT GC 605 17

VebR2 GGA CTC TGC AAC AAA TAC GC

1 PCR amplification primers.

2 PCR amplification and sequencing primers.

Table 2. PCR conditions used for the detection of ESBL genes

Target gene PCR conditions

blaCTX-M

Denaturation for 5 min at 94ºC; 30 cycles of 94ºC for 30 sec, 52ºC for 30 sec,

72ºC for 50 sec; and final extension of 72ºC for 6 min.

blaTEM Denaturation for 5 min at 94ºC; 35 cycles of 94ºC for 30 sec, 55ºC for 30 sec,

72ºC for 60 sec; and final extension of 72ºC for 10 min.

blaSHV Denaturation for 5 min at 94ºC; 35 cycles of 94ºC for 30 sec, 68ºC for 30 sec,

72ºC for 60 sec; and final extension of 72ºC for 7 min.

blaVEB Denaturation for 5 min at 94ºC; 35 cycles of 94ºC for 30 sec, 55ºC for 30 sec,

72ºC for 60 sec; and final extension of 72ºC for 10 min.

2.5 Molecular typing

2.5.1 Rationale and multiple-locus variable number tandem repeat analysis

Bacterial typing and sub-typing allow the spread of pathogens to be assessed. PFGE is

considered the gold standard typing method for both E. coli and Klebsiella species,

although it is a reasonably slow, labour-intensive process that is not suitable for high

throughput analysis. Multiple-locus variable number tandem repeat analysis (MLVA) has

Page 15: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 7 December 2014

emerged as an alternative, powerful typing method that is suitable for high-throughput

analysis.18 It distinguishes non-clonal isolates by assessing the variation in multiple

tandem-repeat sequences and has been used to characterise a wide range of prokaryotes,

including many species within the family Enterobacteriacae.18

For E. coli isolates, multiplex PCR reactions were used to amplify the MLVA loci

O15711, VNTR2, VNTR13 and CCR1 (Table 3). The amplification conditions used were

denaturation at 94˚C for 5 min; followed by 30 cycles of 94˚C for 30 sec, 60˚C for 30 sec,

and 72˚C for 45 sec; and a final extension at 72˚C for 5 min.

For K. pneumoniae isolates, multiplex PCR reactions were used to amplify the MLVA loci

K, N1, KPN3, and KPN26 (Table 3). The amplification conditions used were denaturation

at 94˚C for 5 min; followed by 30 cycles of 94˚C for 30 sec, 59˚C for 30 sec, and 72˚C for

45 sec; and a final extension at 72˚C for 5 min.

Labelled forward primers were synthesized by BioSearch Technologies (Novato,

California, United States) or Applied Biosystems. All MLVA amplifications were

performed in 15 μL reactions using ATG360, an additional 2.5 mM MgCl2, primers at

concentrations described in Table 3, and 1.0 μL DNA template.

Amplification products were diluted 1:40 in DNase/RNase-free water and analyzed on an

ABI 3130xl Genetic Analyzer (Applied Biosystems) using the GeneScan™ 600 LIZ® size

standard (Applied Biosystems) for comparison. Raw data was analysed using the

GeneMapper® Software v5.0 (Applied Biosystems) to determine the size and dye label

associated with each amplicon and assign an allele number. MLVA results were expressed

as a string of four allele numbers: O15711-VNTR2-VNTR13-CCR1 for E. coli and K-N1-

KPN3-KPN26 for K. pneumoniae.

Maximum parsimony trees were constructed in BioNumerics software v6.6 (Applied

Maths, Ghent, Belgium). On the maximum parsimony trees, each circle represents a

MLVA type, with the number of isolates with the MLVA type proportional to the size of

the circle.

Page 16: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 8 December 2014

Table 3. VNTR loci and primers used for their amplification

VNTR

locus

Repeat

size

(bp)

Primer

name

Primer sequence (5΄-3΄)1 Colour

channel

Primer

concentration

in PCR (µM)

Reference

Escherichia coli

O15711 6 O15711F NED - ACCGGCAATCATCGGGCCAACCA Yellow 0.06

19 O15711R GATGCTGGAAAAACTGATGCAGACTCGCGT Not labelled 0.06

VNTR2 95 VNTR2F HEX - CGTCAGTGTATGTCCGAAGG Green 0.10

19 VNTR2R GTGTCTTCTTAGTGTCAGGGGCAGTTTT Not labelled 0.10

VNTR13 39 VNTR13F FAM - TTTACGCCAATTGTTGAACC Blue 0.47

19 VNTR13R GTGTCTTGGTGTCAGCAAATCCAGAGA Not labelled 0.47

CCR1 282 CCR1F CFR610 - GCTGCAGGAGAATGGGATGGTTTT Red 0.47 20

CCR1R GGTGAGGTGTCCGAGTGGCTGAAG Not labelled 0.47

Klebsiella pneumoniae

K 118 KF CFR590 - GAGCTGGCGGCTGGAATA Red 0.60

21 KR GCAATCTGCCCGGAAATA Not labelled 0.60

N1 116 N1F NED - CATCAGGTGCAAGATTCCA Yellow 0.33 Turton, pers

comm N1R TGAGCGATTGCTGGCCTA Not labelled 0.33

KPN3 18 KPN3F FAM - GGCCAAACAGTACGATCTGC Blue 0.07

This study KPN3R GAATCGCAGCCTCACACG Not labelled 0.07

KPN26 57 KPN26F HEX - GGTCAGTTTCGCCACCAG Green 0.10

This study KPN26R ATTGCCCAGTTTCTGGAACA Not labelled 0.10

1 CFR590, Cal FluoroRed 590; CFR610, Cal Fluoro Red 610. 2 Repeat length of 28 bp and an average spacer length of 31 bp.

Page 17: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 9 December 2014

2.5.2 E. coli phylogenetic grouping

E. coli phylogenetic groups were determined using the assay described by Clermont et al

and the primers listed in Table 4.22 This method uses a triplex PCR to determine the

phylogenetic group (A, B1, B2, and D), and is based on the presence or absence of

amplification products at three loci (Table 5).

PCRs were performed in 25 µL reactions using ATG360, an additional 2.5 mM MgCl2,

primers at 0.2 µM, and 1.5 µL DNA template. Amplifying conditions were denaturation

for 5 min at 95ºC; 30 cycles of 95ºC for 30 sec, 55ºC for 30 sec, 72ºC for 30 sec; and final

extension of 72ºC for 7 min.

Table 4. Primers used for the identification of E. coli phylogenetic groups

Primer name Target gene Primer sequence (5΄-3΄) Product

size (bp) Reference

ChuA.1 chuA

GACGAACCAACGGTCAGGAT 279 22

ChuA.2 TGCCGCCAGTACCAAAGACA

YjaA.1 yjaA

TGAAGTGTCAGGAGACGCTG 211 22

YjaA.2 ATGGAGAATGCGTTCCTCAAC

TspE4C2.1 DNA fragment

TspE4C2

GAGTAATGTCGGGGCATTCA 152 22 TspE4C2.2 CGCGCCAACAAAGTATTACG

Table 5. E. coli phylogenetic group assignment based on results of PCR amplification

of the chuA, yjaA and DNA fragment TspE4C2

Phylogenetic

group1

Target gene:

chuA yjaA TspE4C2

A - - +

A - - -

B1 - + +

B1 - + -

B2 + + +

B2 + + -

D + - +

D + - -

1 Based on reference 22.

2.5.3 Identification of E. coli multilocus sequence type 131

As multilocus sequence type (ST) ST131 E.coli strains invariably belong to the B2

phylogenetic group, all group B2 isolates were tested, using a PCR-based method, to

Page 18: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 10 December 2014

determine whether they were ST131. The PCR-based assay screens for the presence of

both a 347 bp fragment of the pabB gene found in isolates belonging to the O25-ST131

clone,23 and ST131-associated single nucleotide polymorphisms (SNPs) in the mdh and

gyrB genes (Table 6).24 Isolates that generated amplicons for all three loci (O25b pabB,

mdh and gyrB) were considered to be ST131.

The O25b pabB and mdh genes were amplified in a multiplex reaction and the gyrB gene

was amplified separately in a singleplex reaction. PCRs were performed in 25 µL

reactions using ATG360, an additional 2.5 mM MgCl2, primers at 0.1 µM (pabB and mdh)

or 0.2 µM (gyrB), and 1.5 µL DNA template. Amplifying conditions were denaturation for

5 min at 95ºC; 30 cycles of 95ºC for 30 sec, xºC for 30 sec (where x is 65˚C for O25 pabB

and mdh PCRs and 60˚C for the gyrB PCR), 72ºC for 60 sec; and final extension of 72ºC

for 7 min. The gyrB allele in 37 isolates and the mdh allele in 11 isolates were sequenced,

using the MLST primers described in Section 2.5.4, to confirm the ST131 assay results.

Table 6. Primers used for the identification of ST131 E. coli

Primer name Target

gene Primer sequence (5΄-3΄)

Product

size

(bp)

Reference

O25pabBspe.F pabB

TCCAGCAGGTGCTGGATCGT 347 23

O25pabBspe.R GCGAAATTTTTCGCCGTACTGT

mdh36 F mdh

GTTTAACGTTAACGCCGGT 275 24

mdh36 R GGTAACACCAGAGTGACCA

gyrB47 F gyrB

CGCGATAAGCGCGAC 132 24 gyrB47 R ACCGTCTTTTTCGGTGGAA

2.5.4 Multilocus sequence typing (MLST)

Isolates representing the more common MLVA profiles, as defined by the MLVA profile

being common to >5 isolates, were further characterized using MLST. MLST was carried

out using protocols and conditions described on the E. coli (http://mlst.warwick.ac.uk/

mlst/) and K. pneumoniae (http://www.pasteur.fr/recherche/genopole/PF8/mlst/primers_

Kpneumoniae.html) MLST websites.25,26 The loci assessed for E. coli MLST were adk,

fumC, gyrB, icd, mdh, purA and recA. The loci assessed for K. pneumoniae were gapA,

infB, mdh, pgi, phoE, rpoB and tonB. Sequence types were assigned using the website

interface.

Page 19: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 11 December 2014

2.6 Data analysis

Statistical analyses were performed with SAS software v.9.3 (SAS Institute Inc, Cary, NC,

USA).27 The chi-square test or Fisher’s exact test, as appropriate, were used to determine

the significance of any observed differences. An associated p value 0.05 was used to

indicate that a difference was significant.

For the analyses of associations between ST131 E. coli and patient demographics,

antimicrobial resistance, ESBL types and MLVA types, isolates belonging to phylogenetic

groups other than B2 that were not tested in the PCR-based assay for ST131 were assumed

to be not ST131.

Simpson’s index of diversity was used to assess variation in MLVA types.28 This index

indicates the probability that two isolates randomly selected are different MLVA types.

The higher the index, the greater the diversity of MLVA types in a particular population.

The index was calculated using the Biodiversity Calculator developed by Danoff-Burg and

Xu (http://www.columbia.edu/itc/cerc/danoff-burg/MBD_Links.html). 95% confidence

intervals for the index were calculated as previously described.29

Page 20: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 12 December 2014

3 RESULTS

3.1 Isolates and patients

63.6% (224) of the total 352 isolates were E. coli, 31.5% (111) were Klebsiella spp., and

the remaining 4.8% (17) were other Enterobacteriaceae species. The majority (88.6%,

312) of the isolates were from urine. Thirteen (3.7%) isolates were from invasive sites.

Details of the bacterial species and source of the isolates are presented in Table 9 and

Table 10 in the Appendix.

The majority of patients were female (263/348, 75.6%) and most patients were ≥65 years

of age (225/351, 64.1%) (Table 11 in the Appendix). Most (240/339, 70.8%) patients

belonged to the European or Other ethnic group (Table 12 in the Appendix). The majority

(178/240, 74.2%) of patients belonging to the European and Other ethnic group were ≥65

years of age, whereas the majority of patients in the Māori, Pacific Peoples and Asian

ethnic groups were <65 years of age (14/24, 58.3%; 16/24, 66.7%; and 30/47, 63.8%,

respectively).

Just over half the patients (166/328, 50.6%) were categorised as public or private hospital

patients, 13.1% (43/328) were LTCF residents, and the remaining 36.3% (119/328) were

community patients (Table 13 in the Appendix). While patients with ESBL-E. coli were

almost evenly split between community patients and those in a healthcare facility (public

hospital, private hospital or LTCF), the majority (90/108, 83.3%) of patients with ESBL-

producing Klebsiella spp. (ESBL-Klebsiella spp.) were healthcare facility patients.

60.7% of the isolates were from patients in one of the three district health boards (DHBs)

in the greater Auckland area (ie, Waitemata, Auckland and Counties Manukau) (Table 14

in the Appendix).

Page 21: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 13 December 2014

3.2 Antimicrobial susceptibility

Table 7. Antimicrobial susceptibility among clinical isolates of all ESBL-producing

isolates, Escherichia coli and Klebsiella spp.

Antimicrobial Number (%) mg/L

Susceptible Intermediate Resistant MIC50 MIC90

All isolates (n=352) Amoxicillin-

clavulanate 91 (25.9) 145 (41.2) 116 (33.0) 16 32

Piperacillin-

tazobactam 334 (94.9) 11 (3.1) 7 (2.0) 2 16

Mecillinam 299 (84.9) 20 (5.7) 33 (9.4) 2 16

Ertapenem 348 (98.9) 2 (0.6) 2 (0.6) 0.03 0.12

Meropenem 352 (100) 0 - 0 - 0.03 0.06

Ciprofloxacin 130 (36.9) 34 (9.7) 188 (53.4) 4 ≥16

Gentamicin 172 (48.9) 2 (0.6) 178 (50.6) 16 ≥64

Tigecycline 345 (98.0) 0 - 7 (2.0) 0.25 1

Nitrofurantoin 237 (67.3) 64 (18.2) 51 (14.5) 16 128

Fosfomycin 339 (96.3) 2 (0.6) 11 (3.1) 2 16

Co-trimoxazole/

trimethoprim1 72 (20.5) 1 (0.3) 279 (79.3) NA NA

E. coli (n=224) Amoxicillin-

clavulanate 67 (29.9) 101 (45.1) 56 (25.0) 16 32

Piperacillin-

tazobactam 216 (96.4) 5 (2.2) 3 (1.3) 2 8

Mecillinam 205 (91.5) 6 (2.7) 13 (5.8) 1 8

Ertapenem 223 (99.6) 1 (0.5) 0 - 0.03 0.06

Meropenem 224 (100) 0 - 0 - 0.03 0.03

Ciprofloxacin 70 (31.3) 3 (1.3) 151 (67.4) ≥16 ≥16

Gentamicin 117 (52.2) 0 - 107 (47.8) 2 ≥64

Tigecycline 223 (99.6) 0 - 1 (0.5) 0.25 0.5

Nitrofurantoin 209 (93.3) 11 (4.9) 4 (1.8) 16 32

Fosfomycin 219 (97.8) 0 (0.0) 5 (2.2) 1 2

Co-trimoxazole/

trimethoprim 60 (26.8) 1 (0.5) 163 (72.8) NA NA

Klebsiella spp.

(n=111)

Amoxicillin-

clavulanate 22 (19.8) 39 (35.1) 50 (45.1) 16 32

Piperacillin-

tazobactam 101 (91.0) 6 (5.4) 4 (3.6) 4 16

Mecillinam 83 (74.8) 10 (9.0) 18 (16.2) 4 ≥128

Ertapenem 108 (97.3) 1 (0.9) 2 (1.8) 0.03 0.12

Meropenem 111 (100) 0 - 0 - 0.03 0.06

Ciprofloxacin 50 (45.1) 27 (24.3) 34 (30.6) 2 8

Gentamicin 50 (45.1) 0 - 61 (55.0) 32 ≥64

Tigecycline 106 (95.5) 0 - 5 (4.5) 1 2

Nitrofurantoin 26 (23.4) 46 (41.4) 39 (35.1) 64 256

Fosfomycin 106 (95.5) 1 (0.9) 4 (3.6) 8 16

Co-trimoxazole/

trimethoprim 9 (8.1) 0 - 102 (91.9) NA NA

1 The co-trimoxazole/trimethoprim susceptibility results are those reported by the referring laboratories

when submitting isolates. Consequently MIC50 and MIC90 values are not available (NA).

Page 22: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 14 December 2014

Resistance to co-trimoxazole/trimethoprim, ciprofloxacin, gentamicin and amoxicillin-

clavulanate was common among ESBL-E (Table 7). There were some significant

differences in resistance between E. coli and Klebsiella spp. Ciprofloxacin resistance was

significantly higher (p <0.05) in E. coli, but ciprofloxacin intermediate resistance was

higher in Klebsiella spp. Conversely, resistance to amoxicillin-clavulanate, co-

trimoxazole/trimethoprim, mecillinam, nitrofurantoin and tigecycline was significantly

more prevalent in Klebsiella spp. than E. coli (Table 7). Full MIC distribution data is

presented in Table 15 in the Appendix.

The majority (303/352, 86.1%) of isolates were multidrug resistant (to ≥3 antibiotic

classes), with a significantly higher proportion of Klebsiella spp. (105/111, 94.6%) being

multiresistant than E. coli (183/224, 81.7%). The most common resistance pattern among

E. coli was amoxicillin-clavulanate, ciprofloxacin, co-trimoxazole/trimethoprim and

gentamicin resistance and this pattern accounted for 25.9% (58/224) of E. coli. The same

pattern, with the addition of nitrofurantoin resistance, was the most common resistance

pattern among Klebsiella spp. and accounted for 21.6% (24/111) of Klebsiella spp. (Table

16 in the Appendix).

3.3 ESBL types

The overwhelming majority (97.2%, 342/352) of ESBLs identified were CTX-M types,

with the remainder being SHV or VEB types (Table 8). Notably, while both group 1 and

group 9 CTX-M ESBLs were common in E. coli, only group 1 CTX-Ms were common

among Klebsiella spp.

There were no clear associations between ethnicity and CTX-M type. Group 1 CTX-M

ESBLs were identified in 70.0% (14/20) of the ESBL-E from patients of Indian ethnicity

and 66.7% (18/27) of the ESBL-E from patients of other Asian ethnicities, compared with

67.9% (239/352) of all patients. Group 9 CTX-M ESBLs were identified in 20.0% (4/20)

of the ESBL-E from patients of Indian ethnicity and 37.0% (10/27) of the ESBL-E from

patients of other Asian ethnicities, compared with 29.6% (104/352) of all patients.

Page 23: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 15 December 2014

Multidrug resistance was prevalent among both ESBL-E with a group 1 CTX-M (88.3%,

211/239) and isolates with a group 9 CTX-M (81.7%, 85/104).

Table 8. Distribution of ESBL types by species

ESBL type1

Number (column %) isolates:

Escherichia coli

(n=224)

Klebsiella

species

(n=111)

Other

Enterobacteriaceae

(n=17)

All isolates

(n=352)

CTX-M2 221 (98.7) 108 (97.3) 13 (76.5) 342 (97.2)

CTX-M group 1 125 (55.8) 104 (93.7) 10 (58.8) 239 (67.9)

CTX-M group 9 97 (43.3) 4 (3.6) 3 (17.6) 104 (29.6)

SHV3 3 (1.3) 2 (1.8) 3 (17.6) 8 (2.3)

VEB4 0 1 (0.9) 1 (5.9) 2 (0.6)

1 No TEM-type ESBLs were identified.

2 One E. coli isolate had both a group 1 and group 9 CTX-M ESBL.

3 The SHV types included SHV-2, SHV-2a, SHV-12 and SHV-28.

4 The VEB types included VEB-1 and VEB-4.

3.4 Molecular types

3.4.1 E. coli types

The majority (71.4%, 160) of the 224 ESBL-E. coli belonged to phylogenetic group B2,

20.1% (45) belonged to group D, 6.3% (14) to group A, and 2.2% (5) to group B1.

All 160 phylogenetic group B2 isolates were tested in the PCR-based assay to identify

isolates that belong to the ST131 clone, and 76.3% (122/160) were positive. This indicates

that 54.5% (122/224) of all ESBL-E. coli were ST131. E. coli ST131 were not

significantly associated with any particular patient age group, sex or ethnicity, nor whether

the patient was in a healthcare facility or the community.

All 122 ST131 E. coli had a CTX-M-type ESBL, with an almost equal split between

group 1 CTX-M types (60, 49.2%) and group 9 CTX-M types (62, 50.8%). However,

while group 1 CTX-M ESBLs were identified almost as frequently in ST 131 E. coli as in

other E. coli (48.4% vs 51.6%, respectively), group 9 CTX-M ESBLs were more common

in ST131 E. coli (64.6%, p = 0.014). Ciprofloxacin resistance was more prevalent among

ST131 E. coli than other E. coli (86.9 vs 45.5%, p <0.001).

Page 24: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 16 December 2014

There was considerable diversity in the MLVA types identified among the 224 ESBL-

E. coli, with 62 types identified (Table 17 in the Appendix). The Simpson’s index of

diversity for the E. coli MLVA types was 0.880 (95% confidence intervals: 0.844-0.916).

There were 10 types that each accounted for ≥2% of the E. coli (equivalent to ≥5 isolates),

and these 10 types collectively accounted for 64.3% (114) of the 224 isolates (Figure 1 and

Table 17 in the Appendix).

None of the 10 most common E. coli MLVA types was uniquely associated with a

particular healthcare facility or even a DHB. The most common type, 5-2-6-1, which

accounted for 31.7% (71/224) of all E. coli, was isolated from patients in 13 of the 18

DHBs or combined DHB regions described in Table 14 in the Appendix.

MLVA types with a profile of x-2-6-1 (where x is variable) cluster with the most common

MLVA type 5-2-6-1 in the maximum parsimony tree (Figure 2), and isolates with such

MLVA profiles accounted for over half all E. coli (125/224, 55.8%). Almost all (122/125,

97.6%) isolates with a MLVA profile of x-2-6-1 were ST131 (Table 17 in the Appendix).

Full multilocus sequence typing (MLST) of representative isolates of MLVA types 5-2-6-1

and 9-2-6-1 confirmed these isolates were ST131 (Table 17 in the Appendix).

Conversely, none of the isolates with a MLVA profile distinct from x-2-6-1 were ST131

(Table 17 in the Appendix). There were three MLVA profiles distinct from x-2-6-1 that

were common to >5 isolates: types 2-1.5-5-1, 5-4-6-1 and 7-3-4-2. The multilocus

sequence types of representative isolates of these three MLVA types were ST2749, ST493

and ST1193, respectively (Table 17 in the Appendix). ST2749, ST493 and ST1193 do not

share any common alleles and are not part of the same clonal complex. They are also in a

distinct clonal complex from ST131, which shares one common allele with ST493 and no

common alleles with ST2749 and ST1193.

Page 25: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 17 December 2014

Figure 1. Prevalence of MLVA types found in E. coli and K. pneumoniae. Each

distinct MLVA type is represented by a different colour.

Page 26: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 18 December 2014

Figure 2. Maximum parsimony tree of the MLVA types among the 224 ESBL-

producing E. coli isolates. The tree was constructed in BioNumerics. Each node

represents a different MLVA type, with the size of the node indicating the number of

isolates with a given MLVA type. The length of the line indicates if the MLVA types are

single, double, or triple locus variants. ST131 isolates are represented by a green node or

partial node.

Page 27: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 19 December 2014

3.4.2 K. pneumoniae types

Again there was considerable diversity in the MLVA types identified among the 107

ESBL-producing K. pneumoniae, with 36 types identified (Table 18 in the Appendix). The

Simpson’s index of diversity for the K. pneumoniae MLVA types was 0.797 (95%

confidence intervals: 0.727-0.867). There were five types that each accounted for ≥2% of

the K. pneumoniae (equivalent to ≥3 isolates) and these five types collectively accounted

for 68.2% of the 107 isolates (Figure 1 and Table 18 in the Appendix).

None of the five most common K. pneumoniae MLVA types was uniquely associated with

a particular healthcare facility. However, 93.2% (41/44) of the isolates with the most

common MLVA type, NA-3-6.5-0, were isolated from patients in the three DHBs in the

greater Auckland area, with 70.5% (31/44) being from patients in the Waitemata DHB.

The clustering of the K. pneumoniae MLVA types is shown in the maximum parsimony

tree in Figure 3. The multilocus sequence types of representative isolates of the three most

common K. pneumoniae MLVA types, NA-3-6.5-0, 1-2-6-1 and NA-2-6-0, were ST25,

ST48 and ST17, respectively (Table 18 in the Appendix). ST25 and ST17 share five alleles

in common and are therefore more closely related to each other than ST48.

Page 28: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 20 December 2014

Figure 3. Maximum parsimony tree of the MLVA types among the 107 ESBL-

producing K. pneumoniae isolates. The tree was constructed in BioNumerics. Each node

represents a different MLVA type, with the size of the node indicating the number of

isolates with a given MLVA type. The length of the line indicates if the MLVA types are

single, double, or triple locus variants.

2.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-12.2-3-7-1

NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1NA-1-5.5--1

NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0NA-1-5-0

NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-0NA-NA-4.8-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-00.8-NA-5.5-0

1-1-7-21-1-7-21-1-7-21-1-7-21-1-7-21-1-7-21-1-7-21-1-7-21-1-7-2

NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0NA-1-6-0

NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1NA-4-7-1

1.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-11.5-4-6-1

NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0NA-3-4.8-0

NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1NA-2-6-1

2.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-02.2-2-6-0

2.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-02.2-1-6-0

1-2-5-11-2-5-11-2-5-11-2-5-11-2-5-11-2-5-11-2-5-11-2-5-11-2-5-1

1-2-6-11-2-6-11-2-6-11-2-6-11-2-6-11-2-6-11-2-6-11-2-6-11-2-6-1

2.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-12.2-4-8-1

1.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-01.5-3-7-0

1.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-01.5-3-4.8-0

2.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-4-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-12.2-2-6-1

NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0NA-2-7-0

NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0NA-3-7-0

1.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-01.5-4-6-0

1.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-01.5-4-8-0

NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0NA-3-6-0

2.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--12.2-2-8--1

2.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-02.2-NA-8-0

1.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-01.5-NA-8-0

1.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-01.5-1-5.5-0

NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0NA-2-6.5-0

NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0NA-3-6.5-0

NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1

NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0NA-2-6-0

NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1NA-1-NA--1

NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1NA-3-6-1

1.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-01.5-NA-6-0

NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0NA-1-4.8-0

Page 29: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 21 December 2014

4 DISCUSSION

Antimicrobial resistance in Enterobacteriaceae is as a major threat to public health.1

Increasing resistance in Enterobacteriaceae has resulted in decreasing options for

antimicrobial therapy, posing treatment challenges in both hospital and community

settings. Furthermore, the global dissemination of specific bacterial clones, and genes

encoding antimicrobial resistance determinants in Enterobacteriaceae has greatly facilitated

the increase and spread of ESBL-E. In this context, the purpose of this report was to

provide a contemporary overview of the antimicrobial susceptibility patterns and molecular

epidemiology of ESBL-E in New Zealand.

We found that the majority (86.1%) of ESBL-E were multidrug resistant, with the most

common resistance pattern being resistance to amoxicillin-clavulanate, ciprofloxacin, co-

trimoxazole/trimethoprim and gentamicin. Of the isolates in this study, 88.6% were from

urine, and approximately half (47.8%) of the E. coli were from patients in the community.

This highlights the therapeutic challenges posed by ESBL-E, particularly in the oral

treatment of community-onset E. coli urinary tract infections. Notably, the vast majority of

ESBL-E. coli isolates (93.3%) were susceptible to nitrofurantoin, and this has been

recommended as a first-line empiric treatment for uncomplicated UTI in New Zealand

(http://www.bpac.org.nz/Supplement/2013/July/antibiotics-guide.aspx). A recent study

demonstrated the clinical efficacy of nitrofurantoin in uncomplicated UTI due to ESBL-

E. coli.30 However, nitrofurantoin is contraindicated in renal impairment, and has low

penetration into tissues, thus limiting its utility beyond uncomplicated cystitis. In addition,

the frequency of dosing and duration of treatment may limit patient adherence. Finally,

nitrofurantoin has less in vitro efficacy against ESBL-Klebsiella spp., with only 23.4% of

isolates in this study testing susceptible.

Recently, there has been renewed interest in the use of older agents such as fosfomycin and

mecillinam for the oral treatment of infections caused by ESBL-E. Several studies have

evaluated the in vitro efficacy of fosfomycin, with reported rates of over 95% susceptibility

for ESBL-E. coli.31,32 In keeping with these findings, we observed a high rate of

fosfomycin susceptibility among ESBL-E. coli (97.8%), although susceptibility among

ESBL-Klebsiella spp. was somewhat lower at 95.5%. Oral fosfomycin is administered as a

single dose, and there have been concerns raised about the theoretical potential for

Page 30: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 22 December 2014

development of bacterial resistance with repeated dosing, although clinical evidence for

this phenomenon is currently limited.33

Mecillinam, an oral -lactam agent widely used in Northern Europe, has demonstrated

high in vitro efficacy against ESBL-E. coli in several studies.34,35 We also observed a high

rate (91.5%) of mecillinam susceptibility amongst ESBL-E. coli, although susceptibility

rates were lower for ESBL-Klebsiella spp. (74.8%). Both fosfomycin and mecillinam are

generally well tolerated, and are safe to use during pregnancy. At present, however,

neither are licensed or funded for use in New Zealand.

In serious cases of ESBL-E infection, the treatment of choice is a carbapenem, and it is

reassuring to note that 100% of ESBL-E. coli and ESBL-Klebsiella spp. tested susceptible

to meropenem. In addition, there were high rates of susceptibility to ertapenem in both

species (99.6% and 97.3%, respectively). Tigecycline is a broad-spectrum antibiotic that

has been used for the treatment of infections caused by multidrug-resistant Gram-negative

pathogens.36 It has proven in vitro efficacy against ESBL-E,37 with previous studies

reporting susceptibility rates of >99% for ESBL-E. coli and approximately 72-93% for

ESBL-Klebsiella spp.37,38 In keeping with these findings, we observed susceptibility rates

of 99.6% for ESBL-E. coli and 95.5% for ESBL-Klebsiella spp.

Similar to the previous molecular epidemiological survey of ESBL-E in New Zealand,8

there was an overwhelming predominance of CTX-M-type ESBLs, with 97.2% of ESBLs

in this study being CTX-M ESBLs. Overall, the majority (69.9%) of CTX-M ESBLs

belonged to CTX-M group 1, and the remainder belonged to CTX-M group 9. There were

notable differences between species, such that there were similar proportions of group 1

and group 9 CTX-Ms in E. coli (55.8% and 43.3%, respectively); however, CTX-Ms in

ESBL-Klebsiella spp. were dominated by group 1. A previous study from 2006-2007 in

Auckland described an association between CTX-M-15 (belonging to CTX-M group 1)

and Indian ethnicity, and CTX-M-14 (belonging to CTX-M group 9) and Chinese or

South-East Asian ethnicity.39 However, we did not find an association between distinct

ethnic groups and CTX-M types. In particular, CTX-M group 1 ESBLs were not

exclusively associated with Indian ethnicity, and CTX-M group 9 ESBLs were no more

common among the Asian group (ie, Asians other than those of Indian ethnicity) than other

Page 31: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 23 December 2014

ethnic groups. It is possible that the lack of association with specific ethnic group reflects

the transmission and subsequent endemicity of ESBL types in New Zealand over time.

Overall, the globally disseminated ST131 clone accounted for 54.4% of all ESBL-E. coli,

and 76.3% of phylogenetic group B2 E.coli isolates. Our ST131 prevalence is in keeping

with studies from other geographic regions, where ST131 prevalence among ESBL-E. coli

reportedly ranges from 23-64%.7 Although CTX-M-15 is the most commonly described

ESBL type associated with ST131,7 we found that group 1 and group 9 CTX-M types were

evenly distributed amongst ST131 (49.2% vs. 50.8%, respectively). However, geographic

variation in the distribution of CTX-M types within ST131 has been reported; for example,

CTX-M-14 is a relatively common type in ST131 ESBL-E. coli in Canada and another

group 9 CTX-M type, CTX-M-27, is relatively common in Japan and Switzerland.40-2

There was marked diversity among both the 224 ESBL-E. coli isolates, with a total of 62

MLVA types identified, and the 107 ESBL-K. pneumoniae isolates, with 36 MLVA types

identified. However, the Simpson’s index of diversity (0.880 vs 0.797 for ESBL-E.coli

and ESBL-K. pneumoniae, respectively) suggests that ESBL-K. pneumoniae were

somewhat more clonal than ESBL-E. coli. This observation of greater clonal restriction

among ESBL-K. pneumoniae is in keeping with our finding that the majority of ESBL-

Klebsiella spp. (83.3%) were isolated from patients associated with healthcare facilities,

and is consistent with the notion of differential transmission patterns between the two

species, with ESBL-E. coli circulating both in hospital and community settings, and ESBL-

Klebsiella spp. largely restricted to healthcare facilities.43

In summary, this study provides contemporary information on the antimicrobial resistance

patterns and molecular epidemiology of ESBL-E in New Zealand. We recommend that

surveys such as this one should be repeated periodically or preferably become an integral

part of the regular national ESBL-E surveys to enhance the usefulness of the regular

surveys. It is important that current data on the antimicrobial susceptibility of ESBL-E is

available for prescribers to ensure the most effective treatment of infections due to these

organisms. Data on the current molecular epidemiology and prevalent circulating strains

can often be useful background information for infection control personnel when

investigating local ESBL-E outbreaks. Future surveys could be further enhanced by (1)

Page 32: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 24 December 2014

obtaining patient hospitalisation history data from the National Minimum Dataset to enable

a more accurate description of the epidemiology of ESBL-E in healthcare vs community

settings; (2) full identification of the ESBL types; (3) identification of sub-clones of ST131

ESBL-E. coli; and (4) using DNA microarrays to identify virulence factors in ESBL-E in

New Zealand. Alternatively, whole genome sequencing could be considered to fully

characterise ESBL-E isolates in New Zealand.

Page 33: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 25 December 2014

REFERENCES

1 World Health Organization. Antimicrobial resistance: global report on surveillance;

2014. Available at:

http://www.who.int/drugresistance/documents/surveillancereport/en/.

2 Heffernan H, Woodhouse R. Annual survey of extended-spectrum β-lactamase

(ESBL)-producing Enterobacteriaceae, 2013. Wellington: Institute of

Environmental Science and Research; 2014. Available at

https://surv.esr.cri.nz/PDF_surveillance/Antimicrobial/ESBL/ESBL_2013.pdf.

3 Institute of Environmental Science and Research. Antimicrobial resistance data

from hospital and community laboratories, 2012. Available at:

https://surv.esr.cri.nz/PDF_surveillance/Antimicrobial/AR/National_AR_2012.pdf.

4 Paterson DL, Bonomo RA. Extended-spectrum beta-lactamases: a clinical update.

Clin Microbiol Rev 2005; 18: 657-86.

5 Pitout JD. Enterobacteriaceae that produce extended-spectrum β-lactamases and

AmpC β-lactamases in the community: the tip of the iceberg? Curr Pharm Des

2013; 19: 257-63.

6 Rogers BA, Sidjabat HE, Paterson DL. Escherichia coli O25b-ST131: a pandemic,

multiresistant, community-associated strain. J Antimicrob Chemother 2011; 66: 1-

14.

7 Nicolas-Chanoine MH, Bertrand X, Madec JY. Escherichia coli ST131, an

intriguing clonal group. Clin Microbiol Rev 2014; 27: 543-74.

8 Heffernan HM, Woodhouse RE, Pope CE, et al. Prevalence and types of extended

spectrum -lactamases among urinary Escherichia coli and Klebsiella spp. in New

Zealand. Int J Antimicrob Agents 2009; 34: 544-9.

9 Clinical and Laboratory Standards Institute. Performance standards for antimicrobial

susceptibility testing; twenty-fourth informational supplement. Wayne (PA): CLSI;

2014. M100-S24.

10 Jarlier V, Nicolas MH, Fournier G, et al. Extended-broad spectrum ß-lactamases

conferring transferable resistance to newer ß-lactam agents in Enterobacteriaceae:

hospital prevalence and susceptibility patterns. Rev Infect Dis 1988; 10: 867-78.

11 Clinical and Laboratory Standards Institute. Methods for dilution antimicrobial

susceptibility tests for bacteria that grow aerobically; approved standard – ninth

edition. Wayne (PA): CLSI; 2012. M7-A9.

12 European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for

interpretation of MICs and zone diameters. Version 4.0. Available from: URL:

http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/Breakpoint_tables

/Breakpoint_table_v_4.0.pdf (last accessed 23 June 2014).

Page 34: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 26 December 2014

13 Magiorakos A-P, Srinivasan A, Carey AB. Multidrug-resistant, extensively drug-

resistant and pandrug-resistant bacteria: an international expert proposal for interim

standard definitions for acquired resistance. Clin Microbiol Infect 2012; 18: 268-

81.

14 Woodford N, Fagan EJ, Ellington MJ. Multiplex PCR for rapid detection of genes

encoding CTX-M extended-spectrum beta-lactamases. J Antimicrob Chemother

2006; 57: 154-5.

15 Dubois V, Poirel L, Marie C, et al. Molecular characterization of a novel class 1

integron containing blaGES-1 and a fused product of aac(3)-Ib/aac(6")-Ib" gene

cassettes in Pseudomonas aeruginosa. Antimicrob Agents Chemother 2002; 46:

638-45.

16 Tenover FC, Rasheed JK. Detection of antimicrobial resistance genes and

mutations associated with antimicrobial resistance in microorganisms. In: Persing

DH, Tenover FC, Versalovic J, et al, editors. Molecular microbiology: diagnostic

principles and practice. Washington DC: ASM Publishing; 2004. p 391-406.

17 Naas T, Benaoudia F, Massuard S, et al. Integron-located VEB-1 extended-

spectrum ß-lactamase gene in a Proteus mirabilis clinical isolate from Vietnam. J

Antimicrob Chemother 2000; 46: 703-11.

18 Lindstedt BA. Multiple-locus variable number tandem repeats analysis for genetic

fingerprinting of pathogenic bacteria. Electrophoresis 2005; 26: 2567-82.

19 Lindstedt BA, Vardund T, Kapperud G. Multiple-locus variable-number tandem-

repeats analysis of Escherichia coli O157 using PCR multiplexing and multi-

colored capillary electrophoresis. J Microbiol Methods 2004; 58: 213-22.

20 Lobersli I, Haugum K, Lindstedt BA. Rapid and high resolution genotyping of all

Escherichia coli serotypes using 10 genomic repeat-containing loci. J Microbiol

Methods 2012; 88: 134-9.

21 Turton JF, Perry C, Elgohari S, et al. PCR characterization and typing of Klebsiella

pneumoniae using capsular type-specific, variable number tandem repeat and

virulence gene targets. J Med Microbiol 2010; 59: 541-7.

22 Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the

Escherichia coli phylogenetic group. Appl Environ Microbiol 2000; 66: 4555-8.

23 Clermont O, Dhanji H, Upton M, et al. Rapid detection of the O25b-ST131 clone of

Escherichia coli encompassing the CTX-M-15-producing strains. J Antimicrob

Chemother 2009; 64: 274-7.

24 Johnson JR, Menard M, Johnston B, et al. Epidemic clonal groups of Escherichia

coli as a cause of antimicrobial-resistant urinary tract infections in Canada, 2002 to

2004. Antimicrob Agents Chemother 2009; 53: 2733-9.

Page 35: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 27 December 2014

25 Wirth T, Falush D, Lan R, et al. Sex and virulence in Escherichia coli: an

evolutionary perspective. Mol Microbiol 2006; 60: 1136-51.

26 Diancourt L, Passet V, Verhoef J, et al. Multilocus sequence typing of Klebsiella

pneumoniae nosocomial isolates. J Clin Microbiol 2005; 43: 4178-82.

27 SAS version 9.3. Cary (NC): SAS Institute; 2013.

28 Simpson EH. Measurement of diversity. Nature 1949; 163: 688.

29 Grundmann H, Hori S, Tanner G. Determining confidence intervals when

measuring genetic diversity and the discriminatory abilities of typing methods for

microorganisms. J Clin Microbiol 2001; 39: 4190–2.

30 Tasbakan MI, Pullukcu H, Sipahi OR, et al. Nitrofurantoin in the treatment of

extended-spectrum β-lactamase-producing Escherichia coli-related lower urinary

tract infection. Int J Antimicrob Agents 2012; 40: 554-6.

31 Falagas ME, Kastoris AC, Kapaskelis AM, et al. Fosfomycin for the treatment of

multidrug-resistant, including extended-spectrum beta-lactamase producing,

Enterobacteriaceae infections: a systematic review. Lancet Infect Dis 2010; 10: 43-

50.

32 Creighton JA. Susceptibility testing of extended-spectrum-β-lactamase (ESBL)-

producing Enterobacteriaceae against oral antimicrobials, including fosfomycin and

mecillinam. NZ J Institut Med Lab Sci 2014; 68:19-23.

33 Karageorgopoulos DE, Wang R, Yu XH, et al. Fosfomycin: evaluation of the

published evidence on the emergence of antimicrobial resistance in Gram-negative

pathogens. J Antimicrob Chemother 2012; 67: 255-68.

34 Dewar S, Reed LC, Koerner RJ. Emerging clinical role of pivmecillinam in the

treatment of urinary tract infection in the context of multidrug-resistant bacteria. J

Antimicrob Chemother 2014; 69: 303-8.

35 Jansåker F, Frimodt-Møller N, Sjögren I, et al. Clinical and bacteriological effects

of pivmecillinam for ESBL-producing Escherichia coli or Klebsiella pneumoniae

in urinary tract infections. J Antimicrob Chemother 2014; 69: 769-72.

36 Stein GE, Babinchak T. Tigecycline: an update. Diagn Microbiol Infect Dis 2013;

75: 331-6.

37 Kelesidis T, Karageorgopoulos DE, Kelesidis I, et al. Tigecycline for the treatment

of multidrug-resistant Enterobacteriaceae: a systematic review of the evidence from

microbiological and clinical studies. J Antimicrob Chemother 2008; 62: 895-904.

38 Sader HS, Flamm RK, Jones RN. Tigecycline activity tested against antimicrobial

resistant surveillance subsets of clinical bacteria collected worldwide (2011). Diagn

Microbiol Infect Dis 2013; 76: 217-21.

39 Freeman JT, Williamson DA, Heffernan H, et al. Comparative epidemiology of

Page 36: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 28 December 2014

CTX-M-14 and CTX-M-15 producing Escherichia coli: association with distinct

demographic groups in the community in New Zealand. Eur J Clin Microbiol Infect

Dis 2012; 31: 2057-60.

40 Peirano G, van der Bij AK, Gregson DB, et al. Molecular epidemiology over an 11-

year period (2000 to 2010) of extended-spectrum β-lactamase-producing

Escherichia coli causing bacteremia in a centralized Canadian region. J Clin

Microbiol 2012; 50: 294-9.

41 Matsumura Y, Yamamoto M, Nagao M, et al. Clinical Microbiology Study Group.

Association of fluoroquinolone resistance, virulence genes, and IncF plasmids with

extended-spectrum-β-lactamase-producing Escherichia coli sequence type 131

(ST131) and ST405 clonal groups. Antimicrob Agents Chemother 2013; 57: 4736-

42.

42 Seiffert SN, Hilty M, Kronenberg A, et al. Extended-spectrum cephalosporin-

resistant Escherichia coli in community, specialized outpatient clinic and hospital

settings in Switzerland. J Antimicrob Chemother 2013; 68: 2249-54.

43 Romero L, López L, Rodríguez-Baño J, et al. Long-term study of the frequency of

Escherichia coli and Klebsiella pneumoniae isolates producing extended-spectrum

beta-lactamases. Clin Microbiol Infect 2005;11: 625-31.

Page 37: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 29 December 2014

APPENDIX

Table 9. Species distribution among the 352 clinical ESBL-producing

Enterobacteriaceae

Species Number of isolates Percent of isolates

Citrobacter farmeri 1 0.3

Citrobacter koseri 1 0.3

Enterobacter aerogenes 1 0.3

Enterobacter cloacae complex 9 2.6

Escherichia coli 224 63.7

Klebsiella oxytoca 2 0.6

Klebsiella pneumoniae 107 30.4

Klebsiella species1 2 0.6

Proteus mirabilis 2 0.6

Proteus species1 1 0.3

Salmonella Stanley 1 0.3

Serratia odorifera 1 0.3

1 Not further identified.

Table 10. Clinical source of the 352 ESBL-producing Enterobacteriaceae

Source Number of isolates Percent of isolates

CSF or blood 13 3.7

skin and soft tissue infection 14 4.0

respiratory tract 11 3.1

urine 312 88.6

other sites1 2 0.6

1 Includes eye and fluid (not further defined).

Table 11. Age and sex of patients from whom the 352 clinical ESBL-producing

Enterobacteriaceae were obtained

Age group

(years)

Number (column %) of isolates1

female male total

0-14 10 (3.8) 2 (2.4) 12 (3.4)

15-64 91 (34.7) 23 (27.1) 114 (32.5)

65-84 94 (35.9) 42 (49.4) 137 (39.0)

≥85 67 (25.6) 18 (21.2) 88 (25.1)

total 263 85

1 Age not recorded for one patient and sex not recorded for four patients.

Page 38: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 30 December 2014

Table 12. Age and ethnicity of patients from whom the 352 clinical ESBL-producing

Enterobacteriaceae were obtained

Age

group

(years)

Number (column %) of isolates1

Māori2 Pacific

Peoples Asian MELAA

European

or Other

0-14 1 (4.2) 2 (8.3) 4 (8.5) 1 (33.3) 4 (1.7)

15-64 13 (54.2) 14 (58.3) 26 (55.3) 1 (33.3) 58 (24.2)

65-84 9 (37.5) 7 (29.2) 16 (34.0) 1 (33.3) 97 (40.4)

≥85 1 (4.2) 1 (4.2) 1 (2.1) 0 81 (33.8)

total 24 24 473 3 240

1 Age or ethnicity not known for 14 patients.

2 Ethnic groups were prioritised in the following order: Māori, Pacific Peoples, Asian,

Middle Eastern/Latin American/African (MELAA), European or Other Ethnicity (including New

Zealander).

3 Among the 47 patients in the Asian ethnic group, 20 were Indian and the remaining 27 were of

Chinese, South East Asian, or ‘Asian ethnicity not further defined’.

Table 13. Categorisation of patients based on their current or recent hospitalisation

history and species of ESBL-producing Enterobacteriaceae

Patient

categorisation1,2

Number (column %) of isolates

E. coli

n=203

Klebsiella

species

n=108

Other species

n=17

Total2

Public hospital patient 78 (38.4) 77 (71.3) 9 (52.9) 164 (50.0)

Private hospital

patient

2 (1.0) 0 0 2 (0.6)

Long-term care

facility resident

26 (12.8) 13 (12.0) 4 (23.5) 43 (13.1)

Community patient 97 (47.8) 18 (16.7) 4 (23.5) 119 (36.3)

1 See the methods section for the description of the patient categorisation.

2 Hospitalisation history not known or recorded for 24 patients.

Page 39: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 31 December 2014

Table 14. District health board domicile of the patients

District Health Board Number of isolates1 Percent of isolates

Northland 11 3.1

Waitemata 103 29.3

Auckland 63 18.0

Counties Manukau 47 13.4

Waikato 23 6.6

Lakes 6 1.7

Bay of Plenty 6 1.7

Tairawhiti 5 1.4

Taranaki 4 1.1

Hawke's Bay 8 2.3

Whanganui 1 0.3

MidCentral 5 1.4

Capital and Coast/ Hutt Valley 31 8.8

Wairarapa 0 -

Nelson Marlborough 6 1.7

West Coast 0 -

Canterbury/South Canterbury 23 6.6

Southern 9 2.6

1 DHB not recorded for one patient.

Page 40: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 32 December 2014

Table 15. Distribution of minimum inhibitory concentrations (MICs) among clinical isolates of ESBL-producing Escherichia coli

(n=224), Klebsiella spp. (n=111) and other Enterobacteriaceae (n=17)

Antimicrobial Source Percent of isolates with an MIC (mg/L) of:1

0.002 0.004 0.008 0.016 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 1024

Amoxicillin-clavulanate

E. coli 8.0 21.9 45.1 20.1 4.0 0.9

Klebsiella 0.9 1.8 17.1 35.1 36.9 8.1

Other3 11.8 29.4 11.8 11.8 35.3

All4 0.3 5.7 19.9 41.2 25.0 5.7 2.3

Piperacillin-

tazobactam

E. coli 2.2 26.3 37.1 17.9 9.8 3.1 0.9 1.3 0.5 0.0 0.9

Klebsiella 2.7 1.8 21.6 25.2 28.8 10.8 4.5 0.9 1.8 0.9 0.9

Other 5.9 23.5 23.5 5.9 11.8 29.4

All 2.6 18.5 31.5 19.6 15.9 6.8 2.0 1.1 0.9 0.3 0.9

Mecillinam E. coli 1.3 4.0 25.5 20.5 16.5 19.2 4.5 2.7 2.7 1.3 1.8

Klebsiella 2.7 6.3 24.3 29.7 11.7 9.0 1.8 3.6 10.8

Other 5.9 17.7 11.8 5.9 23.5 23.5 0.0 5.9 5.9

All 0.9 2.6 17.3 15.9 18.8 21.9 7.7 5.7 2.3 2.3 4.8

Ertapenem E. coli 4.0 34.4 36.2 19.2 2.7 1.3 1.8 0.5

Klebsiella 1.8 8.1 40.5 30.6 9.9 4.5 1.8 0.9 0.0 1.8

Other 5.9 23.5 29.4 5.9 17.7 11.8 5.9

All 3.4 25.6 37.2 22.2 5.7 2.8 2.0 0.6 0.0 0.6

Meropenem E. coli 31.3 63.0 4.9 0.9

Klebsiella 0.9 81.1 14.4 0.9 0.9 0.9 0.9

Other 5.9 35.3 35.3 23.5

All 20.5 67.3 9.4 2.0 0.3 0.3 0.3

Ciprofloxacin E. coli 0.5 0.0 8.5 4.0 0.0 0.0 4.0 8.0 4.0 2.2 1.3 0.9 0.9 65.6

Klebsiella 0.9 1.8 2.7 5.4 1.8 2.7 4.5 20.7 4.5 24.3 18.0 3.6 9.0

Other 5.9 0.0 11.8 0.0 5.9 17.7 11.8 11.8 17.7 0.0 5.9 11.8

All 0.3 0.3 6.3 3.4 2.3 0.6 3.7 7.4 9.7 3.4 9.4 6.3 2.0 45.2

Gentamicin E. coli 1.3 20.1 25.5 4.5 0.9 0.0 0.9 9.8 37.1

Klebsiella 1.8 35.1 8.1 0.0 0.0 0.0 0.9 5.4 48.7

Other 5.9 17.7 0.0 0.0 5.9 11.8 0.0 0.0 58.8

All 1.7 24.7 18.8 2.8 0.9 0.6 0.9 8.0 41.8

Tigecycline E. coli 3.1 32.1 51.8 11.2 1.3 0.0 0.5

Klebsiella 0.9 2.7 17.1 56.8 18.0 4.5

Other 5.9 0.0 29.4 58.8 0.0 5.9

All 2.0 21.0 33.8 13.9 21.6 5.7 2.0

Page 41: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 33 December 2014

Antimicrobial Source Percent of isolates with an MIC (mg/L) of:1

0.002 0.004 0.008 0.016 0.03 0.06 0.12 0.25 0.5 1 2 4 8 16 32 64 128 256 512 1024

Nitrofurantoin E. coli 0.5 0.5 38.8 43.8 9.8 4.9 0.5 0.9 0.5

Klebsiella 0.9 3.6 18.9 41.4 18.9 12.6 3.6

Other 5.9 5.9 41.2 35.3 11.8

All 0.3 0.3 25.0 29.3 12.5 18.2 8.0 5.1 1.4

Fosfomycin E. coli 17.9 57.1 17.0 4.0 0.9 0.0 0.0 0.9 0.0 0.0 0.0 2.2

Klebsiella 1.8 27.0 14.4 34.2 16.2 1.8 0.0 0.9 1.8 0.9 0.9

Other 17.7 0.0 17.7 0.0 5.9 23.5 5.9 11.8 5.9 5.9 0.0 5.9

All 12.2 36.9 20.2 7.1 11.7 6.3 0.9 1.1 0.6 0.9 0.3 2.0

1 The white fields represent the range of antibiotic concentrations tested. MIC values less than or equal to the lowest concentration tested are presented as this lowest concentration. MIC values

greater than the highest concentration tested are presented as the next highest concentration after the highest concentration tested. The vertical bars indicate the breakpoints between the

susceptibility categories. For antibiotics where there are two vertical lines, the first line represents the breakpoint between susceptible and intermediate, and the second line represents the

breakpoint between intermediate and resistant. For antibiotics where there is one vertical line, the line represents the breakpoint between susceptible and resistant. The breakpoints marked for

ciprofloxacin are the CLSI breakpoints for Enterobacteriaceae other than Salmonella. The breakpoints marked for fosfomycin are the CLSI breakpoints for urinary E. coli.

Page 42: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 34 December 2014

Table 16. Common antibiotic resistance patterns1

Number (column %) isolates:

Resistance pattern1, 2 Escherichia coli

(n=224)

Klebsiella species

(n=111)

Amc Cip Fpi Gm 58 (25.9) 8 (7.2)

Cip Fpi Gm 30 (13.4) 1 (0.9)

Amc Cip Gm 24 (10.7) 0 -

Amc Cip Fpi Gm Nit 5 (2.2) 24 (21.6)

Amc Fpi Gm 23 (10.3) 6 (5.4)

Amc Fpi Gm Nit 0 - 16 (14.4)

Fpi Gm 13 (5.8) 3 (2.7)

Amc Fpi Gm Mec 12 (5.4) 0 -

Cip Gm 12 (5.4) 0 -

Amc Cip Fpi Gm Mec Nit 0 - 10 (9.0)

1 Resistance patterns only recorded when there were ≥10 isolates of either E. coli or a Klebsiella species

with the pattern. There were no instances of ≥10 isolates of any other species having the same pattern.

2 Amc, amoxicillin-clavulanate; Cip, ciprofloxacin; Fpi, co-trimoxazole/trimethoprim; Gm, gentamicin;

Mec, mecillinam; Nit, nitrofurantoin.

Page 43: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 35 December 2014

Table 17. MLVA profiles among Escherichia coli isolates and association of MLVA

types with phylogenetic group and ST131

MLVA type1 Number of

isolates

Cumulative

percentage

Associated

phylogenetic

group2

Number of isolates

within a MLVA type

that were ST1313

5-2-6-14 71 31.7 B2 (70) and D (1) 70

6-2-6-1 22 41.5 B2 21

2-1.5-5-15 9 45.5 A nt

4-2-6-1 7 48.7 B2 7

5-4-6-16 7 51.8 B2 0

7-3-4-27 7 54.9 B2 0

9-2-6-18 6 57.6 B2 6

7-2-6-1 5 59.8 B2 5

9-2-5-1 5 62.1 D nt

11-2-6-1 5 64.3 B2 4

5-0.5-5-1 4 66.1 D nt

8-0.5-6-2 4 67.9 D nt

9-2-5-0 4 69.6 D nt

4-0.5-7-0 3 71.0 D nt

10-2-6-1 3 72.3 B2 3

9-0.5-6-2 2 73.2 D nt

3-2-6-1 2 74.1 B2 2

4-3-4.8-2 2 75.0 B2 0

5-2-5-0 2 75.9 B2 0

5-2-5.5-NA9 2 76.8 B2 0

6-0.5-5-1 2 77.7 D nt

6-0.5-7-2 2 78.6 B1 (1) and D (1) nt

6-2-5.5-NA 2 79.5 B2 0

7-0.5-6-1 2 80.4 A (1) and B1 (1) nt

7-0.5-6-2 2 81.3 D nt

8-2-6-1 2 82.1 B2 2

8-3-4-2 2 83.0 B2 0

9-2-7-NA 2 83.9 D nt

9-3-4-2 2 84.8 B2 0

12-2-6-1 2 85.7 B2 2

1-0.5-5-3 1 86.2 A nt

1-NA-NA-NA 1 86.6 A nt

2-0.5-5-3 1 87.1 A nt

4-2-4.5-1 1 87.5 D nt

4-2-5.5-NA 1 87.9 B2 0

4-4-6-1 1 88.4 B2 0

5-1.5-5-1 1 88.8 A nt

5-4-7-NA 1 89.3 B2 0

6-0.5-7-1 1 89.7 D nt

6-0.5-7-NA 1 90.2 D nt

6-2-4-0 1 90.6 B2 0

6-3-6-1 1 91.1 B2 0

7-0.5-5-1 1 91.5 D nt

7-0.5-8-1 1 92.0 B1 nt

7-2-5-0 1 92.4 D nt

7-2-5-1 1 92.9 D nt

7-2-5.5-NA 1 93.3 B2 0

continued

Page 44: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 36 December 2014

MLVA type1 Number of

isolates

Cumulative

percentage

Associated

phylogenetic

group2

Number of isolates

within a MLVA type

that were ST1313

7-4-6-1 1 93.8 B2 0

8-0.5-6-NA 1 94.2 D nt

8-2-5-1 1 94.6 D nt

8-4-6-1 1 95.1 B2 0

10-0.5-6-1 1 95.5 B1 nt

10-0.5-7-2 1 96.0 D nt

10-2-5-1 1 96.4 D nt

10-2-7-NA 1 96.9 D nt

10-4-5.5-1 1 97.3 B2 0

11-0.5-6-2 1 97.8 D nt

11-0.5-7-2 1 98.2 D nt

11-2-5-1 1 98.7 D nt

11-2-7-NA 1 99.1 D nt

12-2-4-2 1 99.6 B2 0

16-0.5-6-1 1 100 B1 nt

1 Based on variable number tandem repeat loci O15711-VNTR2-VNTR13-CCR1.

2 If all isolates of a MLVA type did not belong to the same phylogenetic group, then the number of

isolates belonging to each phylogenetic group is given in parentheses.

3 Only isolates belonging to phylogenetic group B2 were tested for ST131 in the PCR-based assay. A

bold entry indicates that some phylogenetic group B2 isolates of the MLVA type were ST131

positive and others were ST131 negative. nt = not tested, as not phylogenetic group B2.

4 One isolate of MLVA type 5-2-6-1 was characterised using MLST and was ST131.

5 Two isolates of MLVA type 2-1.5-5-1 were characterised using MLST and were ST2749.

6 Two isolates of MLVA type 5-4-6-1 were characterised using MLST and were ST493.

7 Two isolates of MLVA type 7-3-4-2 were characterised using MLST and were ST1193.

8 One isolate of MLVA type 9-2-6-1 was characterised using MLST and was ST131.

9 NA denotes that no amplicon was found at the locus.

Page 45: Antimicrobial susceptibility and molecular epidemiology of … · 2015-02-10 · Antimicrobial susceptibility and molecular epidemiology of ... the oral agents mecillinam and fosfomycin,

Susceptibility and molecular epidemiology of

ESBL-producing Enterobacteriaceae in NZ, 2013 37 December 2014

Table 18. MLVA profiles among Klebsiella pneumoniae isolates

MLVA type1 Number of isolates Cumulative percentage

NA-3-6.5-02,3 44 41.1

1-2-6-14 17 57.0

NA-2-6-05 6 62.6

1-1-7-2 3 65.4

NA-1-6-0 3 68.2

2.2-3-7-1 2 70.1

NA-1-NA-(-1) 2 72.0

NA-3-4.8-0 2 73.8

0.8-NA-5.5-0 1 74.8

1-2-5-1 1 75.7

1.5-1-5.5-0 1 76.6

1.5-3-4.8-0 1 77.6

1.5-3-7-0 1 78.5

1.5-4-6-0 1 79.4

1.5-4-6-1 1 80.4

1.5-4-8-0 1 81.3

1.5-NA-6-0 1 82.2

1.5-NA-8-0 1 83.2

2.2-1-6-0 1 84.1

2.2-2-4-1 1 85.0

2.2-2-6-0 1 86.0

2.2-2-6-1 1 86.9

2.2-2-8-(-1) 1 87.9

2.2-4-8-1 1 88.8

2.2-NA-8-0 1 89.7

NA-1-4.8-0 1 90.7

NA-1-5-0 1 91.6

NA-1-5.5-(-1) 1 92.5

NA-2-6-1 1 93.5

NA-2-6.5-0 1 94.4

NA-2-7-0 1 95.3

NA-3-6-0 1 96.3

NA-3-6-1 1 97.2

NA-3-7-0 1 98.1

NA-4-7-1 1 99.1

NA-NA-4.8-0 1 100

1 Based on variable number tandem repeat loci K-N1-KPN3-KPN26.

2 NA denotes that no amplicon was found at the locus.

3 Two isolates of MLVA type NA-3-6.5-0 were characterised using MLST and were ST25.

4 Two isolates of MLVA type 1-2-6-1 were characterised using MLST and were ST48.

5 One isolate of MLVA type NA-2-6-0 was characterised using MLST and was ST17.