Blood Cells, Molecules and Diseases 52 (2014) 225–229

Contents lists available at ScienceDirect

Blood Cells, Molecules and Diseases

j ourna l homepage: www.e lsev ie r .com/ locate /bcmd

The diagnosis and molecular analysis of a novel 21.9kb deletion(Qinzhou type deletion) causing α+ thalassemia☆

Ju Long ⁎, Shanhuo Yan, Kegan Lao, Wanrong Pang, Xuehe Ye, Lei SunLaboratory of Medical Genetics, Qinzhou Maternal and Child Health Care Hospital, Guangxi 535099, PR China

☆ This study has been funded by the Scientific Research aof Qinzhou city (20130903).⁎ Corresponding author.

E-mail address: lab@longju.net (J. Long).

1079-9796/$ – see front matter © 2013 Elsevier Inc. All rihttp://dx.doi.org/10.1016/j.bcmd.2013.10.005

a b s t r a c t

a r t i c l e i n f o

Article history:Submitted 28 June 2013Revised 10 October 2013Available online 10 November 2013

(Communicated by E. Benz Jr., M.D., 15 October2013)

Keywords:ThalassemiaGap PCRQinzhou type deletionα+ thalassemia-α21.9

α-Thalassemia is a common single-gene genetic disease that can causeHb Bart's hydrops fetalis and HbHdiseasein tropical and subtropical regions. When examining conventional thalassemia genes, an only detected --SEA

genotype sample needs further analysis. In doing so, we found a novel 21.9 kb deletion (Qinzhou type deletion).The deletion position of the novel 21.9 kb deletion is from 14373 bp to 36299 bp of the α-globin gene cluster(NG_000006.1); thus, there exists a 21927bp sequence deletion, into which a 29bp sequence is added. After se-quence analysis, a group of Gap-PCR primers were synthesized to diagnose this novel thalassemia genotype.Through pedigree analysis, we deduced that the propositus obtained the novel alleles from her mother. The ge-notype of this propositus is --SEA/-α21.9 and its phenotype conforms to the characteristics of Hb H disease, estab-lishing that the combination between -α21.9 genotype and α0 genotype can lead to Hb H disease. By molecularanalysis, we established that this case fits the characteristic of an α+ thalassemia genotype.

© 2013 Elsevier Inc. All rights reserved.

Introduction

In tropical and subtropical regions, thalassemia is a common single-gene genetic disease, the major types of which are α-thalassemia andβ-thalassemia. The major hazard of α-thalassemia is Hb Bart's hydropsfetalis or Hb H disease. Expression of the α-globin is regulated by theα-globin gene cluster (NG_000006.1) located on chromosome 16p13.3.The α-globin gene cluster, in which order is HS40–ζ2–Ψζ1–Ψα2–Ψα1–α2–α1–θ, consists of a major regulatory element (HS-40),α genes (α1 and α2), an embryonic gene (ζ2), pseudo genes (Ψζ1,Ψα2 andΨα1) and θ. Usually, the α-thalassemia pathogenic genotypesare divided into deletion types and non-deletion types.α-Thalassemia ismainly caused by a deletion genotype (– or -α), in which molecularcharacteristic is that a large fragment deletion of the functional genewhich leads to the abnormal expression of α-globin; a minority ofα-thalassemias are caused by mutations (αTα) of the α1 or α2 gene.Normal chromosome 16 carries two α genes (α1 and α2). If two αgenes are inactive on a single chromosome, the thalassemia genotypeis designated as α0 thalassemia; if either of the α gene loses activity,the thalassemia genotype is designated as α+ thalassemia [1–3]. In thesouthern regions of China, themain genotypes leading toα0 thalassemiainclude --SEA and --THAI whereas the major genotypes resulting in

nd Technological Development

ghts reserved.

α+ thalassemia include -α3.7, -α4.2 and αCSα, αQSα and αWSα ofα-thalassemia of non-deletion type. Recently, α-thalassemia genotypesof a deletion type, which cause α+ thalassemia have been discoveredthroughout the world; they involve -α27.6, -α16.6, -α7.9, (α)α5.3, -α3.5,-α2.7 and -α2.4 [4–7].

Carriers of α-thalassemia gene express a decrease of mean cell vol-ume (MCV) and mean cell hemoglobin (MCH). The procedures in thal-assemia diagnostic centers are as follows: initially, a potentially affectedindividual is confirmed bymeasuring the subject'sMCV andMCH; if ab-normally low, onemeasures Hb A2 and Hb F by high performance liquidchromatography (HPLC); positive samples are sent for thalassemiagenetic determination [8]. Thalassemia diagnostic kits produced byYaneng Bioscience (Shenzhen) Co., Ltd. are used. For novel suspectedthalassemia samples of deletion types, a multiplex ligation-dependentprobe amplification (MLPA) approach is generally used for detection[9–11].

As a result of screening, we found novel α-thalassemia genotype, inwhich genotype was a 21.9kb deletion, found in a family from Qinzhoucity, China; thus, it was named Qinzhou type deletion in the α-globingene cluster causing α+ thalassemia.

Materials and methods

Materials and hematological analysis

The blood samples with EDTA anticoagulant were obtained from afamily from Qinzhou city, Guangxi, China. The propositus, a 16-week

Table 1Primer sequences in this study.

Primer Sequence(5′→ 3′) Position in NG_000006.1

1F CATCTCGGTCTGAAAGAAGCC 10041→ 100612F TACTCGGAAGACTGAGGCAAGA 10883→ 109043F CACTGTGGCTGTGGTAAAGG 11756→ 117754F TGCTGCCTCCTCCTGCTTGT 13181→ 132005F GACAAGCAGAGGGTGAAAGG 14199→ 142186F CGCCAATAAACCAATGAACG 15345→ 153647F GATCCATGTCTCACCTCCCT 15988→ 160078F TGGTGGAACAGAGGAGAAAC 16600→ 166199F CGAAGCCACAGCAGACAGCA 17595→ 1761410F GATGACTGCTGGTGGGTTTG 18726→ 1874511F ATGATACCAGCCATTTACTCCA 19483→ 1950412F ACGTGGTGACATTTGAGGGA 20136→ 201551R CCAGGAGCAAGCCAGGGTAA 36076→ 360572R GGGTTAGTCTGAGGGCTTCC 36511→ 364923R GGGTGGTGGGTGCTGGCTAA 36819→ 3680021.9-F GAGCAGGGTAAGGAGGGAACGA 14117→ 1413821.9-R TGGAGGTGTGGACGAGGCATT 36543→ 36523

Primer sequences in this study. 1F–12F are forward primers used for Gap-PCR locationwhile 1R–3R are reverse primers used to locateGap-PCR. 12 forwardprimers and 3 reverseprimers respectively combine to form 36 reaction tubes for completing Gap-PCR location.21.9-F/21.9-R are the Gap-PCR diagnostic primer groups of -α21.9 and the positive ampli-fication fragment is 529 bp.

226 J. Long et al. / Blood Cells, Molecules and Diseases 52 (2014) 225–229

pregnant woman and her husband needed thalassemia screening be-cause of her pregnancy. Neither parent had a history of a blood transfu-sion. BC5380 (Mindray, China) was used to obtain hematological datafrom the propositus, and the Bio-Rad Variant II HPLC system (Bio-Rad,USA) was used for the analysis. Using conventional thalassemia detec-tion reagents (Yaneng Bioscience, Shenzhen), the propositus had onlythe --SEA product but her phenotype did not agree with the --SEA homo-zygous genotype. Thus, the propositus was suspected as the carrier of anovelα-thalassemia gene of deletion type and her pedigreewas studied.

DNA extraction and conventional thalassemia genotype detection

DNAextractionwas done using Lab-AidDNAmini extraction kit (Bio-V, Xiamen) and the extraction process compliedwith the kit instructions.After DNA extraction, ultraviolet spectrophotometer (Quawell, USA)wasused to measure the DNA concentration. The detection of conventional

Fig. 1.MLPA results. A: the corresponding position of amplification products (number unit in bpNetherlands) kit. B: the corresponding fragment ratio ofMLPA results from the propositus II:1.conventional Gap-PCRdetection thepropositus has been verified to carry --SEA gene, the left sidethe ratio of 292 is 0.5 while the ratio of 346 is 1. Therefore, the deletion position on the 5′ end ofratio of 256 is 0 and the ratio of 337 is 0.5. Thus, the deletion position on the 3′ end of this nov

thalassemia genotypes employs thalassemia detection reagents (Yaneng,Shenzhen). The detection kits are divided into two types, namely, kits fordiagnosing α-thalassemia deletion genotypes and kits for diagnosingα-thalassemia non-deletion genotypes. Kits ofα-thalassemia of deletiontype combine gap-PCR and agarose gel electrophoresis methods and itsdetection range is α2, --SEA, -α3.7 and -α4.2. Then we judged the sampledeletion genotypes according to the result of agarose gel electrophoresismethod.α-Thalassemias of the non-deletion typewere detected by PCR-RDB method and its detection range is αCSα, αQSα and αWSα. Then, wejudged whether αCSα, αQSα and αWSα existed in accordance with thedetection result. We could judge the α-thalassemia genotypes of thesample by the combinative reference of results from two detection kits.GeneAmp PCR System 9700 (ABI, USA), ENDURO Electrophoresis Sys-tems (Labnet, USA), Molecular Imager Gel Doc XR+ Imaging System(Bio-Rad, USA) and ProBlot Hybridization Oven (Labnet, USA) wereapplied.

MLPA and Gap-PCR location

MLPA uses SALSA MLPA kit, P140-B4 HBA (MRC-Holland, theNetherlands). The GeneAmp PCR System 9700 and ABI3130 GeneticAnalyzer (ABI, USA) are applied. All performance steps are strictly inaccordance with the reagent's instructions. After MLPA locates theapproximate deletion fragments, we designed 12 forward primers(Table 1, 1F–12F) and 3 reverse primers (Table 1, 1R–3R). The combina-tion of 12 forward primers and 3 reverse primers completed the prelim-inary location of deletion positions. PCR reagents, 2× GoldStar TaqMasterMix (CWBio, Beijing), were used and primers were synthesizedby GenScript (Nanjing, China). In the PCR reaction system, the primerconcentration was 0.4 μM and the DNA template was 50ng. The PCR re-actionwas carried out by theGeneAmpPCR System9700. The PCRproce-dures were performed as follows: 95 °C (11min), next 35cycles at 95 °C(45s)/64 °C (90s)/72 °C (3min), and a final extension at 72 °C for 3min.

Sequencing and the design of diagnostic Gap-PCR primers

According to the result of Gap-PCR location, we chose 4 groups ofPCR products for sequencing. After mutual verification among 4 groups

) andα-globin gene cluster (NG_000006.1) sequence in P140-B4 HBA (MRC-Holland, theX-axis is the product fragment length (bp) while Y-axis represents their ratios. Since in theof --SEA deletion site is located in 318-184 of A and the right side is behind 283. In thefigurethis novel deletion genotype should be in the corresponding fragment of 292–346. But theel deletion genotype should be in the corresponding fragment of 256–337.

Fig. 2. The figure of Gap-PCR locating electrophoresis. 1-1–1-12 is the reaction tubemade by the combination of primer 2R and primer 1F–12F and 1-4 (2R/4F) and 1-5 (2R/5F) have clearamplification products; 2-1–2-12 is the reaction tubemade by the combination of primer 3R and primer 1F–12F and 2-4 (3R/4F) and 2-5 (3R/5F) show obvious amplification products. IndesigningGap-PCR location, the distance of 2R and 3R inNG_000006.1 corresponding position is 308bp so that the effectiveness of Gap-PCR location can bemutually verified between 1-4and 2-4 and 1-5 and 2-5.

227J. Long et al. / Blood Cells, Molecules and Diseases 52 (2014) 225–229

of sequencing results, the -α21.9 nucleic acid sequence was determined.Then, we designed a group of primers 21.9-F/21.9-R (Table 1) as Gap-PCR primers to diagnose this genotype and, thereby, confirm the-α21.9 genotype carrier in this pedigree. Primers are synthesized byGenScript. In the PCR reaction system, the primer concentration is0.4μM and the DNA template is 50ng. The PCR reaction was performedby the GeneAmp PCR System 9700. The PCR procedures were done inthe following steps: 95 °C (11min), next 35 cycles at 95 °C (45 s)/64 °C(45 s)/72 °C (45 s), and a final extension at 72 °C for 10min.

Results

The results of MLPA and Gap-PCR location

According to the MLPA results (Fig. 1) and the analysis of knownthalassemia deletion genotypes in the propositus, we found that the 5′end of the breakpoint in this deletion genotype sequence is between10229 and 20362 of theα-globin gene cluster (NG_000006.1), whereasthe 3′ end of the breakpoint lies between 36051 and 36673 in theα-globin gene cluster.

Fig. 3. Sequencing results. The PCR products of 5F/3R, 5F/2R, 4F/3R and 4F/2Rwere selected forbreakpoint on the 5′ end of this novelα-thalassemia gene in deletion typeswas GCTG, located innovel α-thalassemia gene in deletion types was CCTT, located in 36299. The underlined part in

The Gap-PCR location (Fig. 2) showed that obvious amplificationproducts existed around 1400 bp for the 5F/3R reaction group; therewere distinct amplification products around 400bp for the 5F/2R reac-tion group; there were amplification products around 1700 bp for the4F/3R reaction group; and amplification products we present around700 bp for the 4F/2R reaction group. The mutual verification among4 groups of amplification products showed that the breakpoint onthe 5′ end in this novel thalassemia gene in deletion types wasbetween the 5F and 6F primer sections (14199 → 15345) while thebreakpoint on the 3′ end was between the 1R and 2R primer sections(36511→36076).

Sequencing results

We selected PCR products of 5F/3R, 5F/2R, 4F/3R and 4F/2R for se-quencing. Sequencing was conducted by GenScript. The sequencing re-sults (Fig. 3) showed that the breakpoint of this novel thalassemia genesequence in deletion types is GGAGCTTTTCCTTCCCTGGAACGCTG-GGGAAGGGTGGGTGGGAATAACAGCTTTT-CCTTCCCCAGAAGTCCACCCCTTCCTTCCTCACCCTG. Its 5′ end of the breakpoint was in 14373 of theα-globin gene cluster (NG_000006.1), whereas its 3′ end of the

sequencing and the sequencing results were mutually verified. As shown in the figure, the14373 ofα-globin gene cluster (NG_000006.1);while the breakpoint on the 3′ end of thisred was inserted 29 bp sequence.

Fig. 4. The composition of -α21.9 genotype. A: the figure of the corresponding functional area in normal α-globin gene cluster (NG_000006.1) sequence; B: the deletion area of -α21.9

genotype from 14373 to 36299 of α-globin gene cluster (NG_000006.1); C: the composition of -α21.9 genotype after deletion restructuring, including part of ζ2, inserted 29 bp and α1.

228 J. Long et al. / Blood Cells, Molecules and Diseases 52 (2014) 225–229

breakpointwas located in 36299. There existed a 21927bp sequence de-letion and a 29bp sequence is added in the deletion part. The deletion ofthis novel thalassemia genotype (Fig. 4) covered part of ζ2 andΨζ1–Ψα2–Ψα1–α2 genes and there is a complete α1 gene.

Gap-PCR diagnosis and pedigree analysis

We obtained the -α21.9 complete sequence based on the comparisonbetween sequencing results and the α-globin gene cluster (NG_000006.1) sequence. According to the characteristics of this sequence, wedesigned Gap-PCR diagnostic primer 21.9-F/21.9-R (Table 1), which isused for clinical diagnosis and pedigree analysis and also aimed atdiagnosing -α21.9 and its positive PCR fragment was 529 bp. Then we

Table 2Hematological data and thalassemia genotype of this family members.

I:1 I:2 II:1

Age/gender 54/M 52/F 24/FRBC × 1012 6.20 4.24 5.00Hb (g/L) 139 103 77MCV (fL) 66.8 74.6 49.5MCH (pg/cell) 22.4 24.3 15.4HbA2 2.8 2.2 1.5HbF 1.8 1.4 0.7Fer (μg/L) Not tested Not tested 202.9α genotype –SEA/αα -α21.9/αCSα –SEA/-α21.9

β genotype N/N N/N N/N

The results of hematological data detection, HPLC detection and gene genotyping of -α21.9

genotype pedigree. As results show, II:1 is the patientwith Hb H disease, which proves thecombination of -- genotype and -α21.9 is likely to cause Hb H disease.

Fig. 5.Thepedigreedetectionwith -α21.9 genotype. A: the pedigreefigurewith -α21.9 genotype.PCR diagnostic primers were used to detect this pedigree, which proves that -α21.9 of the prop

performed the pedigree detection of the blood samples from the propos-itus' and her husband's parents and conducted thalassemia genotypingfor this pedigree by using conventional thalassemia kits and the Gap-PCR diagnostic primers we designed for diagnosing -α21.9. The detectionresult of hematological data, the result of HPLC and the result of α-thalassemia and β-thalassemia genotypes among pedigree membersare shown in Table 2. From the pedigree and the -α21.9 electrophoresisresults, we knew that the propositus obtained the -α21.9 gene from hermother (Fig. 5).

Discussion

Thalassemia is prevalent in the southern regions of China, where it isa single-gene genetic disease. The carrier rate of theα-thalassemia geneis approximately 15.5% [12]. The deletion genotypes (– or -α) and thenon-deletion genotypes (αTα) are themain cause ofα-thalassemia. De-letion genotypes include --SEA, -α3.7and -α4.2 and their detection meth-od is Gap-PCR [13]; and non-deletion α-thalassemia genotypes containαCSα, αQSα and αWSα. PCR-RDB is used to detect them [14]. The majorhazards ofα-thalassemia are HbH disease andHbBart's hydrops fetalis.The primary genotype that causes Hb H disease is α0/α+ [15,16],whereas the genotype that causes Hb Bart's hydrops fetalis is α0/α0

[1]. Both lead to serious consequences. Among the Chinese population,the key α0 genotypes are --SEA and --THAI, whereas the main α+ geno-type (including -α and αTα) comprises -α3.7, -α4.2, αCSα, αQSα andαWSα. Except --THAI, α-thalassemia genotyping kits used in the south-ern regions of China focus on the above 6 genotypes for detection. Dueto the large population in China and the high carrier rate of thalassemia

II:1was theproposituswith 16-weeks of pregnancy and its genotype is --SEA/-α21.9; B:Gap-ositus I:1 inherited her mother II:2 and the genotype of her husband is αα/αα.

Fig. 6. The possible composition mechanism of -α21.9 genotype. A: the different sequences labeled with ▲ were the same while another different sequence labeled with ● was also thesame. The large fragment deletion may be derived from copy position errors of these sequences and these deletions are from 14373 of α-globin gene cluster (NG_000006.1) to 36299.The origin of inserted 29 bp may be recombining between CTG of 14371–14373 and CTG of 36308–36306 reverse sequence in NG_000006.1. Then those combined GGGAAGGGTGGGof 36305–36294 reverse sequence in NG_000006.1 and inserted a length of TGGGAATAAC of 10 bp sequence to connect AGCTTTT of 14350–14356 sequence in NG_000006.1. LaterCCTTCCC of 14357–14363 and CCTTCCC of 36299–36305 recombine and continued the copy process after 36299. B: the formation cause of 10 bp's insertion sequence TGGGAATAACwas that the positive and negative sequences of 14306–14320 in NG_000006.1 recombine. TGGG came from the repeated copying of the reverse sequence 36297–36294 inNG_000006.1. And the sequence AGCT (labeled with ○) can make the insertion sequence reconnect 14350–14353 of NG_000006.1.

229J. Long et al. / Blood Cells, Molecules and Diseases 52 (2014) 225–229

genes in the southern areas, recently used kits can detect the majorthalassemia genotypes. However, the novel thalassemia genotypeswill escape prenatal diagnosis.

Our newly discovered -α21.9 (Qinzhou type deletion) genotype is aα+ genotype and combined with α0 it can result in Hb H disease (justas II:1 individual detected in the pedigrees). The formation of thegenotype is performed in the following steps: in the replication processCTG of 14371–14373 (in NG_000006.1) and the reverse sequence CTGof 36308–36306 (in NG_000006.1) recombine; then those combinewith the reverse sequence GGGAAGGGTGGG of 36305–36294 (inNG_000006.1); later CCTTCCC of 14357–14363 and CCTTCCC of36299–36305 recombine and continue the replication process after36299; and finally these create a new genotype -α21.9 (Fig. 6A). Theformation of the insertion sequence TGGGAATAAC in 10 bp occurswhen the positive and negative sequences of 14306–14320 (inNG_000006.1) recombine. The formation of TGGG is derived fromthe repetitive copying of the reverse sequence of 36297–36294 (inNG_000006.1). The sequence AGCT can make the insertion sequenceby reconnecting to 14350–14353 of NG_000006.1 (Fig. 6B). Becausethere exists a complete α1 fragment in this genotype, the propositus(II:1, genotype --SEA/-α21.9) still has an active α1.

In detecting the pedigree with -α21.9 genotype, the propositus (II:1,genotype --SEA/-α21.9) is a patient with Hb H disease, which proves thatthe combination of this genotype and α0 genotype will cause Hb H dis-ease. This genotype is a novel α-thalassemia deleted gene. In conven-tional thalassemia screening, if the individual genotype with this geneis -α21.9/αα, it may not be detected by screening. If this individual andher spouse with α0 genotype have a child, it will lead to an error in pre-natal diagnosiswhen conventional detection kits are used. Because of thelarge population and higher carrier rate in southern parts of China, asubject's hematological data, HPLC electrophoresis, and genotypemutualmatching should be examined carefully during thalassemia screening. Ifthe result of routine screening is a homozygous individual of deletion ornon-deletion type, we should consider whether this individual carries anovel non-deletion type to ensure the accuracy of classification.

Conflict of interest

Wedeclare thatwe have no financial and personal relationshipswithother people or organizations that can inappropriately influence our

work, there is no professional or other personal interest of any natureor kind in any product, service and/or company that could be construedas influencing the position presented in, or the review of, themanuscriptentitled "The diagnosis andmolecular analysis of a novel 21.9kb deletion(Qinzhou type deletion) causing α+ thalassemia."

References

[1] C.L. Harteveld, D.R. Higgs, Alpha-thalassaemia, Orphanet J. Rare Dis. 5 (May 282010) 13.

[2] D.R. Higgs, M.A. Vickers, A.O. Wilkie, et al., A review of the molecular genetics of thehuman alpha-globin gene cluster, Blood 73 (1989) 1081–1104.

[3] H.H. Kazazian Jr., The thalassemia syndromes: molecular basis and prenatal diagno-sis in 1990, Semin. Hematol. 27 (1990) 209–228.

[4] X.F. Wei, X. Shang, D.Q. He, et al., Molecular characterization of a novel 27.6-kbdeletion causing α(+) thalassemia in a Chinese family, Ann. Hematol. 90 (1) (Jan2011) 17–22.

[5] M.J. Rugless, C.A. Fisher, J.M. Old, et al., A large deletion in the human alpha-globincluster caused by a replication error is associatedwith an unexpectedlymild pheno-type, Hum. Mol. Genet. 17 (2008) 3084–3093.

[6] C.L. Harteveld, P. van Delft, P.W. Wijermans, et al., A novel 7.9 kb deletion causingalpha+-thalassaemia in two independent families of Indian origin, Br. J. Haematol.120 (2) (Jan 2003) 364–366.

[7] M. Lin, J.R. Wu, Y. Huang, et al., Clinical and molecular characterization of a rare2.4 kb deletion causing α(+) thalassemia in a Chinese family, Blood Cells Mol.Dis. 49 (2) (Aug 15 2012) 83–84.

[8] G. Fucharoen, K. Sanchaisuriya, N. Sae-ung, et al., A simplified screening strategy forthalassaemia and haemoglobin E in rural communities in south-east Asia, Bull.World Health Organ. 82 (5) (May 2004) 364–372.

[9] C.L. Harteveld, A. Voskamp, M. Phylipsen, et al., Nine unknown rearrangements in16p13.3 and 11p15.4 causing alpha- and beta-thalassaemia characterised by highresolution multiplex ligation-dependent probe amplification, J. Med. Genet. 42(12) (Dec 2005) 922–931.

[10] L. Stuppia, I. Antonucci, G. Palka, et al., Use of the MLPA assay in the molecular diag-nosis of gene copy number alterations in human genetic diseases, Int. J. Mol. Sci. 13(3) (2012) 3245–3276.

[11] A. Colosimo, V. Gatta, V. Guida, et al., ApplicationofMLPAassay to characterizeunsolvedα-globin gene rearrangements, Blood Cells Mol. Dis. 46 (2) (Feb 15 2011) 139–144.

[12] H.F. Pan, G.F. Long, Q. Li, et al., Current status of thalassemia in minority populationsin Guangxi, China, Clin. Genet. 71 (5) (May 2007) 419–426.

[13] A.S. Tan, T.C. Quah, P.S. Low, et al., A rapid and reliable 7-deletionmultiplex polymerasechain reaction assay for alpha-thalassemia, Blood 98 (1) (Jul 1 2001) 250–251.

[14] M. Lin, J.J. Zhu, Q. Wang, et al., Development and evaluation of a reverse dot blotassay for the simultaneous detection of common alpha and beta thalassemia inChinese, Blood Cells Mol. Dis. 48 (2) (Feb 15 2012) 86–90.

[15] J.A. Phillips III, T.A. Vik, A.F. Scott, et al., Unequal crossing-over: a common basis ofsingle alpha-globin genes in Asians and American blacks with hemoglobin-Hdisease, Blood 55 (6) (Jun 1980) 1066–1069.

[16] A.Y. Chan, C.C. So, E.S. Ma, et al., A laboratory strategy for genotyping haemoglobin Hdisease in the Chinese, J. Clin. Pathol. 60 (8) (Aug 2007) 931–934.