ORIGINAL INVESTIGATION

Role of pregnane xenobiotic receptor in the midbrain ventraltegmental area for estradiol- and 3α,5α-THP-facilitatedlordosis of female rats

C. A. Frye & C. J. Koonce & A. A. Walf

Received: 4 April 2013 /Accepted: 5 December 2013# Springer-Verlag Berlin Heidelberg 2014

AbstractRationale Progesterone and its metabolite, 5α-pregnan-3α-ol-20-one (3α,5α-THP), have actions in the ventral tegmentalarea (VTA) that are required for lordosis, a characteristicmating posture of female rodents. 17β-estradiol (estradiol)co-varies with progestogens over natural cycles, enhancesproduction of 3α,5α-THP, and is required for successfulreproductive behavior.Objectives A question of interest is the role of pregnanexenobiotic receptor (PXR), a nuclear receptor that regulatesenzymes needed for the production of 3α,5α-THP, forestradiol-mediated lordosis. The hypothesis tested was that ifPXR is involved in estradiol-mediated biosynthesis of 3α,5α-

THP and reproductive behavior, knocking down expression ofPXR in the VTA of estradiol-primed, but not vehicle-primed,rats should decrease lordosis and midbrain 3α,5α-THP; ef-fects may be attenuated by 3α,5α-THP administered to theVTA.Methods Ovariectomized rats were administered subcutane-ous injections of oil vehicle or estradiol. Rats were thenadministered PXR antisense oligonucleotides (PXR AS-ODNs; which are expected to locally knock down expressionof PXR), or control (saline), infusions to the VTA. Rats wereadministered 3α,5α-THP or vehicle via infusions to the VTA.Reproductive behavior (paced mating task) of rats was deter-mined in addition to exploratory (open field), affective (ele-vated plus maze), and pro-social (social interaction task)behavior.Results Reproductive behavior (i.e., increased lordosis) wasenhanced with estradiol-priming and infusions of 3α,5α-THPto the VTA. Infusions of PXR AS-ODNs to the VTA attenu-ated responses in estradiol-, but not vehicle-, primed rats,compared to control infusions.Conclusions PXR may be involved in a neuroregulatory re-sponse involving biosynthesis of 3α,5α-THP in the midbrainVTA of estradiol-primed rats.

Keywords Pregnane xenobiotic receptor (PXR) .Midbrainventral tegmental area . 3α,5α-THP

Introduction

One approach that has been taken to further understand themechanisms of progestogens for complex behaviors is to uselordosis, a hormone-dependent mating posture of female ro-dents, as a bioassay. Progestogens amplify estradiol-initiatedincreases in reproductive behavior, in part through actions in

C. A. Frye : C. J. Koonce :A. A. WalfDepartment of Psychology, The University at Albany-SUNY, LifeSciences 01058, 1400 Washington Ave., Albany, NY 12222, USA

C. A. FryeDepartment of Biological Sciences, The University atAlbany-SUNY, Life Sciences 01058, 1400 Washington Ave.,Albany, NY 12222, USA

C. A. FryeThe Centers for Neuroscience, The University at Albany-SUNY, LifeSciences 01058, 1400 Washington Ave., Albany, NY 12222, USA

C. A. FryeLife Sciences Research, The University at Albany-SUNY, LifeSciences 01058, 1400 Washington Ave., Albany, NY 12222, USA

C. A. Frye : C. J. Koonce :A. A. WalfDepartment of Chemistry and Biochemistry, Institute for ArcticBiology, The University of Alaska–Fairbanks,Fairbanks, AK 99775, USA

C. A. Frye (*) : C. J. Koonce :A. A. WalfAlaska IDeA Network of Biomedical Excellence, The University ofAlaska–Fairbanks, Fairbanks, AK 99775, USAe-mail: cheryl.a.frye@gmail.com

PsychopharmacologyDOI 10.1007/s00213-013-3406-0

brain regions, such as the ventromedial hypothalamus(Ahdieh et al. 1986; Christensen et al. 2011; Debold et al.1982; Mani and Blaustein 2012; Micevych and Christensen2012; Pleim et al. 1989; Rubin and Barfield 1983a, b) and themidbrain ventral tegmental area (VTA; Debold and Malsbury1989; Frye 2011; Lisciotto et al. 1991; Pleim et al. 1990;1991). Analyses of lordosis responding has been utilized toelucidate steroid receptor as well as novel neurotransmittertargets of progestogens in brain regions, such as the ventro-medial hypothalamus (Balasubramanian et al. 2008a, b;García-Juárez et al. 2011; González-Mariscal et al. 1989;Etgen et al. 2006), and the midbrain VTA (reviewed in Frye2011). Thus, there are novel mechanisms of action in braincircuits supporting lordosis.

A related question to understanding the novel targets ofprogestogens is elucidating the sources of progestogens inthe midbrain. In this region, some of progesterone’s effectsoccur through actions of 5α-pregnan-3α-ol-20-one (3α,5α-THP). Ovarian progesterone is readily metabolized todihydroprogesterone by 5α-reductase and then to 3α,5α-THP by 3α-hydroxysteroid dehydrogenase in the VTA;blocking any of these enzymes attenuates progesterone’s facil-itating effects on lordosis and other socially relevant behaviors,and 3α,5α-THP-replacement can reverse these effects (Beyeret al. 1999; Frye 2011; Mòdol et al. 2011). However, proges-terone’s and 3α,5α-THP’s effects to prevent restraint stress-induced reductions in lordosis of female rats are not mitigatedby administration of metabolism inhibitors, suggesting othersources of progestogens for effects on lordosis (Miryala et al.2011). 3α,5α-THP is a neurosteroid produced de novo in thebrain (Baulieu 1991). This de novo synthesis of 3α,5α-THP inthe brain was noted by Purdy and colleagues decades agofollowing exposure to acute stressors (Barbaccia et al. 1996;Purdy et al. 1991; Vallée et al. 2000). In the midbrain VTA, denovo synthesis of 3α,5α-THP has been noted following socialchallenges, such as mating (reviewed in Frye 2011). Inhibitorsof rate-limiting factors (e.g., 18-kDa translocator protein, ste-roidogenic acute regulatory protein, cytochrome P450-dependent side chain cleavage enzymes) involved in cholester-ol metabolism, and, thereby, production of 3α,5α-THP attenu-ate lordosis (reviewed in Frye 2011; King et al. 2002; MellonandDeschepper 1993; Papadopoulos et al. 2006). An importantquestion is what other upstream factors may be important forregulating 3α,5α-THP biosynthesis.

Pregnane xenobiotic receptor (PXR) may be involved in3α,5α-THP’s actions in the VTA. PXR acts as a transcriptionfactor for cytochrome P450 enzymes involved in drug andsteroid metabolism (Harmsen et al. 2007; Ma et al. 2008; Xuet al. 2005; Zhang et al. 2008). PXR has been referred to as the“master regulator” of xenobiotic clearance for its role in me-tabolism and efflux of these factors (Dussault and Forman2002; Francis et al. 2003; Geick et al. 2001; Kliewer et al.2002). PXR is most well-known for these effects in the liver,

and other excretory and barrier tissues, such as the kidneys andintestines, and has received less focus on its potential in thecentral nervous system until more recently. It had been thoughtthat PXR was not expressed in the central nervous system, butPXR has been identified in the central nervous system in manymammals, including humans, pigs, rabbits, and rodents (Baueret al. 2004; Frye 2011; Frye et al. 2011; Lamba et al. 2004;Marini et al. 2007; Mellon et al. 2008). A role of hormonalmilieu for PXR expression is supported by the observation thatthere is greater expression of PXR protein in the midbrain ofproestrous rats compared to diestrous rats or male rats (Frye2011). Activating PXR in the midbrain VTAwith PXR ligands,including 3α,5α-THP, increases lordosis of estradiol-primedrats (Frye 2011), whereas blocking PXR in the midbrain VTAwith antisense oligodeoxynucleotides (AS-ODN) infusions tothis region reduced expression of PXR and 3α,5α-THP levelsin the midbrain and lordosis responding of proestrous rats (Fryeet al. 2013). Whether replacement of 3α,5α-THP followingknock down of PXR in the VTA can reverse these effects is ofinterest.

During proestrus, there are sequential increases in estradiolfollowed by elevations in progestogen levels, such that ourprevious studies on the role of PXR for mating were not ableto fully address whether these effects of PXR manipulationswere estradiol and/or progestogen dependent. Estradiol canenhance neurosteroidogenic enzyme activity and, subsequent-ly, 3α,5α-THP levels (Cheng and Karavolas 1975; Frye2011). As well, estradiol-priming is required for 3α,5α-THPto facilitate the consummatory aspects of mating behavior ofovariectomized female rats (Frye et al. 2008). How thesedistinct effects of estradiol may involve PXR has not beensystematically investigated. We hypothesized that if PXR isinvolved as an important factor in estradiol-mediated biosyn-thesis of 3α,5α-THP in the midbrain and lordosis, infusionsof PXR AS-ODNs to the VTA of estradiol-primed, but notvehicle-primed, rats should decrease reproductive behaviorand midbrain 3α,5α-THP levels. Further, these effects maybe attenuated by replacement of 3α,5α-THP to the midbrainVTA. Because reproduction of rats involves lordosis as wellas changes in exploration, anxiety, and social behaviors, andmating-induced biosynthesis of 3α,5α-THP occurs incorticolimbic structures (reviewed in Frye 2011), behavior ofrats in the open field, elevated plus maze, and social interac-tion test was assessed with standard measures of reproduction(lordosis, proceptivity, and aggression/rejection).

Methods and materials

Principles of laboratory animal care, “Guidelines for the Careand Use of Mammals in Neuroscience and BehavioralResearch” (National Research Council 2003), as well asUnited States laws governing use of animal subjects in

Psychopharmacology

research were followed in completing the experiments de-scribed herein. These methods involving animal subjects inthe experiments described in this report were pre-approved bythe Institutional Animal Care and Use Committee at theinstitution where the experiment was conducted (TheUniversity at Albany-SUNY).

Animal housing Long-Evans female rats (N=158), approxi-mately 55–60 days old, were obtained from the breedingcolony in the Life Sciences Laboratory Animal Core Facilityat The University at Albany-SUNY (original stock obtainedfrom Taconic, Germantown, NY, USA), or were purchasedfrom Taconic. All experimental rats were group-housed inpolycarbonate cages (45 cm long×24 cm wide×21 cm high)with autoclaved woodchip bedding, and continuous access toPurina Rat Chow and tap water in their home cages. Thehousing room was maintained at 21±1 °C and on a 12:12 hreversed light cycle (lights off at 08:00 h), such that rats wereassessed during their dark/active phase. Breeder male ratsfrom the colony (N=15) were utilized in the paced matingtask, and were group-housed with other breeder males in thesame room as the females, as described above. Age-, strain-,and weight-matched ovariectomized female rats (n=3, “stim-ulus rats”) were utilized in the social interaction task. Thesefemale stimulus rats were used for all the social interactiontesting as they were habituated in the task, which reducessocial interaction that they initiate with the experimental rat.

General procedure Rats were included in this experiment inseveral small cohorts (10–25 rats/cohort) that were run con-secutively so that the age of rats and the timing of recoveryfrom surgery to when rats were manipulated and assessedremained consistent across cohorts (7 days). Cohorts werecounterbalanced so that at least one animal was assigned eachtreatment condition in each cohort run. Adult female rats wereovariectomized and surgically implanted with guide cannulaeaimed at the VTA and allowed to recover for 1 week. Starting44 h before behavioral testing, rats were primed with estradiolor vehicle via subcutaneous injections and received their firstintra-VTA infusions of PXR AS-ODNs or saline (control). Athour 24 before behavioral testing, rats received a secondsubcutaneous injection of estradiol or vehicle and anotherdosing of intra-VTA infusions of PXR AS-ODNs or saline(control). One half-hour before behavioral testing (hour 43.5),rats received their last intra-VTA infusions of PXR AS-ODNsor saline (control) and then 3α,5α-THP or β-cyclodextrin.Rats were tested at hour 44 in a single battery of consecutivetasks. Followingβ-cyclodextrin or 3α,5α-THP infusions, ratswere tested in a single battery of tasks (consecutive assess-ments in the open field, elevated plus maze, social interaction,and paced mating tasks) to assess exploration/anxiety, social,and reproductive behaviors. Assessments of behaviors beyondlordosis is important because mating-induced biosynthesis of

3α,5α-THP has been shown in forebrain regions involved inmotivated and affective processes, such as the striatum, hip-pocampus, and cortex in addition to the midbrain (Frye 2011).Immediately after testing in the battery (paced mating), ratswere euthanized and had tissues (brain and trunk blood)collected. Estradiol was measured in plasma and progestogenswere measured in brain. Knock down of PXR inmidbrain wasconfirmed with qPCR.

Surgical protocol Experimental rats were ovariectomized viabilateral flank incisions and stereotaxically implanted withbilateral guide cannulae aimed at the VTA during one surgicalsession. These surgeries were completed under general anes-thesia from administration of xylazine (12 mg/kg) and keta-mine (80 mg/kg). Stereotaxic coordinates from bregma for themidbrain VTAwere 5.3 mm posterior, 0.4 mm lateral on theright and left, and 7.0 mm ventral (Paxinos andWatson 1986).Guide cannulae consisted of 23-gauge stainless steel needleswith 30-gauge removable inserts made from dental needleswith sharp tips removed and sanded smooth. After surgery,rats were neurologically evaluated daily for their ability toright themselves, cage-climb, and show proper muscle toneand reflexive responses to hind limb extension. Rats were alsoevaluated for weight gain after surgery. All rats passed neuro-logical evaluations and gained weight following surgery andwere included in the experiment. Manipulations began after7 days of recovery from surgery.

Estradiol priming Rats were randomly assigned to be admin-istered subcutaneous estradiol (10 μg total, from two injec-tions of 5 μg estradiol in 0.1 cc Wesson vegetable oil;ConAgra Foods, Omaha, NE) or vehicle (Wesson vegetableoil; two injections of 0.1 cc) at 44 and 24 h before behavioraltesting. Subcutaneous injections were to the scruff of the rats’necks. Because rats were ovariectomized and either vehicle-or estradiol-primed, it was deemed important to verify theestradiol levels produced by the treatment during behavioralassessments. As such, levels in plasma (from trunk bloodcollected immediately after testing) were measured using es-tradiol radioimmunoassay methods that are described belowin detail. Ovariectomized, estradiol-primed rats had higherestradiol levels in plasma (24.0+2.7 pg/ml) than did vehicle-administered rats (8.6±0.6 pg/ml).

Antisense oligonucleotide infusions Rats were administered1 μl control or PXRAS-ODN (5′CTTGCGGAAGGGGCACCTCA 3′; 100 ng) infusions 0.5, 24, and 44 h before behav-ioral testing (purchased from Invitrogen Life Technologies,Carlsbad, CA; Frye et al. 2013). The vehicle for PXR AS-ODN infusions was sterile saline. The “control” infusionswere sterile saline as we have previously demonstrated nobehavioral or endocrine differences between rats administeredthe control conditions of saline or scrambled ODN infusions

Psychopharmacology

to the VTA (Frye et al. 2013). Rats were administered threeinfusions of AS-ODN or the control condition because of thepotential for AS-ODNs to degrade and become ineffective.The timing of these infusions was as per previous experimentsand aimed to knock down PXR throughout the rise in estradiollevels post-priming as well as behavioral assessments.

3α,5α-THP infusions Rats were either infused with β-cyclodextrin vehicle or 3α,5α,-THP 30 min before testing(hour 43.5). 3α,5α-THP (purchased from the late Dr. RobertPurdy, Scripps Research Institute, CA, whom I have enjoyedfruitful conversations and collaborations with for decades)was prepared to a concentration of 100 ng/1 μl in β-cyclodextrin (Frye and Rhodes 2006).

Behavioral testing Rats were tested sequentially in the follow-ing battery of tasks in one testing session without time inbetween tasks in the order listed: open field, elevated plusmaze, social interaction, and paced mating task. Behavioralassessments and corticosterone measurements in plasma in thisand/or previous studies (e.g., Frye et al. 2013 and unpublishedresults) using the exact testing protocol or those in whichshorter batteries (open field, elevated plus maze, and socialinteraction alone, or after paced mating, or paced mating alone)do not suggest a robust stress response among rats when testedin this battery, or carry-over behavioral effects due to stressfrom completing previous behavioral procedures. However, thepotential for those effects need to be considered in interpretingthe data. To be able to assess reproductive behavior in thecontext of exploration, anti-anxiety, and pro-social behavior,as well as interpret results in the context of previous findings,we have used this short battery of tasks with tissue collectionimmediately after. Behavioral data were simultaneously col-lected by using the Any-maze behavioral assessment computerprogram (Stoelting Inc., Wood Lawn, IL; for open field, ele-vated plus maze, and social interaction), or a digital videocamera (for paced mating), and trained experimenters.

Open field Rats were assessed in this task, using methods asfirst described by Hall and Ballachey (1932), and recently inour laboratory (Frye et al. 2013), where central or inner 8square entries are used as an index of anti-anxiety behaviorand the total number of entries is used as an index of generalmotor/exploratory behavior.

Elevated plus maze Rats were assessed in this task as firstdescribed by Handley andMithani (1984) and recently report-ed by our laboratory (Frye et al. 2013). The time spent in theopen arms (as compared to closed arms) was utilized as anindex of anti-anxiety-like behavior because there were nodifferences between groups for the number of closed, open,or total arm entries, and the average percentage of open arm tototal arm entries was low (∼13 % across groups).

Social interaction Rats were assessed in this task usingmethods first described by File and Hyde (1978), and recentlyimplemented in our laboratory (Frye et al. 2013), where thetotal time spent by each experimental rat with one the stimulusrat engaging in any behaviors considered social interaction(crawling over and under partner, sniffing of partner, follow-ing with contact, anogenital investigation, tumbling, andgrooming) were recorded. Separate measurements of thesedifferent types of social interactions were not determined.

Paced mating Reproductive responses of rats in the pacedmating task, which uses a chamber with a partition that allowsthe female to spend time in close proximity to the male or not,were assessed (Erskine 1985; Frye et al. 2013). Standard mea-sures of mating behavior (lordosis quotients, lordosis ratings,proceptivity quotients, and aggression quotients) were recorded.

Tissue collection and preparation for RIA and QPCR Ratswere euthanized by rapid decapitation immediately after test-ing. Whole brain and trunk blood were collected to measuresteroid hormone levels in brain and plasma. Brains wereimmediately placed on dry ice and then stored at −80 untildissections. For dissections, punches from the midbrain,around the VTA, were taken from frozen slices for qPCR.At this time, whether cannulae/infusion tracks were aimed atthe VTA was noted. There were 17 rats that had placementoutside of the VTA (see Fig. 1 for a representative picture of a“miss” to the VTA); their data was excluded from analyses ofthe data from rats with placement to the VTA. Although amethod to determine spread of infusion (i.e., infusions ofthionine or cresyl violet in the same volume as infusions ofdrug conditions) was not utilized here, we have previouslyreported that such infusions to the VTA spread approximately1 mm in all directions and do not extend beyond the VTA toimpinge on other nearby midbrain regions (Frye and Rhodes2006). The pattern of responses of rats with missed siteplacement of cannulae for behavioral measures and centralsteroid levels was unlike that observed in rats with infusions tothe VTA. Following this punching out of the VTA, the rest ofthe midbrain that was remaining was then dissected out andplaced in a chilled test tube and homogenized in 1 ml ddH2Oto be used for steroid measurement by radioimmunoassay.The hippocampus, hypothalamus, and prefrontal cortex weredissected out from the thawedwhole brain in a similar fashion.

qPCR methods Standard qPCR methods were utilized ontissues that had been preserved in RNA later (Qiagen) imme-diately following dissection as described in detail in a previousreport (Frye et al. 2013). Data were analyzed using the com-parative cycle time (DeltaDeltaCT) method. The fold changein comparison to vehicle controls of the delta CT values ofPXR versus actin are depicted (Livak and Schmittgen 2001;Schmittgen and Livak 2008).

Psychopharmacology

Radioimmunoassay for steroid hormones Standard steroidextraction and radioimmunoassay techniques used by ourlaboratory were employed to measure plasma estradiol levelsand brain progesterone, dihydroprogesterone, and 3α,5α-THP levels (Frye et al. 2013).

Statistical analyses Three-way analyses of variances wereused to examine effects of hormone condition (vehicle, estra-diol), PXR AS-ODN condition (control, PXR AS-ODN), and3α,5α,-THP condition (β-cyclodextrin, 3α,5α,-THP) on be-havioral and endocrine measures. The α level for statisticalsignificance was p≤0.05 for main effects and interactions.Fisher’s least significant differences post hoc tests were usedto determine treatment differences from vehicle controls ateach independent variable level.

Results

PXR expression in the midbrain (Fig. 2) There was a signif-icant main effect of PXR AS-ODN condition [F1, 129=17.1,P<0.01] to influence fold changes in PXR expression. Ratsinfused with PXR AS-ODN had lower PXR expression in themidbrain VTA compared to control infusions. There were nomain effects for estradiol or 3α,5α-THP condition, or

interactions between these variables or with the AS-ODNcondition, for PXR expression.

Behavioral measures (Table 1 and Fig. 3) There were nostatistically significant main effects, or interactions betweenvariables, for any measures collected in the open field, elevat-ed plus maze, or social interaction tasks (Table 1). There weresignificant differences between groups for reproductive mea-sures (described as follows). See Fig. 3 for lordosis quotients

Fig. 1 Depiction of midbrainventral tegmental area (VTA)targeted with infusions (blackcircle) in drawings on the left (topand bottom panel). Pictures on theright show correct placement ofVTA (“hit”; top panel) orplacement outside of the VTA(“miss”; bottom panel), asdetermined by visual inspectionduring brain dissections

Fig. 2 Bars depicts the mean fold change of pregnane xenobiotic recep-tor (PXR) expression (fold-change from control) in the midbrain ventraltegmental area (VTA). Asterisks indicates a main effect of PXR antisenseoligodeoxynucleotide (AS-ODN) condition (P<0.05)

Psychopharmacology

data and Table 1 for lordosis ratings, proceptivity quotients,and aggression quotients data.

There was significant interaction between estradiol conditionand PXRAS-ODN condition for lordosis quotients [F1, 133=9.5,P<0.01], and proceptivity quotients [F1, 133=3.860, P=0.05],but not lordosis ratings or aggression quotients. Estradiol-primedrats infused with PXR-AS-ODN had lower lordosis quotientsand proceptivity quotients than did those infused with saline(control condition) to the VTA.

There was a significant interaction between estradiol condi-tion and 3α,5α-THP condition for lordosis quotients [F1, 133=4.5, P<0.03], lordosis ratings [F1, 133=6.759, P<0.01], andproceptivity quotients [F1, 133=3.711, P=0.05], but not aggres-sion quotients. Estradiol-primed rats infused with 3α,5α-THPhad higher lordosis quotients and ratings and proceptivityquotients compared to controls. There were no interactionsbetween estradiol condition, PXR-AS-ODN condition, and3α,5α-THP condition for lordosis quotients or ratings, orproceptivity or aggression quotients.

There was a main effect for estradiol condition for lordosisquotients [F1, 133=138.4, P<0.01], lordosis ratings [F1, 133=51.995, P<0.01], and proceptivity quotients [F1, 133=33.770,P<0.01], but not aggression quotients. Rats administeredestradiol had increased lordosis quotients, lordosis ratings,and proceptivity quotients compared to vehicle-administeredrats.

There was a significant main effect of PXR AS-ODNcondition for lordosis quotients [F1, 133=11.5, P<0.01],proceptivity quotients [F1, 133=4.591, P=0.03], and aggres-sion quotients [F1, 133=3.705, P=0.05], but not lordosis rat-ings. Rats infused with PXR AS-ODN, compared to control

infusions, had decreased lordosis quotients, proceptivity quo-tients, and increased aggression quotients.

There was a significant main effect for 3α,5α-THP condi-tion for lordosis quotients [F1, 133=15.900, P<0.01] and rat-ings [F1, 133=10.436, P<0.01], but not proceptivity quotientsor aggression quotients. Rats infused with 3α,5α-THP hadincreased lordosis quotients and ratings compared to ratsinfused with β-cyclodextrin.

3α,5α-THP levels in the midbrain (Fig. 3) There was signif-icant interaction between estradiol condition and AS-ODNcondition [F1, 133=6.3, P<0.01] for 3α,5α-THP levels in the

Table 1 Indicated in the tables are the number of observations per condition and the behavioral testing measures (means±SEM for each) of rats that hadinfusions of antisense oligodeoxynucleotides (AS-ODNs) or vehicle (control) to the midbrain ventral tegmental area (VTA)

Hormone condition Condition

Vehicle Estradiol

Intra-VTA AS-ODN Control PXR AS-ODN Control PXR AS-ODN

Intra-VTA infusion β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP

n 20 20 13 18 15 19 16 20

Total open field entries 246.9±19.5 261.5±32.8 263.8±37.5 238.0±17.2 219.1±22.9 218.5±18.9 254.5±24.3 251.1±31.6

Central open field entries 105.6±15.9 106.1±23.8 118.1±26.8 86.5±15.8 65.2±17.9 64.0±16.5 89.3±18.0 97.4±22.4

Inner 8 open field entries 31.5±6.2 28.2±8.1 35.7±9.9 18.2±4.0 17.3±6.8 17.6±6.4 31.6±7.1 25.7±8.1

Open arm time (seconds) 20.1±5.4 17.2±5.8 11.4±3.5 22.4±6.8 31.5±15.1 7.4±2.6 20.1±4.8 26.2±7.7

Total time spent interacting(seconds)

80.6±8.5 80.7±4.9 73.8±6.7 75.2±5.2 68.9±8.7 76.8±6.7 73.6±8.9 78.7±9.6

Lordosis ratings (scale 0–3) 0.01±0.01 0.1±0.1 0.0±0.0 0.1±0.1 0.6±0.2a 1.0±0.1a,b 0.2±0.5a 0.9±0.2b

Proceptivity quotients (%) 0.0±0.0 0.09±0.01 0.0±0.0 0.0±0.0 24.3±7.9a 32.6±8.7a 4.7±2.3a,c 22.7±6.7a,c

Aggression quotients (%) 31.1±5.8 16.6±4.1 31.7±5.8c 28.9±6.1c 23.4±7.2 13.3±4.2 30.1±7.8c 26.5±6.1c

a Indicates a main effect of estradiol condition (P<0.05)b Indicates a main effect of 3α,5α-THP condition (P<0.05)c Indicates a main effect of PXR AS-ODN condition (P<0.05)

Fig. 3 Circles indicate the mean (±SEM) 3α,5α-THP (ng/mg) levels inthe midbrain and bars indicate the mean (±SEM) lordosis quotient.Circumflex accent indicates a main effect of estradiol condition(P<0.05). Plus sign indicates a main effect of 3α,5α-THP condition(P<0.05). Asterisks indicates a main effect of PXR antisenseoligodeoxynucleotide (AS-ODN) condition (P<0.05)

Psychopharmacology

midbrain VTA, such that estradiol-primed, but not vehicle-primed, rats had higher levels of 3α,5α-THP in the midbrainwith control, compared to PXR AS-ODN, infusions. Therewere no interactions between estradiol condition, PXR AS-ODN condition, and 3α,5α-THP condition for 3α,5α-THPlevels in the midbrain.

There was a main effect for estradiol condition [F1, 133=4.4,P=0.03] for 3α,5α-THP levels in midbrain VTA. Rats admin-istered estradiol had higher levels of midbrain 3α,5α-THPcompared to rats administered vehicle. There was a significantmain effect of PXRAS-ODN condition [F1, 133=13.2, P<0.01]for 3α,5α-THP levels in the midbrain. Rats infused with PXRAS-ODN had significantly lower 3α,5α-THP in the midbraincompared to those infused with control condition. There was amain effect for 3α,5α-THP condition [F1, 133=3.7, P=0.05] for3α,5α-THP levels, with 3α,5α-THP infusions increasing3α,5α-THP levels in midbrain compared to β-cyclodextrin.

Progesterone, dihydroprogesterone, and 3α,5α-THP levels(Table 2) There were no statistically significant differencesin progesterone or dihydroprogesterone levels in the midbrainor cortex, hippocampus, and hypothalamus. Despite differ-ences in midbrain 3α,5α-THP levels, there were no statisti-cally significant differences in 3α,5α-THP levels measured inthe cortex, hippocampus, and hypothalamus.

Discussion

Results partially supported our hypothesis that PXR may beinvolved in production of 3α,5α-THP in the midbrain VTAof estradiol-primed rats, a necessary condition for 3α,5α-THP facilitation of lordosis and other reproductively relevantbehaviors (exploration, anti-anxiety, and social). Althoughthere were no effects of hormone and PXR manipulationsfor exploration and anti-anxiety-like behavior (i.e., total andcentral entries in the open field; open arm time in the plusmaze) or pro-social behavior (i.e., time spent by experimentalrat engaging in social interaction with a conspecific), therewere robust differences among estradiol-primed rats for re-productive behavior (i.e., lordosis quotients and ratings,proceptivity quotients). Lordosis and proceptivity of ovariec-tomized rats was enhanced with estradiol-priming and infu-sions of 3α,5α-THP to the midbrain VTA, but attenuatedwith infusions of PXR AS-ODNs to the VTA coincident withreductions in PXR expression and 3α,5α-THP levels in themidbrain. These data suggest that PXR may be involved inthe biosynthesis of 3α,5α-THP in the midbrain VTA ofestradiol-primed rats and subsequent effects for reproductiveresponding.

The present study confirms and extends the role of estradiolfor 3α,5α-THP-facilitated lordosis in the midbrain VTA.

Table 2 Indicated in the table are the number of observations percondition and the mean (ng/mg±SEM) steroid levels of progesteroneand dihydroprogesterone and 3α,5α-THP in the midbrain, cortex,

hippocampus, and hypothalamus, among rats that had antisenseoligodeoxynucleotides (AS-ODNs) or vehicle (control) infusions to themidbrain ventral tegmental area (VTA)

Hormone condition Condition

Vehicle Estradiol

Intra-VTA AS-ODN Control PXR AS-ODN Control AS-ODN

Intra-VTA infusion β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP β-cyclodextrin 3α,5α-THP

n 20 20 13 18 15 19 16 20

Midbrain

Progesterone 2.5±0.4 1.8±0.5 3.8±1.4 1.9±0.4 4.1±1.6 4.4±2.3 3.7±1.1 2.2±0.7

Dihydroprogesterone 15.5±2.7 17.0±3.2 24.2±7.2 14.6±3.6 18.1±3.1 14.1±2.2 12.7±3.2 9.8±1.9

3α,5α-THP See Fig. 2

Cortex

Progesterone 2.8±0.8 2.1±0.6 3.3±1.2 1.3±0.4 3.2±0.9 2.3±1.0 2.5±1.1 2.6±1.1

Dihydroprogesterone 13.3±2.4 10.8±1.8 12.1±6.0 7.8±1.3 7.4±1.4 11.0±3.4 9.4±2.7 9.8±2.2

3α,5α-THP 6.8±1.5 11.1±1.8 9.7±4.5 7.8±1.2 9.9±2.0 4.9±0.7 5.7±0.7 6.3±0.8

Hippocampus

Progesterone 4.2±1.8 2.4±0.8 1.9±0.5 1.2±0.4 2.1±0.4 1.5±0.4 2.1±0.7 1.5±0.4

Dihydroprogesterone 13.5±1.6 11.6±1.4 8.3±2.6 8.6±1.8 6.4±1.2 7.5±1.3 11.2±2.3 9.2±1.7

3α,5α-THP 8.3±1.4 8.2±1.4 8.5±2.1 10.0±1.8 9.4±2.0 6.6±1.1 5.1±1.0 4.6±0.7

Hypothalamus

Progesterone 3.9±0.9 2.2±1.0 3.7±1.1 3.0±0.9 3.2±0.6 2.0±0.5 2.9±0.9 2.1±0.7

Dihydroprogesterone 17.6±2.8 19.2±2.6 20.7±4.1 14.5±3.2 20.1±12.4 12.4±2.0 11.5±2.4 11.6±2.3

3α,5α-THP 9.0±12.8 12.8±1.4 10.4±15.2 15.2±3.2 19.0±10.8 10.9±1.4 13.3±3.4 8.4±1.2

Psychopharmacology

Here, 3α,5α-THP’s effects to increase lordosis, an effectblocked by PXR AS-ODNs, was only observed in rats thatwere estradiol-primed. Moreover, the effect of manipulatingPXR may be specific to 3α,5α-THP in the midbrain. This issupported by infusions of PXR AS-ODNs reducing 3α,5α-THP, but not altering other progestogens, in the midbrain, andonly reducing lordosis to levels that are typical in rats primedwith estradiol alone. However, alternative interpretations ofour findings need to be explored. Although 3α,5α-THP levelsin the estradiol-primed animals are comparable to those ofvehicle-treated rats, behavior of the estradiol-primed animalsare more robust than any of the vehicle groups. Combinedwith the fact that there is also no additive effect of 3α,5α-THP,these results suggest that it is possible that another unrelatedpathway is involved in estradiol-induced lordosis, with3α,5α-THP having a permissive role with estradiol-priming.In addition, 3α,5α-THP is able to induce lordosis behavior inthe vehicle treated (non-estradiol primed) PXR AS-ODNgroup to the same level as controls. For both lordosis quotientsand midbrain 3α,5α-THP levels, there are significant interac-tions, with the most robust effects of 3α,5α-THP infusions toincrease, and PXR AS-ODN infusions to decrease, lordosisand midbrain 3α,5α-THP in estradiol-, rather than vehicle-,primed rats. Experiments are ongoing to further understandthe role of PXR as a homeostatic regulator in this system.

In addition to these specific effects only being observed inestradiol-primed rats, there was behavioral and site-specificityobserved. For example, no effects were noted in the openfield, elevated plus maze, or social interaction tasks. Thiswas somewhat unexpected, particularly in the elevated plusmaze, given previous results showing clear effects ofestradiol-priming to enhance these behaviors. In the presentstudy, compared to these past studies, a pulsed dosing ofestradiol was utilized with rats receiving 10 μg of estradiolover two injections administered 44 and 24 h before behav-ioral testing (coincident with PXR AS-ODN or control infu-sions). This dosing regimen and/or the testing of rats in a briefconsecutive battery of tasks as was utilized in the presentexperiment may have produced these attenuated responsesof rats to estradiol in the elevated plus maze as well as theother tasks assessed here. As well, no differences were notedfor progesterone or dihydroprogesterone levels in any of thebrain regions where these progestogens were measured, or in3α,5α-THP levels outside of the midbrain. Thus, the mostrobust effects herein were for 3α,5α-THP biosynthesis in themidbrain and changes in a motivated behavior, lordosis, me-diated by this region.

We had anticipated that 3α,5α-THP-replacement in ratsthat received PXR AS-ODNs would have reversed theseeffects of PXR knockdown in the brain for lordosis and3α,5α-THP, but this was not observed. PXR AS-ODNs re-duced lordosis of estradiol-primed rats as well as levels ofmidbrain 3α,5α-THP, and abrogated effects of subsequent

infusions of 3α,5α-THP to the VTA. Activated PXR regu-lates gene transcription in a ligand-dependent fashion, whichpromotes the production of a wide array of proteins, includ-ing cytochrome P450 enzymes, involved in drug metabolismand clearance as well as steroid metabolism from cholesterol(Harmsen et al. 2007; Ma et al. 2008; Xu et al. 2005; Zhanget al. 2008). Given that 3α,5α-THP is a ligand for PXR(Frye 2011; Kliewer et al. 2002; Lamba et al. 2004; Mooreet al. 2000; Watkins et al. 2001), it may be that PXRrequires activation by 3α,5α-THP to initiate effects on cho-lesterol metabolism involving CYP enzymes, which ulti-mately induce greater production of 3α,5α-THP. An ideais that mating-induced biosynthesis of 3α,5α-THP functionsas a homeostatic response for the initiation and terminationof mating behavior, both of which are necessary for suc-cessful reproductive outcomes, noted in different laboratoryrodent species (Frye 2011). Thus, PXR may be anotherimportant neuroregulatory factor in the biosynthesis of3α,5α-THP in the midbrain, and resulting actions on lordo-sis in the adult.

In summary, the present work extends previous studies onthe functional role of PXR for cholesterol metabolism in thecentral nervous system. Here we found that lordosis wasenhanced with estradiol-priming and infusions of 3α,5α-THP to the VTA. Infusions of PXR AS-ODNs to the VTAattenuated responses in estradiol-, but not vehicle-, primedrats, compared to control infusions. Indeed, it may be thatPXR is acting in the central nervous system, much like in theliver, to regulate metabolizing enzymes, receptors, and effluxtransporters, to promote homeostasis.

Acknowledgments This research was supported by grants from theNational Institute of Mental Health (MH0676980; RMH067698B) aswell as the National Institute of General Medical Sciences of the NationalInstitutes of Health (P20GM103395). The content of this paper is solelythe responsibility of the authors and does not necessarily represent theofficial views of the National Institutes of Health. Technical assistance,provided byDrs. Paris and Rusconi, and DanDaCosta, RyanKeller, AmyKohtz, Danielle Llaneza, Jennifer Torgersen, Aaron Sheppard, andZhenhong Zhao, is greatly appreciated. Experiments described hereincomply with the current laws of the United States.

Conflict of interest All authors report that they have no conflicts ofinterest (financial or otherwise) that would bias them to the outcome ofthese experiments.

References

Ahdieh HB, Brown TJ, Wade GN, Blaustein JD (1986) Hypothalamicnuclear progestin receptors and the duration of sexual receptivity inovariectomized and ovariectomized-hysterectomized rats. PhysiolBehav 36:211–215

Balasubramanian B, PortilloW, ReynaA, Chen JZ,Moore AN, Dash PK,Mani SK (2008a) Nonclassical mechanisms of progesterone action

Psychopharmacology

in the brain: I. Protein kinase C activation in the hypothalamus offemale rats. Endocrinology 149:5509–5517

Balasubramanian B, PortilloW, ReynaA, Chen JZ,Moore AN, Dash PK,Mani SK (2008b) Nonclassical mechanisms of progesterone actionin the brain: II. Role of calmodulin-dependent protein kinase II inprogesterone-mediated signaling in the hypothalamus of female rats.Endocrinology 149:5518–5526

Barbaccia ML, Roscetti G, Trabucchi M, Mostallino MC, Concas A,Purdy RH, Biggio G (1996) Time-dependent changes in rat brainneuroactive steroid concentrations and GABAA receptor functionafter acute stress. Neuroendocrinology 63:166–172

Bauer B, Hartz AM, Fricker G,Miller DS (2004) Pregnane X receptor up-regulation of P-glycoprotein expression and transport function at theblood–brain barrier. Mol Pharmacol 66:413–419

Baulieu EE (1991) Neurosteroids: a new function in the brain. Biol Cell71:3–10

Beyer C, González-Flores O, Ramírez-Orduña JM, González-Mariscal G(1999) Indomethacin inhibits lordosis induced by ring A-reducedprogestins: possible role of 3α-oxoreduction in progestin-facilitatedlordosis. Horm Behav 35:1–8

Cheng YJ, Karavolas HJ (1975) Subcellular distribution and properties ofprogesterone (delta4-steroid) 5α-reductase in rat medial basal hypo-thalamus. J Biol Chem 250:7997–8003

Christensen A, Dewing P, Micevych P (2011) Membrane-initiated estra-diol signaling induces spinogenesis required for female sexual re-ceptivity. J Neurosci 31:17583–17589

DeBold JF, Malsbury CW (1989) Facilitation of sexual receptivity byhypothalamic and midbrain implants of progesterone in femalehamsters. Physiol Behav 46:655–660

DeBold JF, Malsbury CW, Harris VS, Malenka R (1982) Sexual recep-tivity: brain sites of estrogen action in female hamsters. PhysiolBehav 29:589–593

Dussault I, Forman BM (2002) The nuclear receptor PXR: a masterregulator of “homeland” defense. Crit Rev Eukaryot Gene Expr12:53–64

Erskine MS (1985) Effects of paced coital stimulation on estrus durationin intact cycling rats and ovariectomized and ovariectomized/adrenalectomized hormone-primed rats. J Comp Physiol Psychol99:151–161

Etgen AM, González-Flores O, Todd BJ (2006) The role of insulin-likegrowth factor-I and growth factor-associated signal transductionpathways in estradiol and progesterone facilitation of female repro-ductive behaviors. Front Neuroendocrinol 27:363–375

File SE, Hyde JR (1978) Can social interaction be used to measureanxiety? Br J Pharmacol 62:19–24

Francis GA, Fayard E, Picard F, Auwerx J (2003) Nuclear receptors andthe control of metabolism. Annu Rev Physiol 65:261–311

Frye CA (2011) Novel substrates for, and sources of, progestogens forreproduction. J Neuroendocrinol 23:961–973

Frye CA, RhodesME (2006) Infusions of 5α-pregnan-3α-ol-20-one (3α,5α-THP) to the ventral tegmental area, but not the substantia nigra,enhance exploratory, anti-anxiety, social and sexual behaviours andconcomitantly increase 3α,5α-THP concentrations in the hippocam-pus, diencephalon and cortex of ovariectomised oestrogen-primedrats. J Neuroendocrinol 18:960–975

Frye CA, Paris JJ, Rhodes ME (2008) Exploratory, anti-anxiety, social,and sexual behaviors of rats in behavioral estrus is attenuated withinhibition of 3α,5α-THP formation in the midbrain ventral tegmen-tal area. Behav Brain Res 193:269–276

Frye CA, Paris JJ, Walf AA, Rusconi JC (2011) Effects and mechanismsof 3α, 5α,-THP on emotion, motivation, and reward functionsinvolving pregnane xenobiotic receptor. Front Neurosci 5:136

Frye CA, Koonce CJ, Walf AA, Rusconi JC (2013) Motivated behaviorsand levels of 3α,5α-THP in themidbrain are attenuated by knockingdown expression of pregnane xenobiotic receptor in the midbrainventral tegmental area of proestrous rats. J Med Sex 10:1692–1706

García-Juárez M, Beyer C, Soto-Sánchez A, Domínguez-Ordoñez R,Gómora-Arrati P, Lima-Hernández FJ, Eguibar JR, Etgen AM,González-Flores O (2011) Leptin facilitates lordosis behaviorthrough GnRH-1 and progestin receptors in estrogen-primed rats.Neuropeptides 45(1):63–67

Geick A, Eichelbaum M, Burk O (2001) Nuclear receptor responseelements mediate induction of intestinal MDR1 by rifampin. JBiol Chem 276:14581–14587

González-Mariscal G, González-Flores O, Beyer C (1989)Intrahypothalamic injection of RU486 antagonizes the lordosis in-duced by ring A-reduced progestins. Physiol Behav 46:435–438

Hall CS, Ballachey EL (1932) A study of the rat’s behavior in a field: acontribution to method in comparative psychology. Univ Calif PublPsychol 6:1–12

Handley SL, Mithani S (1984) Effects of α-adrenoreceptor agonists andantagonists in a maze-exploration model of ‘fear’-motivated behav-iour. Naunyn-Schmeideberg’s Arch Pharmacol 327:1–5

Harmsen S, Meijerman I, Beijnen JH, Schellens JH (2007) The role ofnuclear receptors in pharmacokinetic drug–drug interactions in on-cology. Cancer Treat Rev 33:369–380

King SR, Manna PR, Ishii T, Syapin PJ, Ginsberg SD, Wilson K, WalshLP, Parker KL, Stocco DM, Smith RG, Lamb DJ (2002) An essen-tial component in steroid synthesis, the steroidogenic acute regula-tory protein, is expressed in discrete regions of the brain. J Neurosci22:10613–10620

Kliewer SA, Goodwin B, Willson TM (2002) The nuclear pregnane Xreceptor: a key regulator of xenobiotic metabolism. Endocr Rev 23:687–702

Lamba V, Yasuda K, Lamba JK, Assem M, Davila J, Strom S, SchuetzEG (2004) PXR (NR1I2): splice variants in human tissues, includ-ing brain, and identification of neurosteroids and nicotine asPXRactivators. Toxicol Appl Pharmacol 199:251–265

Lisciotto CA, DeBold JF (1991) Ventral tegmental lesions impair sexualreceptivity in female hamsters. Brain Res Bull 26:877–883

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expressiondata using real-time quantitative PCR and the 2(-Delta Delta C(T)).Methods 25:402–408

Ma X, Idle JR, Gonzalez FJ (2008) The pregnane X receptor: from benchto bedside. Expert Opin Drug Metab Toxicol 4:895–908

Mani SK, Blaustein JD (2012) Neural progestin receptors and femalesexual behavior. Neuroendocrinology 96:152–161

Marini S, Nannelli A, Sodini D, Dragoni S, Valoti M, Longo V, GervasiPG (2007) Expression, microsomal and mitochondrial activities ofcytochrome P450 enzymes in brain regions from control andphenobarbital-treated rabbits. Life Sci 80(10):910–917

Mellon SH, Deschepper CF (1993) Neurosteroid biosynthesis: genes foradrenal steroidogenic enzymes are expressed in the brain. Brain Res629:283–292

Mellon SH, GongW, SchonemannMD (2008) Endogenous and syntheticneurosteroids in treatment of Niemann-Pick Type C disease. BrainRes Rev 57:410–420

Micevych P, Christensen A (2012) Membrane-initiated estradiol actionsmediate structural plast ici ty and reproduction. FrontNeuroendocrinol 33:331–341

Miryala CS, Hassell J, Adams S, Hiegel C, Uzor N, Uphouse L (2011)Mechanisms responsible for progesterone’s protection againstlordosis-inhibiting effects of restraint II. Role of progesterone me-tabolites. Horm Behav 60:226–232

Mòdol L, Darbra S, Pallarès M (2011) Neurosteroids infusion into theCA1 hippocampal region on exploration, anxiety-like behaviour andaversive learning. Behav Brain Res 222:223–229

Moore LB, Parks DJ, Jones SA, Bledsoe RK, Consler TG, Stimmel JB,Goodwin B, Liddle C, Blanchard SG, Willson TM, Collins JL(2000) Kliewer SA (2000) Orphan nuclear receptors constitutiveandrostane receptor and pregnane X receptor share xenobiotic andsteroid ligands. J Biol Chem 275:15122–15127

Psychopharmacology

National Research Council (US) Committee on Guidelines for the Use ofAnimals in Neuroscience and Behavioral Research (2003)Guidelines for the Care and Use of Mammals in Neuroscience andBehavioral Research. National Academies Press (US), Washington(DC)

Papadopoulos V, Baraldi M, Guilarte TR, Knudsen TB, Lacapère JJ,Lindemann P, Norenberg MD, Nutt D, Weizman A, Zhang MR,Gavish M (2006) Translocator protein (18 kDa): new nomenclaturefor the peripheral-type benzodiazepine receptor based on its struc-ture and molecular function. Trends Pharmacol Sci 27:402–409

Paxinos G, Watson C (1986) The rat brain. Academic Press, NYPleim ET, Brown TJ, MacLusky NJ, Etgen AM, Barfield RJ (1989)

Dilute estradiol implants and progestin receptor induction in theventromedial nucleus of the hypothalamus: correlation with recep-tive behavior in female rats. Endocrinology 124:1807–1812

Pleim ET, Lisciotto CA, DeBold JF (1990) Facilitation of sexual recep-tivity in hamsters by simultaneous progesterone implants into theVMH and ventral mesencephalon. Horm Behav 24:139–151

Pleim ET, Baumann J, Barfield RJ (1991) A contributory role for mid-brain progesterone in the facilitation of female sexual behavior inrats. Horm Behav 25:19–28

Purdy RH, Morrow AL, Moore PH Jr, Paul SM (1991) Stress-inducedelevations of gamma-aminobutyric acid type A receptor-active ste-roids in the rat brain. Proc Natl Acad Sci U S A 88:4553–4557

Rubin BS, Barfield RJ (1983a) Induction of estrous behavior in ovariecto-mized rats by sequential replacement of estrogen and progesterone tothe ventromedial hypothalamus. Neuroendocrinology 37:218–224

Rubin BS, Barfield RJ (1983b) Progesterone in the ventromedial hypo-thalamus facilitates estrous behavior in ovariectomized, estrogen-primed rats. Endocrinology 113:797–804

Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by thecomparative C(T) method. Nat Protoc 3:1101–1108

Vallée M, Rivera JD, Koob GF, Purdy RH, Fitzgerald RL (2000)Quantification of neurosteroids in rat plasma and brain followingswim stress and allopregnanolone administration using negativechemical ionization gas chromatography/mass spectrometry. AnalBiochem 287:153–166

Watkins RE, Wisely GB, Moore LB, Collins JL, Lambert MH, WilliamsSP, Willson TM, Kliewer SA, Redinbo MR (2001) The humannuclear xenobiotic receptor PXR: structural determinants of directedpromiscuity. Science 292:2329–2333

Xu DX, Chen YH, Wang JP, Sun MF, Wang H, Wei LZ, Wei W (2005)Perinatal lipopolysaccharide exposure downregulates pregnane Xreceptor and Cyp3a11 expression in fetal mouse liver. Toxicol Sci87:38–45

Zhang B, Xie W, Krasowski MD (2008) PXR: a xenobiotic receptor ofd ive r s e func t i on imp l i c a t ed in pha rmacogene t i c s .Pharmacogenomics 9:1695–1709

Psychopharmacology