Receptors genotype of FSH,LH/hCG are a predictor marker ......• Pharmaco-metabonomic phenotyping...

Receptors genotype and Receptors genotype and PharmacogeneticsPharmacogenetics of FSH,LH/hCG :Are of FSH,LH/hCG :Are they a predictor for ovulation induction in ART ?they a predictor for ovulation induction in ART ?

ATHENS MEDICAL SCHOOLDIMITRIS LOUTRADIS

ΣτοιχείαΣτοιχεία ΦαρµακογενετικήςΦαρµακογενετικής στηστη ΜαιευτικήΜαιευτική καικαιΓυναικολογίαΓυναικολογία

∆ΗΜΗΤΡΗΣ Χ.ΛΟΥΤΡΑ∆ΗΣΚΑΘΗΓΗΤΗΣ

Α ΜΑΙΕΥΤΙΚΗ ΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗ

ΦαρµακογενετικήΦαρµακογενετική

•• ΗΗ φαρµακογενετικφαρµακογενετικήή ((νέοςνέος ερευνητικόςερευνητικός τοµέαςτοµέας) ) έχειέχει σκοπόσκοπό νανα βελτιώσβελτιώσειει τηντην ισορροπίαισορροπία µεταξύµεταξύτωντων επιθυµητώνεπιθυµητών καικαι ανεπιθύµητωνανεπιθύµητων ενεργειώνενεργειώντωντων φαρµάκωνφαρµάκων, , ανάλογαανάλογα µεµε τητη γενετικήγενετικήπροδιάθεσηπροδιάθεση κάθεκάθε ασθενήασθενή..

ΜετάλλαξηΜετάλλαξη ((mutation)mutation)

ΕάνΕάν τατα ζεύγηζεύγη τωντων βάσεωνβάσεων τουτου γονιδίουγονιδίου αλλάξουναλλάξουν αυτόαυτό οδηγείοδηγεί σεσε µίαµίαελάχιστηελάχιστη αλλαγήαλλαγή τηςτης κωδικοποίησηςκωδικοποίησης τωντων αµινοξέωναµινοξέων τοτο οποίοοποίο δενδεν έχειέχεισηµαντικήσηµαντική δράσηδράση γιαγια τηντην παραγωγήπαραγωγή πρωτείνηςπρωτείνης. . ΕάνΕάν όµωςόµως γίνουνγίνουν δραστικέςδραστικέςαλλαγέςαλλαγές στηνστην κωδικοποίησηκωδικοποίηση τωντων αµινοξέωναµινοξέων τότετότε θαθα µπορούσεµπορούσε νανα οδηγήσειοδηγήσει

σεσε ασθένειαασθένειαΜετάλλαξηΜετάλλαξη ((mutation)mutation)


-- ΚάθεΚάθε σταθερήσταθερή αλλαγήαλλαγή στηστη χηµικήχηµική σύστασησύστασητουτου DNA DNA σταστα χρωµοσώµαταχρωµοσώµατα ενόςενός οργανισµούοργανισµού, , πουπου µπορείµπορεί νανα µεταφερθείµεταφερθεί µεµε κληρονοµικόκληρονοµικότρόποτρόπο σταστα θυγατρικάθυγατρικά κύτταρακύτταρα..-- ΣηµειακέςΣηµειακές ((point mutationspoint mutations))-- ΧρωµοσωµικέςΧρωµοσωµικές ((chromosomal aberrationschromosomal aberrations))

ππ..χχ.. ηη ∆ρεπανοκυτταρική∆ρεπανοκυτταρική ΑναιµίαΑναιµία ((∆Α∆Α) ) έχειέχει σανσαν πρωταρχικήπρωταρχική αιτίααιτίατηςτης ασθένειαςασθένειας τητη µετάλλαξηµετάλλαξη τουτου γονιδίουγονιδίου τηςτης ββ--σφαιρίνηςσφαιρίνης ((ββss)), , πουπου προκαλείπροκαλεί τητη σύνθεσησύνθεση τηςτης HbSHbS ((αα22ββs2) s2) αντίαντί τηςτης HbAHbA((αα22βΑβΑ2 ).2 ).

ΠολυµορφισµόςΠολυµορφισµός ((polymorphism)polymorphism)

ΠαρεκκλίσειςΠαρεκκλίσεις στηνστην ακολουθίαακολουθία τωντων νουκλεοτιδίωννουκλεοτιδίων συνοδεύεταισυνοδεύεται µεµε σιωπηλήσιωπηλή µετάλλαξηµετάλλαξηοφειλόµενηοφειλόµενη ότιότι χρησιµοποιούνταιχρησιµοποιούνται εκφυλισµέναεκφυλισµένα κωδικόνιακωδικόνια µεµε ήπιαήπια αλλαγήαλλαγή τουτουφαινοτύπουφαινοτύπου..

ΑυτέςΑυτές οιοι αλλαγέςαλλαγές είναιείναι ανεκτέςανεκτές κατάκατά τηντην διαρκείαδιαρκεία τηςτης εξέλιξηςεξέλιξης τουτου ανθρωπίνουανθρωπίνου είδουςείδους καικαικληρονοµήταικληρονοµήται στηνστην επόµενηεπόµενη γενιάγενιά..

ΤαΤα SNPsSNPs παρουσιάζουνπαρουσιάζουν µικροµικρο αλλαγέςαλλαγές τουτου DNADNA τοτο οποίοοποίο εµφανίζεταιεµφανίζεται µεµε διαφορετικήδιαφορετικήσυχνότητασυχνότητα σεσε διαφορετικούςδιαφορετικούς πληθυσµούςπληθυσµούς καικαι έθνηέθνη καικαι είναιείναι ηη βασικήβασική εστίαεστία τωντωνφαρµακογενετικώνφαρµακογενετικών µελετώνµελετών..

ΠολυµορφισµόςΠολυµορφισµός ((polymorphism)polymorphism)

-- ΤοΤο φαινόµενοφαινόµενο κατάκατά τοτο οποίοοποίο σεσε ένανέναν γενετικόγενετικό τόποτόπο ενόςενόςείδουςείδους µπορούνµπορούν νανα ανιχνευθούνανιχνευθούν διαφορετικάδιαφορετικά ((δύοδύο ήήπερισσότεραπερισσότερα) ) αλληλόµορφααλληλόµορφα γονίδιαγονίδια ((εναλλακτικέςεναλλακτικέςµορφέςµορφές ενόςενός γονιδίουγονιδίου).).

-- ΗΗ µεταβλητήµεταβλητή πρέπειπρέπει νανα είναιείναι παρούσαπαρούσα σεσε σηµαντικόσηµαντικόαριθµόαριθµό ατόµωνατόµων τουτου πληθυσµούπληθυσµού (>1%).(>1%).

-- ΠολυµορφισµόςΠολυµορφισµός µήκουςµήκους θραύσµατοςθραύσµατος εκεκ περιορισµούπεριορισµού (RFLPs)(RFLPs)-- ΠολυµορφισµόςΠολυµορφισµός ενόςενός νουκλεοτιδίουνουκλεοτιδίου (SNPs)(SNPs) -- ΤοΤο µεγαλύτεροµεγαλύτερο µέροςµέρος τηςτηςγενετικήςγενετικής ποικιλίαςποικιλίας µεταξύµεταξύ τωντων ανθρώπωνανθρώπων, , πιστεύεταιπιστεύεται ότιότι οφείλεταιοφείλεται στοστο SNP.SNP.

-- ΠολυµορφισµόςΠολυµορφισµός µήκουςµήκους γονιδιακήςγονιδιακής αλληλουχίαςαλληλουχίας ((SSLPsSSLPs))

ππ..χχ.. τοτο σύστηµασύστηµα HLAHLA (Human Leucocytes Antigen), (Human Leucocytes Antigen), τοτο οποίοοποίοείναιείναι τοτο πιοπιο πολυµορφικόπολυµορφικό σύστηµασύστηµα τουτου ανθρώπινουανθρώπινουγονιδιώµατοςγονιδιώµατος

Pharmacogenetics Pharmacogenetics inin ovarianovarianstimulationstimulation

•• Pharmacogenetics has emerged as a new Pharmacogenetics has emerged as a new area of research to improve the balance area of research to improve the balance between desired and undesired actions of between desired and undesired actions of drugs, based upon the genetic drugs, based upon the genetic predisposition of the individual patient. predisposition of the individual patient.

ΦαρµακογενετικήΦαρµακογενετική καικαι φαρµακογενωµικήφαρµακογενωµική

•• ΗΗ φαρµακογενετικήφαρµακογενετική περιγράφειπεριγράφει τητη σχέσησχέσηµεταξύµεταξύ τωντων γενετικώνγενετικών αποκλίσεωναποκλίσεων καικαι τηςτηςφαρµακευτικήςφαρµακευτικής απάντησηςαπάντησης ενώενώ ηηφαρµακογενωµικήφαρµακογενωµική αποτελείαποτελεί τηντην επιστήµηεπιστήµηπουπου µελετάµελετά τοτο γονιδίωµαγονιδίωµα καικαι τατα παράγωγαπαράγωγατουτου –– RNA RNA καικαι πρωτεΐνεςπρωτεΐνες –– σεσε σχέσησχέση µεµετηντην ανταπόκρισηανταπόκριση τουτου ατόµουατόµου σεσεφαρµακευτικέςφαρµακευτικές ουσίεςουσίες..

Pharmacogenetics Pharmacogenetics inin ovarianovarianstimulationstimulation

•• Tailoring ovarian stimulation to the individual Tailoring ovarian stimulation to the individual patient can be challenging because the ovarian patient can be challenging because the ovarian response varies substantially between patients. response varies substantially between patients.

•• Pharmacogenetics has emerged as a new area Pharmacogenetics has emerged as a new area of research to improve the balance between of research to improve the balance between desired and undesired actions of drugs, based desired and undesired actions of drugs, based upon the genetic predisposition of the individual upon the genetic predisposition of the individual patient. patient.

LH RECEPTORLH RECEPTORFSH RECEPTORFSH RECEPTOR

Ovarian theca, granulosa and luteal cellsTesticular Leydig cells

Ovarian granulosa cellsTesticular Sertoli cells

FUNCTIONFUNCTION

Regulate gonadal growth and differentiationRegulate endocrine functionRegulate gametogenesis

LH and FSH receptors expression was analyzed by RTLH and FSH receptors expression was analyzed by RT--PCR to study PCR to study their role in early mouse development.their role in early mouse development.

Presence of mRNA for FSH and LH receptors in oocytes, zygotes anPresence of mRNA for FSH and LH receptors in oocytes, zygotes and/or d/or preimplantation embryos would indicate a potential role for the preimplantation embryos would indicate a potential role for the gonadotrophins in the modulation of meiotic resumption and complgonadotrophins in the modulation of meiotic resumption and completion etion of oocyte maturation, as well as beneficial effect on early embrof oocyte maturation, as well as beneficial effect on early embryonic yonic development in mice.development in mice.

LH RECEPTORLH RECEPTORFSH RECEPTORFSH RECEPTOR

Ovarian theca, granulosa and luteal cellsTesticular Leydig cells

Ovarian granulosa cellsTesticular Sertoli cells

FUNCTIONFUNCTION

Regulate gonadal growth and differentiationRegulate endocrine functionRegulate gametogenesis

The role of FSH,LH in the oocyte/embryoThe role of FSH,LH in the oocyte/embryo

•• FSH doesnFSH doesn’’t increase nuclear t increase nuclear maturation.maturation.Rat: Vadrhyde,1980Rat: Vadrhyde,1980Monkey:Morga,1991Monkey:Morga,1991Human:Durinzi,1997Human:Durinzi,1997

•• FSH increase: FSH increase: --Fertilization (Schoeder1988)Fertilization (Schoeder1988)--Early embryo developmentEarly embryo development(Jinno1989,Morgan 1991)(Jinno1989,Morgan 1991)

•• FSH increase:FSH increase:--cAMPcAMP

(Eppig,1983,Shultz,1983)

•• LH induce GVBD by anLH induce GVBD by anindirect action mediated byindirect action mediated bycumulus cells because therecumulus cells because thereare no LH receptors on the are no LH receptors on the oocytes (Dekel,1988)oocytes (Dekel,1988)

mRNA for the FSH and LH receptors mRNA for the FSH and LH receptors was observed in oocytes and was observed in oocytes and preimplantation embryos at preimplantation embryos at different stages, indicating a different stages, indicating a physiological role in the oocyte physiological role in the oocyte maturation process and early maturation process and early embryonic development in the embryonic development in the human. (human. (LoutradisLoutradis D D ReprRepr. 2001 . 2001 Fert.Ster.2003)Fert.Ster.2003)

(Eppig,1983,Shultz,1983)

Expression of mRNA for the LH Expression of mRNA for the LH and FSH receptors in mouse and FSH receptors in mouse oocytes and preimplantation oocytes and preimplantation

embryos.embryos.

E. E. PatsoulaPatsoula, D. , D. LoutradisLoutradis, P. , P. DrakakisDrakakis, K. , K. KallianidisKallianidis, , R. R. BletsaBletsa and S. and S. MichalasMichalas

First Department of Obstetrics and First Department of Obstetrics and GynaecologyGynaecology, Athens University Medical School, , Athens University Medical School, IvfIvf Unit, Unit, ““AlexandraAlexandra”” Maternity Hospital, Athens, Greece (2001)Maternity Hospital, Athens, Greece (2001)

•• LH and FSH receptors expression was LH and FSH receptors expression was analysedanalysedby RTby RT--PCR to study their role in early mouse PCR to study their role in early mouse development.development.

•• Presence of mRNA for FSH and LH receptors in Presence of mRNA for FSH and LH receptors in oocytesoocytes, zygotes and/or , zygotes and/or preimplantationpreimplantationembryos would indicate a potential role for the embryos would indicate a potential role for the gonadotrophinsgonadotrophins in the modulation of meiotic in the modulation of meiotic resumption and completion of resumption and completion of oocyteoocytematuration, as well as beneficial effect on early maturation, as well as beneficial effect on early embryonic development in mice human.embryonic development in mice human.

Table 11Table 11Oligonucleotide primers used for RTOligonucleotide primers used for RT--PCR assaysPCR assays

mRNAmRNAPCR primer PCR primer

pairpairPrimersPrimers

55’’ –– 33’’SequenceSequence

of oligonucleotideof oligonucleotideAnnealing Annealing

temperature (temperature (ooCC))Product Product size (bp)size (bp)

Restriction enzyme Restriction enzyme and product size (bp)and product size (bp)

FSH receptorFSH receptor Outer pairOuter pair 55’’ –– endend GGGCTGGAGTCCATTCAGACGGGGCTGGAGTCCATTCAGACG 5555

33’’ –– endend CAGTTTATAACGACTGGTCAGCAGTTTATAACGACTGGTCAG 5555 318318

Inner pairInner pair 55’’ –– endend AATTCACCAGCCTACTGGTTGAATTCACCAGCCTACTGGTTG 5555

33’’ –– endend CAGTTTATAACGACTGGTCAGCAGTTTATAACGACTGGTCAG 5555 175175 HinclllHinclll--126/49126/49

LH receptorLH receptor Outer pairOuter pair 55’’ –– endend AATACACAACTGTGCATTCAACAATACACAACTGTGCATTCAAC 5555

33’’ –– endend ATTTGGATGAAGTTCAGAGGTTATTTGGATGAAGTTCAGAGGTT 5555 451451

Inner pairInner pair 55’’ –– endend TTTGGAAGAATTGCCTGATGATTTTGGAAGAATTGCCTGATGAT 5555

33’’ –– endend CATGACAAACTTGTCTAGACTACATGACAAACTTGTCTAGACTA 5555 313313 DdelDdel--185/128185/128

ββ--actinactin 55’’ –– endend TGAACCCTAAGGCCAACCGTCTGAACCCTAAGGCCAACCGTC 5656

33’’ –– endend GCTCATAGCTCTTCTCCAGGGGCTCATAGCTCTTCTCCAGGG 5656 396396

Figure 3Figure 3Gene structure of LH receptor (LHR) and FSH receptor (FSHR) showGene structure of LH receptor (LHR) and FSH receptor (FSHR) showing the ing the appropriate position of PCR primers. The appropriate position of PCR primers. The exonsexons are indicated in numbered boxes.are indicated in numbered boxes.

1 2 3 4 5 6 7 8 109 11

LH ReceptorLH Receptor LHR inner (808 bp)LHR outer (738 bp)

LHR inner (1120 bp)

LHR outer (1190 bp)

1 2 3 4 5 6 7 8 9 10

FSH ReceptorFSH Receptor FSHR inner (618 bp)FSHR outer (552 bp)

FSHR inner (789 bp)

FSHR outer (873 bp)

Figure 4Figure 4Gel electrophoresis of RTGel electrophoresis of RT--PCR products for (a) PCR products for (a) ββ--actinactin control, control, (b) LH receptor mRNA and (c) FSH receptor mRNA in mouse (b) LH receptor mRNA and (c) FSH receptor mRNA in mouse oocytes and embryos.oocytes and embryos.

Oocytes (Oocytes (OoOo) with and without reverse ) with and without reverse transcriptase (RT+/RTtranscriptase (RT+/RT--) ; zygotes () ; zygotes (ZyZy) (RT+/RT) (RT+/RT--); ); twotwo--cell (2c) embryos (RT+/RTcell (2c) embryos (RT+/RT--); four); four--cell (4c) cell (4c) embryos (RT+/RTembryos (RT+/RT--); morulae (Mo) (RT+/RT); morulae (Mo) (RT+/RT--); ); blastocysts (B) (RT+/RTblastocysts (B) (RT+/RT--). Detection of ). Detection of ββ--actinactinmRNA ensured correct RNA extraction and mRNA ensured correct RNA extraction and cDNAcDNAsynthesis. After amplification, samples were synthesis. After amplification, samples were subjected to electrophoresis on 2% subjected to electrophoresis on 2% agaroseagarose gels gels and visualized under ultraviolet light. Arrows and visualized under ultraviolet light. Arrows show RTshow RT--PCR products. A 100 bp molecular size PCR products. A 100 bp molecular size marker was used.marker was used.

396396+ - + - + - + - + - + -OoOo ZyZy 2c 4c Mo B2c 4c Mo B

(a)(a) 313313

+ - + - + - + - + - + -OoOo ZyZy 2c 4c Mo B2c 4c Mo B

(b)(b)

175175

+ - + - + - + - + - + -OoOo ZyZy 2c 2c 4c 4c Mo BMo B

(c)(c)

mRNA expression for the follicle mRNA expression for the follicle stimulating hormone receptor and stimulating hormone receptor and

luteinizing hormone receptor in luteinizing hormone receptor in human oocytes and human oocytes and

preimplantation stage embryos.preimplantation stage embryos.

E. E. PatsoulaPatsoula, D. , D. LoutradisLoutradis, P. , P. DrakakisDrakakis, L. , L. MichalasMichalas, , R. R. BletsaBletsa and S. and S. MichalasMichalas

Division of Human Reproduction, IVF Unit, First Department of ObDivision of Human Reproduction, IVF Unit, First Department of Obstetrics and stetrics and GynaecologyGynaecology, , Athens University Medical School, Athens, Greece (2003)Athens University Medical School, Athens, Greece (2003)

Table 12Table 12Oligonucleotide primers used for RTOligonucleotide primers used for RT--PCR assaysPCR assays

mRNAmRNAPCR PCR

Primer Primer PairPair

Primers 5Primers 5’’--33’’ Primer Sequence

Primer SequenceAnnealing Annealing

Temperature Temperature ((ooCC))

Product Product Size (bp)Size (bp)

FSHRFSHR OuterOuter 55’’ EndEnd CATCATCGGATCTGTCACTGCATCATCGGATCTGTCACTG 5555

33’’ EndEnd CAGCCCCACGAAAGAATTTCCAGCCCCACGAAAGAATTTC 5555 450450

InnerInner 55’’ EndEnd GAGAGCAAGGTGACAGAGATTCCGAGAGCAAGGTGACAGAGATTCC 5858

33’’ EndEnd CCTTTTGGAGAGAATGAATCTTCCTTTTGGAGAGAATGAATCTT 5858 340340

LHRLHR OuterOuter 55’’ EndEnd CACTTGCCTACCTCCCTGTCACACTTGCCTACCTCCCTGTCA 5555

33’’ EndEnd CTGATGCCTGTGTTACAGATCTGATGCCTGTGTTACAGAT 5555 244244

InnerInner 33’’ EndEnd TGCTCCGGGCTCAATGTATCTTGCTCCGGGCTCAATGTATCT 5555 191191

HRPTHRPT OuterOuter 55’’ EndEnd CTCCGCCTCCTCCTCTGCTCTCCGCCTCCTCCTCTGCT 5050

33’’ EndEnd GCCTGACCAAGGAAAGCAAAGGCCTGACCAAGGAAAGCAAAG 5050 528528

InnerInner 55’’ EndEnd GCCGGCTCCGTTATGGCGGCCGGCTCCGTTATGGCG 5555

33’’ EndEnd AGCCCCCCTTGAGCACACAGAAGCCCCCCTTGAGCACACAGA 5555 226226

P450P450 55’’ EndEnd TTGTTGTTAAATATGATGCCTTGTTGTTAAATATGATGCC 4848

33’’ EndEnd ATACCAGGTCCTGGCTACTGATACCAGGTCCTGGCTACTG 4848 272272

Figure7Figure7

FSHR mRNA expression in human FSHR mRNA expression in human oocytesoocytes and and preimplantationpreimplantationembryos. M: 100 embryos. M: 100 bpbp DNA Marker; Lane 1: DNA Marker; Lane 1: UnfertilisedUnfertilised oocytesoocyteswith and without reverse transcriptase respectively (+/with and without reverse transcriptase respectively (+/--); ); Lane 2: Zygotes (+/Lane 2: Zygotes (+/--); Lane); Lane--3: 23: 2--cell embryos (+/cell embryos (+/--); Lane 4: ); Lane 4: 44--cell embryos (+/cell embryos (+/--); Lane 5: ); Lane 5: MorulaMorula stage embryos (+/stage embryos (+/--); ); Lane 6: Lane 6: BlastocystBlastocyst stage embryos (+/stage embryos (+/--).).

Figure8Figure8

RTRT--PCR amplification of LHR mRNA expression in human PCR amplification of LHR mRNA expression in human oocytesoocytes and and preimplantationpreimplantation embryos. M: 100 embryos. M: 100 bpbp DNA DNA Marker; Lane 1: Marker; Lane 1: UnfertilisedUnfertilised oocytesoocytes with and without with and without reverse transcriptase respectively (+/reverse transcriptase respectively (+/--); Lane 2: Zygotes ); Lane 2: Zygotes (+/(+/--); Lane); Lane--3: 23: 2--cell embryos (+/cell embryos (+/--); Lane 4: 4); Lane 4: 4--cell cell embryos (+/embryos (+/--); Lane 5: ); Lane 5: MorulaMorula stage embryos (+/stage embryos (+/--); ); Lane 6: Lane 6: BlastocystBlastocyst stage embryos (+/stage embryos (+/--).).

340 340 bpbp

191 191 bpbp

M + - + - + - + - + - + -1 2 3 4 5 61 2 3 4 5 6

1 2 3 4 5 61 2 3 4 5 6M + - + - + - + - + - + -

ΣυµπεράσµαταΣυµπεράσµατα••TTαα ανθρώπιναανθρώπινα έµβρυαέµβρυα µεµε τηντην προσθήκηπροσθήκη γοναδοτροπινώνγοναδοτροπινών στσταακαλλιεργητικάκαλλιεργητικά µέσαµέσα διαιρούνταιδιαιρούνται φυσιολογικάφυσιολογικά καικαιεξελίσσονταιεξελίσσονται έωςέως τοτο στάδιοστάδιο τηςτης βλαστοκύστηςβλαστοκύστης.. ΗΗ παρουσίαπαρουσίαγοναδοτροπινώνγοναδοτροπινών σταστα καλλιεργητικάκαλλιεργητικά µέσαµέσα αυξαυξάνάνειει τηντηνπεριεκτικότηταπεριεκτικότητα σεσε πρωτεϊνπρωτεϊνεςες. . AnderiezAnderiez C (C (Hum.ReprHum.Repr.2000).2000)..

••ΤοΤο mRNA mRNA τωντων FSH FSH καικαι LHLH εκφράζεταιεκφράζεται σεσε ανθρώπιναανθρώπινα ωάριαωάριακαικαι έµβρυαέµβρυα πρινπριν τηντην εµφύτευσηεµφύτευση καικαι υποδηλώνειυποδηλώνει τοτο σηµαντικόσηµαντικόρόλορόλο τωντων γοναδοτροπινώνγοναδοτροπινών στηστη διαδικασίαδιαδικασία τηςτης ωρίµασηςωρίµασηςωαρίωνωαρίων καθώςκαθώς καικαι στηνστην πρώιµηπρώιµη εµβρυϊκήεµβρυϊκή ανάπτυξηανάπτυξη((LoutradisLoutradis D D ReproductionReproduction 2001, 2001, FertFert SterSter 20032003).).

••ΑνοσοκυτταροχηµικέςΑνοσοκυτταροχηµικές µελέτεςµελέτες έδειξανέδειξαν τηντην ύπαρξηύπαρξηλειτουργικούλειτουργικού υποδοχέαυποδοχέα FSH FSH σεσε χοίρουςχοίρους καικαι ανθρώπουςανθρώπους((MeduriMeduri G JCEM 2002).G JCEM 2002).

ΣυµπεράσµαταΣυµπεράσµαταΈχει περιγραφεί ότι τα ανθρώπινα ωάρια διαιρούνταιφυσιολογικά µετά την προσθήκη γοναδοτροπινών στακαλλιεργητικά µέσα. Επιπλέον η ανάπτυξη τωνανθρώπινων εµβρύων βελτιώνεται, ενώ παρατηρείται καιδραµατική αύξηση των πρωτεΐνών (Anderiez C,Hum.Repr.2000)

ΤοΤο mRNA mRNA τωντων υποδοχέωνυποδοχέων τωντων FSH FSH καικαι LH LH έχειέχει ανιχνευτείανιχνευτείσταστα ανθρώπιναανθρώπινα ωάριαωάρια καικαι σταστα προεµφυτευτικάπροεµφυτευτικά έµβρυαέµβρυα, , αναδεικνύονταςαναδεικνύοντας τοτο σηµαντικόσηµαντικό ρόλορόλο τωντων γοναδοτροπινώνγοναδοτροπινώνστηστη διαδικασίαδιαδικασία τηςτης ωρίµανσηςωρίµανσης ωαρίωνωαρίων καικαι στηνστην πρώιµηπρώιµηεµβρυΐκήεµβρυΐκή ανάπτυξηανάπτυξη (Loutradis D, Repr. Fert.Ster.).

ΑνοσοκυτταροχηµικέςΑνοσοκυτταροχηµικές µελέτεςµελέτες έδειξανέδειξαν λειτουργικούςλειτουργικούςυποδοχείςυποδοχείς FSHFSH σεσε ανθρώπιναανθρώπινα ωάριαωάρια καικαι σεσε ωάριαωάρια χοίρωνχοίρων(Meduri G J Clin End.Met.2002).

ConclusionsConclusions

This study demonstrated that human embryos have normal cleavage This study demonstrated that human embryos have normal cleavage and and development to the development to the blastocystblastocyst stage following the addition of stage following the addition of gonadotropinsgonadotropinsto culture system. Also increase the protein content when rto culture system. Also increase the protein content when r--FSH and rFSH and r--LH LH present in culture conditions. present in culture conditions. AnderiezAnderiez C (Hum.Repr.2000)C (Hum.Repr.2000)

mRNA for the FSH and LH receptors was observed in mRNA for the FSH and LH receptors was observed in oocytesoocytes and and preimplantationpreimplantation embryos at different stages, embryos at different stages, indicating a physiological role in the indicating a physiological role in the oocyteoocyte maturation maturation process and early embryonic development in the process and early embryonic development in the human.(Loutradishuman.(Loutradis D D ReprRepr. 2001 Fert.Ster.2003). 2001 Fert.Ster.2003)

ImmunocytochemicalImmunocytochemical studies showed the functional FSHR studies showed the functional FSHR in both pig and human in both pig and human oocytesoocytes .(.(MeduriMeduri G J G J ClinClinEnd.Met.2002)End.Met.2002)

Follicle stimulating hormone receptor gene mutations arenot evident in Greek women with premature ovarianfailure and poor respondersD.Loutradis 2004.

In the present studyIn the present study, we examined a group of 33 Greek , we examined a group of 33 Greek women with POF, 35 women with POF, 35 ““poopoorr respondersresponders”” and and 20 normal 20 normal fertile controls to determine if three of known fertile controls to determine if three of known inactivating inactivating mutations, T479C (Ile160Thr), C566T mutations, T479C (Ile160Thr), C566T (Ala189Val), C1717T(Arg573Cys) are present in the (Ala189Val), C1717T(Arg573Cys) are present in the FSH receptor gene . FSH receptor gene . The first two are The first two are extracellularextracellulardomain mutations, whereas the third is a domain mutations, whereas the third is a transmembranetransmembrane fertile controlsfertile controls to determine if three of to determine if three of the known inactivating the known inactivating domain mutation. domain mutation.

•• LetterLetter•• NatureNature 440440, 1073, 1073--1077 (20 1077 (20 AprilApril 2006) | 2006) | doidoi:10.1038/nature04648; :10.1038/nature04648; ReceivedReceived 17 17 OctoberOctober 2005; ; 2005; ; AcceptedAccepted 14 14 FebruaryFebruary 20062006•• PharmacoPharmaco--metabonomicmetabonomic phenotypingphenotyping andand personalizedpersonalized drugdrug treatmenttreatment•• T. T. AndrewAndrew ClaytonClayton11, , JohnJohn C. LindonC. Lindon11, , OlivierOlivier CloarecCloarec11, , HenrikHenrik AnttiAntti22, , ClaudeClaude CharuelCharuel33, , GillesGilles HantonHanton33, , JeanJean--PierrePierre ProvostProvost33, , JeanJean--LoLoïïcc

LeLe NetNet33, , DavidDavid BakerBaker44, , RosalindRosalind J. WalleyJ. Walley55, , JeremyJeremy R. EverettR. Everett55 andand JeremyJeremy K. NicholsonK. Nicholson11•• TopTop ofof pagepage ThereThere isis a a clearclear casecase forfor drugdrug treatmentstreatments toto bebe selectedselected accordingaccording toto thethe characteristicscharacteristics ofof anan individualindividual patientpatient, , inin orderorder toto

improveimprove efficacyefficacy andand reducereduce thethe numbernumber andand severityseverity ofof adverseadverse drugdrug reactions1, 2. reactions1, 2. HoweverHowever, , suchsuch personalizationpersonalization ofof drugdrug treatmentstreatmentsrequiresrequires thethe abilityability toto predictpredict howhow differentdifferent individualsindividuals willwill respondrespond toto a a particularparticular drug/dosedrug/dose combinationcombination. . AfterAfter initialinitial optimismoptimism, , therethere isisincreasingincreasing recognitionrecognition ofof thethe limitationslimitations ofof thethe pharmacogenomicpharmacogenomic approachapproach, , whichwhich doesdoes notnot taketake accountaccount ofof importantimportant environmentalenvironmentalinfluencesinfluences onon drugdrug absorptionabsorption, , distributiondistribution, , metabolismmetabolism andand excretion3, 4, 5. excretion3, 4, 5. ForFor instanceinstance, a , a majormajor factorfactor underlyingunderlying interinter--individualindividualvariationvariation inin drugdrug effectseffects isis variationvariation inin metabolicmetabolic phenotypephenotype, , whichwhich isis influencedinfluenced notnot onlyonly byby genotypegenotype butbut alsoalso byby environmentalenvironmental factorsfactorssuchsuch asas nutritionalnutritional statusstatus, , thethe gutgut microbiotamicrobiota, , ageage, , diseasedisease andand thethe coco-- oror prepre--administrationadministration ofof otherother drugs6, 7. drugs6, 7. ThusThus, , althoughalthough geneticgeneticvariationvariation isis clearlyclearly importantimportant, , itit seemsseems unlikelyunlikely thatthat personalizedpersonalized drugdrug therapytherapy willwill bebe enabledenabled forfor a a widewide rangerange ofof majormajor diseasesdiseases usingusinggenomicgenomic knowledgeknowledge alonealone. . HereHere wewe describedescribe anan alternativealternative andand conceptuallyconceptually newnew ''pharmacopharmaco--metabonomicmetabonomic' ' approachapproach toto personalizingpersonalizingdrugdrug treatmenttreatment, , whichwhich usesuses a a combinationcombination ofof prepre--dosedose metabolitemetabolite profilingprofiling andand chemometricschemometrics toto modelmodel andand predictpredict thethe responsesresponses ofofindividualindividual subjectssubjects. . WeWe provideprovide proofproof--ofof--principleprinciple forfor thisthis newnew approachapproach, , whichwhich isis sensitivesensitive toto bothboth geneticgenetic andand environmentalenvironmental influencesinfluences, , withwith a a studystudy ofof paracetamolparacetamol ((acetaminophenacetaminophen) ) administeredadministered toto ratsrats. . WeWe showshow prepre--dosedose predictionprediction ofof anan aspectaspect ofof thethe urinaryurinary drugdrugmetabolitemetabolite profileprofile andand anan associationassociation betweenbetween prepre--dosedose urinaryurinary compositioncomposition andand thethe extentextent ofof liverliver damagedamage sustainedsustained afterafter paracetamolparacetamoladministrationadministration..

•• TopTop ofof pagepage•• BiologicalBiological ChemistryChemistry, , BiomedicalBiomedical SciencesSciences DivisionDivision, , FacultyFaculty ofof NaturalNatural SciencesSciences, , SirSir AlexanderAlexander FlemingFleming BuildingBuilding, , ImperialImperial CollegeCollege LondonLondon, ,

SouthSouth KensingtonKensington, , LondonLondon SW7 2AZ, UK SW7 2AZ, UK •• DepartmentDepartment ofof ChemistryChemistry, , UmeUmeåå UniversityUniversity, 901 87 , 901 87 UmeUmeåå, , SwedenSweden•• PfizerPfizer GlobalGlobal ResearchResearch & & DevelopmentDevelopment, , CentreCentre dede RechercheRecherche, 37401 , 37401 AmboiseAmboise CedexCedex, , FranceFrance•• PfizerPfizer IncInc., 2800 ., 2800 PlymouthPlymouth RoadRoad, , AnnAnn ArborArbor, , MichiganMichigan 48105, USA 48105, USA •• PfizerPfizer GlobalGlobal ResearchResearch & & DevelopmentDevelopment, , RamsgateRamsgate RoadRoad, , SandwichSandwich, , KentKent CT13 9NJ, UK CT13 9NJ, UK •• CorrespondenceCorrespondence toto: : JeremyJeremy K. NicholsonK. Nicholson11 CorrespondenceCorrespondence andand requestsrequests forfor materialsmaterials shouldshould bebe addressedaddressed toto J.K.N J.K.N

((EmailEmail:: [email protected]@imperial.ac.uk).).•• ReceivedReceived 17 17 OctoberOctober 2005 | 2005 | AcceptedAccepted 14 14 FebruaryFebruary 20062006

mailto:[email protected]

ΦαρµακογενετικήΦαρµακογενετική προσέγγισηπροσέγγιση τηςτης ωοθηκικήςωοθηκικής υπερδιέγερσηςυπερδιέγερσης στηνστην IVFIVFD.Loutradis 2005D.Loutradis 2005

ΣτηνΣτην παρούσαπαρούσα µελέτηµελέτη

•• ΕΕξετάσαµεξετάσαµε τηντην παρουσίαπαρουσία τουτου πολυµορφισµούπολυµορφισµού Ser680Asn Ser680Asn τουτουγονιδίουγονιδίου τουτου υποδοχέαυποδοχέα τηςτης FSH, FSH,

•• ΣυΣυσχετήσαµεσχετήσαµε τοντον πολυµορφισµόπολυµορφισµό τουτου υποδοχέαυποδοχέα µµεε ττοοορµονικορµονικόό προφίλπροφίλ τωντων ασθενώνασθενών,,

•• ΣΣυσχετυσχετήήσαµεσαµε τιςτις παραλλαγέςπαραλλαγές τουτου υποδοχέαυποδοχέα µεµε τατα κλινικάκλινικάχαρακτηριστικάχαρακτηριστικά ασθενώνασθενών πουπου είχανείχαν χαρακτηριστείχαρακτηριστεί ωςως ππτωχτωχέςέςαπαπαντήτριεςαντήτριες, , καλέςκαλές απαπαντήτριεςαντήτριες καικαι ασθενώνασθενών µεµε ωοθηκικήωοθηκικήδυσλειτουργίαδυσλειτουργία,,

•• ΗΗ µελέτηµελέτη έγινεέγινε σεσε ελληνικόελληνικό πληθυσµόπληθυσµό..

A pharmacogenetic approach to controlled ovarian hyperstimulatioA pharmacogenetic approach to controlled ovarian hyperstimulation in IVFn in IVFD.Loutradis 2005D.Loutradis 2005

•• In the present study, we examined the In the present study, we examined the prevalence ofprevalence of Ser680AsnSer680Asn polymorphism of the polymorphism of the FSH receptor gene, associated the receptor FSH receptor gene, associated the receptor polymorphism with hormonal profiles and polymorphism with hormonal profiles and correlated the variants to the clinical correlated the variants to the clinical characteristics of assisted reproductive characteristics of assisted reproductive technologies (ART) in technologies (ART) in ““poorpoor”” responders, responders, ““goodgood””responders and responders and ““ovarian dysfunctionovarian dysfunction”” patients patients among the Greek populationamong the Greek population

•• Figure 1. Figure 1. Figure 1.

Figure legendsFigure 1. RFLP analysis of the Asn680Ser FSHR variant. Following BsrI digestion of the PCR products, 2.5% agarose gel electrophoresis revealed the patterns presented. Lanes 1-4 present two bands, 520 and 413 bp, corresponding to the Asn/Ser variant, Lanes 4-7 present a 413 bp band corresponding to the Ser/Ser variant, and Lanes 8-11 present a 520 bp band corresponding to the Asn/Asn variant. M represents a 100-bp molecular size marker (Invitrogen Life Technologies).

Table I. Biological. and clinical characteristics of 97 patients that underwent IVF/ICSI, grouped according to FSRH polymorphism

Asn/Ser Ser/Ser Asn/Asn

Age (y) 29 ± 3 31 ± 3 33 ± 3

FSH (mIU/mL) 7.4 ± 3.4 b 9.0 ± 3.5 b 8.5 ± 2.1 b

LH (mIU/mL) 4.9 ± 2.2 a 7.9 ± 1.5 a 6.5 ± 4.0 a

PRL (ng/mL) 10.1 ± 1.9 a 14.8 ± 3.9 a 12.6 ± 2.8 a

Estrogen levels on HCG admin (pg/mL)

2733 ± 1792 c 1583 ± 1181 c 1273 ± 602 c

Total rFSH dose (IU) 3070 ± 1494 3512 ± 1499 3105 ± 992

Stimulation days 11 ± 0 11 ± 1 11 ± 0

No. of follicles 8.7 ± 2.8 a 6.6 ± 2.0 a 5.7 ± 2.9 a

No. of oocytes 7.7 ± 2.8 a 6.0 ± 2.5 a 5.3 ± 3.3 a

Mature oocytes (%) 69.5 ± 2.4 67.5 ± 12.6 90.9 ± 10.8

Fertilization Rate (%) 98.0 ± 5.4 98.0 ± 2.5 94.8 ± 6.1

Pregnancies (n) 3/44 3/30 2/23

•• KruskalKruskal Wallis test for the analysis of variance. Superscripts indicateWallis test for the analysis of variance. Superscripts indicate: a: p

Frequency distribution of different allelic variants in 125 Frequency distribution of different allelic variants in 125 women, according to ovarian function. Data are number of women, according to ovarian function. Data are number of subjects.subjects.

Asn/Ser Ser/Ser Asn/Asn Total

Ovarian DysfunctionOvarian Dysfunction10 ( 22.7%) 20 ( 45,4%) 14 ( 31,8%) 44

Poor Responders 15 ( 42,8%) 10 (28,5%) 10 ( 28,5%) 35

Good responders 24 (52,1%) 12 ( 26,0%) 10 ( 21,7%) 46

Total 59 a 42 a 34 a 125

Table III. Biological and clinical characteristics of 97 patientTable III. Biological and clinical characteristics of 97 patients that s that underwent IVF/ICSI, grouped according to ovarian responseunderwent IVF/ICSI, grouped according to ovarian response

Ovarian Dysfunction (OD) Poor responders (PR) Good responders (GR)

Asn/Ser Ser/Ser Asn/Asn Asn/Ser Ser/Ser Asn/Asn Asn/Ser Ser/Ser Asn/Asn

Age (y) 27 ± 3 33 ± 2 27 ± 4 31 ± 3 32 ± 2 34 ± 2 28.3 ± 2.6 28.8 ± 1.8 32.9 ± 2.4

FSH (mIU/ mL) 15.5 ± 5.2 14.2 ± 1.9 13.6 ± 1.2 5.5 ± 0.7 a 8.0 ± 0.5a 8.1 ± 0.5 a 6.9 ± 0.8 6.4 ± 1.4 7.5 ± 0.9

LH (mIU/ mL) 10.2 ± 0.9 8.5 ± 2.0 10.1 ± 1.3 3.8 ± 0.6 a 7.8 ± 1.3 a 2.1 ± 0.5 a 4.6 ± 1.3 a 7.4 ± 1.1 a 9.8 ± 1.6 a

E2 (pg/mL) 2806±304a

746 ± 84 a 1344 ± 16 a 595 ± 164 557 ± 149 728 ± 294 4055 ±1080 a

2995 ± 130a

1796 ±406 a

GonadotropinDose (IU)

3522 ±548

4483 ±244b

3439±479 4873 ±764

4720±1009

3787±968c

1849 ± 218c

1858 ± 246c

2322 ±427 c

Follicles (#) 9.0 ± 0.7 b 5.0 ± 0.7 b 4.0 ± 0.0 b 5 ± 0.8 a 5 ± 0.8 a 3 ± 0.6 a 11 ± 0.8 a 9 ± 0.7 a 9 ± 0.6 a

Oocytes (#) 8.0 ± 0.7 b 4.0 ± 0.7 b 4.0 ± 0.0 b 4 ± 0.6 a 4 ± 0.9 a 2 ± 0.5 a 10 ± 0.6 a 9 ± 0.7 a 9 ± 0.7 a

Pregnancies 0/5 1/8 0/3 0/15 0/10 1/10 3/24 2/12 1/10

Kruskal Wallis test for the analysis of variance. Superscripts indicate: a: p

ΣυµπεράσµαταΣυµπεράσµατα

•• ΗΗ προκαταρκτικήπροκαταρκτική αυτήαυτή µελέτηµελέτη έέδδειξεειξε ότιότι υπάρχειυπάρχει τάσητάση γιαγιατουςτους ασθενείςασθενείς OD OD νανα παρουσιάπαρουσιάζζουνουν ττοο αλλήλιοαλλήλιο Ser/SerSer/Ser((44,5%), 44,5%), ενώενώ οιοι ασθενείςασθενείς GR GR νανα παρουσιάζουνπαρουσιάζουν συχνότερασυχνότερα ττοοαλλαλλήλιοήλιο AsnAsn/Ser/Ser ((pp

CONCLUSIONSCONCLUSIONS

•• In conclusion, this preliminary study shows that there is In conclusion, this preliminary study shows that there is a tendency for OD patients to present the Ser/Ser allelic a tendency for OD patients to present the Ser/Ser allelic variant (44.5%), whereas GR patients present more variant (44.5%), whereas GR patients present more often the often the AsnAsn/Ser allelic variant (p


•• In this preliminary study the distribution of the allelic In this preliminary study the distribution of the allelic variants variants inin““poorpoor respondersresponders”” patients was 10 Ser/Ser, patients was 10 Ser/Ser, 10 10 Ans/AsnAns/Asn and 15 and 15 AnsAns/Ser genotype./Ser genotype.

•• In In ““ovarian ovarian dysfunctiondysfunction””patientspatients AnsAns/Ser genotype gives /Ser genotype gives more follicles and more follicles and oocytesoocytes while the serum E2 was while the serum E2 was higher.higher.

•• In In ““ODOD”” the Ser/Ser genotype was a large percentage the Ser/Ser genotype was a large percentage (45,4%)(45,4%)

•• The FSH level on day 3 of menstrual cycle was slight The FSH level on day 3 of menstrual cycle was slight elevated in Ser/elevated in Ser/Ser,Asn/AsnSer,Asn/Asn genotype.genotype.

Knockout of LHR abolishes the effects of FSH on Knockout of LHR abolishes the effects of FSH on preovulatorypreovulatory maturation and maturation and ovulation of mouse ovulation of mouse graafiangraafian follicles.Mol.Endfollicles.Mol.End. 19(10):2591. 19(10):2591--2602,20052602,2005PakarainnenPakarainnen T et all T et all

•• ItIt isis consideredconsidered a a dogmadogma thatthat a a secretorysecretory peakpeak ofof LH LH isis indispensableindispensable asas thethe triggertrigger ofofovulationovulation. . HoweverHowever, , earlierearlier studiesstudies onon hypophysectomizedhypophysectomized rodentsrodents havehave shownshown thatthatstimulationstimulation withwith recombinantrecombinant FSH, FSH, devoiddevoid ofof anyany LH LH activityactivity, , isis ableable toto boostboost thethe finalfinalstagesstages ofof follicularfollicular maturationmaturation andand triggertrigger ovulationovulation. . AsAs thethe expressionexpression ofof ovarianovarian LH LH receptorsreceptors ((LHRsLHRs) ) stillstill persistspersists afterafter hypophysectomyhypophysectomy, , suchsuch studiesstudies cannotcannot totallytotallyexcludeexclude thethe possibilitypossibility thatthat LHR LHR activationactivation isis involvedinvolved inin thethe apparentlyapparently purepure FSH FSH effectseffects. . ToTo revisitrevisit thisthis questionquestion, , wewe analyzedanalyzed inin LHR LHR knockoutknockout ((LuRKOLuRKO) ) micemice thetheprogressionprogression ofof folliculogenesisfolliculogenesis andand inductioninduction ofof ovulationovulation byby humanhuman chorionicchorionicgonadotropingonadotropin andand humanhuman recombinantrecombinant FSH FSH treatmentstreatments. . TheThe resultsresults provideprovide clearclearevidenceevidence thatthat follicularfollicular developmentdevelopment andand ovulationovulation couldcould notnot bebe inducedinduced byby highhighdosesdoses ofof FSH FSH inin thethe absenceabsence ofof LHR LHR expressionexpression. . OvarianOvarian histologyhistology andand oocyteoocyteanalysesanalyses indicatedindicated thatthat follicularfollicular maturationmaturation diddid notnot advanceadvance inin LuRKOLuRKO micemice beyondbeyondthethe antralantral folliclefollicle stagestage. . NeitherNeither werewere ovulationsovulations detecteddetected inin LuRKOLuRKO ovariesovaries afterafter anyanyofof thethe gonadotropingonadotropin treatmentstreatments. . TheThe ovarianovarian resistanceresistance toto FSH FSH treatmenttreatment inin thetheabsenceabsence ofof LHR LHR waswas confirmedconfirmed byby realreal--timetime RTRT--PCR PCR andand immunohistochemicalimmunohistochemicalanalysesanalyses ofof a a numbernumber ofof gonadotropingonadotropin--dependentdependent genesgenes, , whichwhich onlyonly respondedresponded totothethe treatmentstreatments inin wildwild--typetype controlcontrol micemice. . NegativeNegative findingsfindings werewere notnot alteredaltered bybyestradiolestradiol primingpriming precedingpreceding thethe gonadotropingonadotropin stimulationsstimulations. . HenceHence, , thethe presentpresent studystudyshowsshows thatthat, , inin additionaddition toto ovulationovulation, , thethe expressionexpression ofof LHR LHR isis essentialessential forfor follicularfollicularmaturationmaturation inin thethe progressionprogression fromfrom antralantral toto preovulatorypreovulatory stagestage..

THEORY THEORY

Physiology and basic science has been proven that LH is essential for optimal maturation and development of follicle during ovulation induction treatment.

This confirms the “two-cell”,two-gonadotrophin”theory, emphasizing that stimulation of both theca cells by LH and granulosa cells by FSH and LH is required for adequate oestradiol biosynthesis but probably also for optimal follicle oocyte maturation.

ΘΕΩΡΙΑ

Η LH είναι απαραίτητη για την ωρίµανση και τηνανάπτυξη του ωοθυλακίου κατά τη διάρκεια πρόκλησηςωοθυλακιορρηξίας. Αυτό επιβεβαιώνει τη θεωρία "δύο- κύτταρα", δύο-γοναδοτροπίνες"Σύµφωνα µε τη θεωρία η διέγερση των κυττάρων θήκηςαπό την LH και των κοκκωδών κυττάρων από την FSH απαιτείται για την επαρκή παραγωγή οιστραδιόλης για τηβέλτιστη ωρίµανση των ωαρίων.

Knockout of LHR abolishes the effects of FSH on Knockout of LHR abolishes the effects of FSH on preovulatorypreovulatory maturation and maturation and ovulation of mouse ovulation of mouse graafiangraafian follicles.Mol.Endfollicles.Mol.End. 19(10):2591. 19(10):2591--2602,20052602,2005PakarainnenPakarainnen T et all T et all

--SStudiestudies onon hypophysectomizedhypophysectomized rodentsrodents havehave shownshown thatthat stimulationstimulation withwith recombinantrecombinant FSH, FSH, devoid of any LH activity, is able to boost the final stages of devoid of any LH activity, is able to boost the final stages of follicular maturation and trigger follicular maturation and trigger ovulation.ovulation.

•• As the expression of ovarian LH receptors (LHRs) still persistsAs the expression of ovarian LH receptors (LHRs) still persists after hypophysectomy, such after hypophysectomy, such studies cannot totally exclude the possibility that LHR activatistudies cannot totally exclude the possibility that LHR activation is involved in the apparently pure on is involved in the apparently pure FSH effects.FSH effects.

•• To To answer answer this question, this question, they they analyzed in LHR knockout (LuRKO) mice the progression of analyzed in LHR knockout (LuRKO) mice the progression of folliculogenesis and induction of ovulation by human chorionic gfolliculogenesis and induction of ovulation by human chorionic gonadotropin and human onadotropin and human recombinant FSH treatments.recombinant FSH treatments.

•• The results provide clear evidence that follicular development The results provide clear evidence that follicular development and ovulation could not be induced and ovulation could not be induced by high doses of FSH in the absence of LHR expression.by high doses of FSH in the absence of LHR expression.

•• The ovarian resistance to FSH treatment in the absence of LHR waThe ovarian resistance to FSH treatment in the absence of LHR was confirmed by reals confirmed by real--time RTtime RT--PCR and immunohistochemical analyses of a number of gonadotropinPCR and immunohistochemical analyses of a number of gonadotropin--dependent genes, which dependent genes, which only responded to the treatments in wildonly responded to the treatments in wild--type control mice.type control mice.

•• TThe present study shows that, in addition to ovulation, the exprehe present study shows that, in addition to ovulation, the expression of LHR is essential for ssion of LHR is essential for follicular maturation in the progression from antral to preovulafollicular maturation in the progression from antral to preovulatory stage.tory stage.

•• ScienceScience.. 2004 2004 JanJan 30;303(5658):68230;303(5658):682--4. 4. EpubEpub 2004 2004 JanJan

EGFEGF--likelike growthgrowth factorsfactors asas mediatorsmediators ofof LH LH actionaction inin thethe ovulatoryovulatory folliclefollicle..

ParkPark JYJY, , SuSu YQYQ, , ArigaAriga MM, , LawLaw EE, , JinJin SLSL, , ContiConti MM..

DivisionDivision ofof ReproductiveReproductive BiologyBiology andand DivisionDivision ofof ReproductiveReproductive EndocrinologyEndocrinology andand InfertilityInfertility, , DepartmentDepartment ofof ObstetricsObstetrics andand GynecologyGynecology, , StanfordStanford UniversityUniversity SchoolSchool ofof MedicineMedicine, , StanfordStanford, , CA 94305, USA.CA 94305, USA.

BeforeBefore ovulationovulation inin mammalsmammals, a , a cascadecascade ofof eventsevents resemblingresembling anan inflammatoryinflammatoryand/orand/or tissuetissue remodelingremodeling processprocess isis triggeredtriggered byby luteinizingluteinizing hormonehormone (LH) (LH) inin thetheovarianovarian folliclefollicle. . ManyMany LH LH effectseffects, , howeverhowever, , areare thoughtthought toto bebe indirectindirect becausebecause ofofthethe restrictedrestricted expressionexpression ofof itsits receptorreceptor. . HereHere, , wewe demonstratedemonstrate thatthat LH LH stimulationstimulation inducesinduces thethe transienttransient andand sequentialsequential expressionexpression ofof thethe epidermalepidermalgrowthgrowth factorfactor (EGF) (EGF) familyfamily membersmembers amphiregulinamphiregulin, , epiregulinepiregulin, , andand betabeta--cellulincellulin. . IncubationIncubation ofof folliclesfollicles withwith thesethese growthgrowth factorsfactors recapitulatesrecapitulates thethe morphologicalmorphologicalandand biochemicalbiochemical eventsevents triggeredtriggered byby LH, LH, includingincluding cumuluscumulus expansionexpansion andand oocyteoocytematurationmaturation. . ThusThus, , thesethese EGFEGF--relatedrelated growthgrowth factorsfactors areare paracrineparacrinemediatorsmediators thatthat propagatepropagate thethe LH LH signalsignal throughoutthroughout thethe folliclefollicle

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Park+JY%22%5BAuthor%5Dhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Su+YQ%22%5BAuthor%5Dhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Ariga+M%22%5BAuthor%5Dhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Law+E%22%5BAuthor%5Dhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Jin+SL%22%5BAuthor%5Dhttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=pubmed&cmd=Search&itool=pubmed_Abstract&term=%22Conti+M%22%5BAuthor%5D

29

Does the addition of menopausal gonadotropinto recombinant FSH in pituitary – suppressed women improve clinical pregnancy in an intracytoplastic sperm injection program?

29

Ovarian stimulation characteristics in the two groups

NS180.252181.49Started dose IU

0.00070,063.4Percent of fertilized oocytes

0.0210.210.7No of ≥ 15mm follicules

0.041667.91535E2(pg/ml) on hCG day

0.00010.3310.59Days of ovarian stimulation

0.0632.231.5Age

prFSH + HMGrFSHVariable

29

Table II. Ovum retrieval and outcome of ICSI in the two groups of patients

NS6.6%7.5%Implantation rate

NS29.7%34.7%Clinical pregnancy / started cycle

NS31.9%35.7%Clinical pregnancy / ET

NS35.3%41.2%Pregnancy / ET

NS4.524.76No of transferable embryos

NS6.3786.359No of oocytes fertilized

0.048.8829.551No of oocytes retrieved

pτFSH + HMGτFSHVariable

RATIONALRATIONAL

A Comparative prospective and randomize study was performed to evaluate the hypothesis that ‘DIFFICULT PATIENTS’ it would be possible to improve stimulation characteristics and pregnancy rate further if stimulation was carried out with the flare protocol associating with r - FSH and HMG to detect which women will need additional LH administration .

Table 1. Parameters of the patients of our studyTable 1. Parameters of the patients of our study

Group AGroup An=108n=108

rFSHrFSH

Group BGroup Bn=38n=38

rFSH+HMGrFSH+HMG

Group CGroup Cn=35n=35

rFSH+HMGrFSH+HMGPP

Age Age (years)(years)

37.3337.33±±3.783.78 38.0938.09±±5.305.30 39.2039.20±±2.102.10 0.0650.065

BMI BMI (kg/m(kg/m22))

23.8023.80±±0.290.29 22.9022.90±±0.330.33 22.0722.07±±0.380.38 0.1490.149

Duration of Duration of infertility infertility (months)(months)

76.8476.84±±50.250.2 73.8673.86±±49.649.6 75.9475.94±±49.049.0 N.S.N.S.

Previous Previous attempts attempts (1(1--6)6)

1.701.70±±1.341.34 2.1142.114±±1.241.24 2.192.19±±1.191.19 N.S.N.S.

FSHFSH 6.946.94±±1.041.04 6.806.80±±1.001.00 9.209.20±±1.091.09 0.0080.008

LHLH 4.424.42±±1.051.05 4.604.60±±1.101.10 4.854.85±±1.091.09 0.6420.642

Table 2. IVF/ICSI outcome in the patients of our studyTable 2. IVF/ICSI outcome in the patients of our study


Group BGroup Bn=38n=38

Group CGroup Cn=35n=35 PP

Serum ESerum E22 on on the day of the day of HCG HCG administration administration (pg/ml)(pg/ml)

933.80933.80±±1.101.10 905.90905.90±±1.101.10 697.00697.00±±1.101.10 0.500.50

Total dose Total dose (IU)(IU)

2750.02750.0±±1039.781039.78 3140.03140.0±±1084.141084.14 3450.03450.0±±1100.01100.0 0.000.00

# # oocytesoocytes 763 (6.8)763 (6.8) 709 (7.8)709 (7.8) 189 (5.4)189 (5.4) 0.0000.000

Immature Immature oocytesoocytes (%)(%) 212 (27.7)212 (27.7) 205 (28.9)205 (28.9) 42 (22.2)42 (22.2) 0.1670.167

Fertilization Fertilization rate (%)rate (%) 551 (72.2)551 (72.2) 504 (71.0)504 (71.0) 147 (77.7)147 (77.7) 0.1670.167

No of No of transferable transferable embryos embryos

410/112 (3.6)410/112 (3.6) 396/90 (4.4)396/90 (4.4) 134/35 (3.8)134/35 (3.8) 0.0010.001

Pregnancy Pregnancy rate per rate per transfer (%)transfer (%)

23.223.2 26.726.7 8.68.6 0.0890.089

Table 3. Quality of embryos transferred Group A

410 Group B

396 Group C

134 p

Grade of embryos 4 3 2+1

60 (14.6%) 245 (59.7%) 105 (25.6%)

150 (37.8%) 200 (50.5%) 46 (11.6%)

-

75 (56.0%) 59 (44.0%)

0.000

Embryo cleavage 2C

40 (9.7%)

37 (9.3%)

22 (16.4%)

3C 71 (17.3%) 59 (14.8%) 31 (23.1%) 4C 226 (55.1%) 232 (58.5%) 71 (53%) 5C 63 (15.3%) 60 (15.1%) 9 (6.7%) 6C 6 (1.4%) 5 (1.2%) 1 (0.7%) 8C 4 (0.7%) 3 (0.7%) 0

X2=17.56 P=0.001

Comments

A slight increase on day 3 FSH is a strong prognostic factor for a poor outcome.

Serum E2 on the day of hCG administration is a marker of embryo quality.

LH group had better quality of embryos.

ΟΟ ρόλοςρόλος τωντων υποδοχέωνυποδοχέων LH/ LH/ hCGhCG στηνστην διέγερσηδιέγερση τωντων ωοθηκώνωοθηκών--ΦαρµακογενετικήΦαρµακογενετική προσέγγισηπροσέγγιση

ΕκτίµησηΕκτίµηση τηςτης σχέσηςσχέσης µεταξύµεταξύ δραστικότηταςδραστικότητας τηςτης hCGhCGκαικαι τουτου υποδοχέαυποδοχέα LH/LH/hCGhCG--R, R, καικαι τωντων αντιγράφωναντιγράφωνcDNAcDNA..

ΑΣΘΕΝΕΙΣΑΣΘΕΝΕΙΣ: : ΣτηΣτη µελέτηµελέτη συµπεριελήφθησανσυµπεριελήφθησαν 31 31 γυναίκεςγυναίκες µεµε ιστορικόιστορικό 22--6 6 προσπαθειώνπροσπαθειών IVF/ICSIIVF/ICSI. . ΟιΟι γυναίκεςγυναίκες χωρίστηκανχωρίστηκαν σεσε δύοδύο οµάδεςοµάδες::

AA.. ΛίγαΛίγα αντίγραφααντίγραφα< 30 c/< 30 c/µµl l καικαιB. B. ΠολλάΠολλά αντίγραφααντίγραφα>30 c/>30 c/µµl c DNA.l c DNA.

The role of LH/ The role of LH/ hCGhCG R ,as R ,as pharmacogeneticpharmacogenetic approach to controlled ovarian approach to controlled ovarian hyperstimulationhyperstimulation

To evaluate the association between To evaluate the association between hCGhCG efficacy and LH/efficacy and LH/hCGRhCGR, and , and cDNAcDNAcopies .copies .

PATIENT(S): 31 women withPATIENT(S): 31 women with a history of a history of 22--6 previous attempts of IVF/ICSI were 6 previous attempts of IVF/ICSI were included in the present study.included in the present study. Women Women were categorized in two groups A low were categorized in two groups A low copies< 30 c/copies< 30 c/µµl and B. high copies l and B. high copies >30 c/>30 c/µµl of c DNA.l of c DNA.

Ovulation ProtocolOvulation Protocol

•• The short protocol was briefly as follows: They started with 500The short protocol was briefly as follows: They started with 500µµg/day intranasal spray of g/day intranasal spray of suprefactsuprefact (Hoechst) on cycle day 2. (Hoechst) on cycle day 2. Administration of Administration of gonadotropinsgonadotropins started on started on day 2 at a dose of 200IU rFSH +200 IU hCG or (rLH 200IU) only for fourth days. Plasma Plasma estradiol (E2) levels were measured 7 days after commencing the estradiol (E2) levels were measured 7 days after commencing the regimen daily until the day after hCG administration. The first regimen daily until the day after hCG administration. The first scan scan was performed on day 7 and subsequent scans were performed was performed on day 7 and subsequent scans were performed every day until oocyte retrieval. The dose of rFSH was adjusted every day until oocyte retrieval. The dose of rFSH was adjusted according to ovarian response after 6 days of gonadotropin according to ovarian response after 6 days of gonadotropin administration. GnRHadministration. GnRH--a administration was continued until hCG a administration was continued until hCG administration (10.000 IU) was given intramuscularly when the administration (10.000 IU) was given intramuscularly when the mean diameter of at least two leading follicles was mean diameter of at least two leading follicles was ≥≥18mm and 18mm and serum E2 was rising. The procedure was then the same as serum E2 was rising. The procedure was then the same as described previously in the long protocol described previously in the long protocol

Demographic Data Demographic Data hCGhCG

GROUP

19 61,3 61,312 38,7 100,031 100,0

Low CopiesHigh CopiesTotal

ValidFrequency Percent

CumulativePercent

Demographic Data Demographic Data hCGhCG

# 31

Age (y) 36,29±0,85

FSH (mIU/mL) 8,04 ± 3,06

LH (mIU/mL) 5,90 ± 1,98

PRL (ng/mL) 12,3 ± 6,5

Years infertility (1-17) 6,8

Stimulation days 10.97 ± 2,10

No. of follicles 7,00 ± 2,22

Immature oocytes (%) 29.2

Fertilization Rate (%) 73,8

Table 1 Table 1 OligonucleotideOligonucleotide primers used for RTprimers used for RT--PCR assaysPCR assays

mRNA PCR primer PCR primer pairpair

PrimersPrimers55’’ –– 33’’

SequenceofSequenceof oligonucleotideoligonucleotide Annealing Annealing temperaturetemperature(0C)

Product Product size (size (bpbp))

HCG-R

HPRT

Outer pairOuter pair

Inner pairInner pair

Outer pairOuter pair

Inner pairInner pair

5’-3’3’-5’5’-3’3’-5’5’-3’3’-5’5’-3’3’-5’

CCATGTGAAAGCACAGTAAGGAAGGCTATGAGCAGCAGATAGAGGGACTGAGTGGCTGGGACTAGCAAAAGTCTGCAAAGGAGACTCCGCCTCCTCCTCTGCTGCCTGACCAAGGAAAGCAAAGGCCGGCTCCGTTATGGCGAGCCCCCCTTGAGCACACAGA

5555555550505555

343

249

528

226

Figure 1. RFLP analysis of the hCG/LHR. Following BsrI digestion of the PCR products, 2.5% agarose gel electrophoresis revealed the patterns presented. Lanes 1-13 present two bands, 249 bp, corresponding to the hCG/LHR, M represents a 100-bp molecular size marker (Invitrogen Life Technologies)

Biological and clinical characteristics Biological and clinical characteristics hCGhCG

Low copies #19 High copies #12

Age (y) 35,8 ± 4,71 37,00 ± 4,97

FSH (mIU/ mL) 7,94 ± 2,50 9,06 ± 4,26

LH (mIU/ mL) 6,25 ± 2,14 5,87 ± 2,72

PRL(ng/ml) 13,25 ± 7,04 10,85 ± 4,39


2944,74 ± 1221,8 2812.50 ± 1274,5

E2 on the day of hCG(pg/mL)

1711,68 ± 1117,7 1534.09 ± 684,3

Days of stimulation 11.05 ± 2,12 10,83 ± 2,16

Follicles (#) 7,42 ± 2,29 6,27 ± 2,00

Immature oocytes 0,26 ± 0,15 0,33 ± 0,14

Fertilization Rate (%) 74 72

Endometrium thickness > 8mm 89,5% >8mm 70%

Pregnancies (%) 26,3 27,3

ΠιθανόςΠιθανός ΜηχανισµόςΜηχανισµός

ΣτιςΣτις γυναίκεςγυναίκες µεµε τατα ««λλίγίγαα αντίγραφααντίγραφα" " τουτου υποδοχέαυποδοχέαhCGhCG σταστα λεµφοκύτταραλεµφοκύτταρα τωντων δειγµάτωνδειγµάτων αίµατοςαίµατος, , ηηποσότηταποσότητα τηςτης HCGHCG στοστο αίµααίµα είναιείναι περισσότερηπερισσότερη. .

ΑυτόΑυτό οφείλεταιοφείλεται στοστο φαινόµενοφαινόµενο τουτου down regulation down regulation πουπου προκαλείταιπροκαλείται απόαπό τηντην ορµόνηορµόνη στουςστους υποδοχείςυποδοχείςµέσωµέσω τωντων οποίωνοποίων δραδρα. .

Possible MechanismPossible Mechanism

In women with” low copies” of hCG R in the lymphocytes of blood samples, the level of hCGin the blood was probably higher.

This is due to the This is due to the ““down regulationdown regulation”” mechanism mechanism that is caused by the effect of the hormone on that is caused by the effect of the hormone on the receptors. the receptors.

ΑπόΑπό αυτήναυτήν τηντην πειραµατικήπειραµατική µελέτηµελέτη, , φαίνεταιφαίνεται ότιότι ηηπροσθήκηπροσθήκη hCGhCG στοστο short short πρωτόκολλοπρωτόκολλο ββελτιώνειελτιώνει ττααποσοστάποσοστά ωοθυλακιορρηξίαςωοθυλακιορρηξίας..

ΠαραµένειΠαραµένει νανα διευκρινιστείδιευκρινιστεί, , µεµε τιςτις διαδοχικέςδιαδοχικέςµετρήσειςµετρήσεις τηςτης ορµόνηςορµόνης στοστο αίµααίµα κατάκατά τητη διάρκειαδιάρκειατηςτης πρόκλησηςπρόκλησης ωοθυλακιορρηξίαςωοθυλακιορρηξίας, , πποιαοια ποσότηταποσότηταHCGHCG στοστο αίµααίµα σχετίζεταισχετίζεται µεµε τοντον ιδανικόιδανικό αριθµόαριθµόυποδοχέωνυποδοχέων HCGHCG. .

From this pilot study, it seems that the addition From this pilot study, it seems that the addition of of hCGhCG in the short protocol helps to improve in the short protocol helps to improve the ovulation profile. the ovulation profile.

It remains to be clarified, with the successive It remains to be clarified, with the successive measurements of hormone in the blood during measurements of hormone in the blood during ovulation induction, which range of ovulation induction, which range of hCGhCG in the in the blood relates with the optimum number of blood relates with the optimum number of receptors.receptors.

Demographic Data Demographic Data rLHrLH

GROUP

22 88,0 88,03 12,0 100,0

25 100,0

LowHighTotal

ValidFrequency Valid Percent

CumulativePercent

Demographic Data rDemographic Data r--LHLH

25

Age (y) 37,52± 2.18

FSH (mIU/mL) 8,70 ± 3,55

LH (mIU/mL) 6.77± 3.40

PRL (ng/mL) 11.73 ± 4.83

Years infertility (1-17)

Stimulation days 11.48 ± 1.41

No. of follicles 5.68 ± 2,05

Mature oocytes 0.71 ± 0.23

Fertilization Rate 0.68 ± 0.18

Biological and clinical characteristics rBiological and clinical characteristics r--LHLH

Low copies #22 High copies #3

Age (y) 37.64 ± 2.30 36,67 ± 0.57

FSH (mIU/ mL) 8.82 ± 3.54 7.83± 1.35

LH (mIU/ mL) 6,82 ± 3.57 6.82 ± 2,09

PRL(ng/ml) 12.18 ± 4.70 12,18 ± 4,70


4396.59 ± 1129.48 3858.33 ± 1385.71


1415.52 ± 1498.15 1428.00 ± 886,32

Days of stimulation 11.50± 1.50 11,33 ± 0,77

Follicles (#) 5.82 ± 3.06 4,67 ± 2,00

Mature oocytes 0,69 ± 0,23 0,83 ± 0,28

Fertilization Rate 0.66 ± 0,16 0.83 ± 0.28

Endometrium thickness > 8mm 81,8% >8mm 66.7%

Pregnancies (%) 9,1 -

Low copies #22 r -LH

High copies #3r-LH

Low copies #19hCG

High copies #12hCG

Age (y) 37.64 ± 2.30 36,67 ± 0.57 35,8 ± 4,71 37,00 ± 4,97

FSH (mIU/ mL) 8.82 ± 3.54 7.83± 1.35 7,94 ± 2,50 9,06 ± 4,26

LH (mIU/ mL) 6,82 ± 3.57 6.82 ± 2,09 6,25 ± 2,14 5,87 ± 2,72

PRL(ng/ml) 12.18 ± 4.70 12,18 ± 4,70 13,25 ± 7,04 10,85 ± 4,39


4396.59 ±1129.48

3858.33 ±1385.71

2944,74 ±1221,8

2812.50 ±1274,5


1415.52 ±1498.15

1428.00 ±886,32

1711,68 ±1117,7

1534.09 ± 684,3

Days of stimulation

11.50± 1.50 11,33 ± 0,77 11.05 ± 2,12 10,83 ± 2,16

Follicles (#) 5.82 ± 3.06 4,67 ± 2,00 7,42 ± 2,29 6,27 ± 2,00

Mature oocytes 0,69 ± 0,23 0,83 ± 0,28 0,74 ± 0,15 0,67 ± 0,14

Fertilization Rate %

66 83 74 72

Endometriumthickness

> 8mm 81,8% >8mm 66.7% > 8mm 89,5% >8mm 70%

Pregnancies (%) 9,1 - 26,3 27,3

Low copies Low copies hCGhCG#19#19

Low copies r LHLow copies r LH#22#22

Age (y) 36.44 36.44 ± 4.03 37.64 37.64 ± 2.302.30

FSH (mIU/ mL) 8.03 8.03 ± 2.562.56 8.81 8.81 ± 3.543.54

LH (mIU/ mL) 6.25 6.25 ± 2.142.14 6.82 6.82 ± 3.573.57

PRL(ng/ml) 13.25 13.25 ± 7.257.25 12.18 12.18 ± 4.704.70


2944 2944 ± 12211221 4936 4936 ± 1129 1129 0.0010.001


1723 1723 ± 11481148 1415 1415 ± 14981498

Days of stimulation 11.06 11.06 ± 4.764.76 11.5 11.5 ± 1.501.50

Follicles (#) 7.42 7.42 ± 2.292.29 5.86 5.86 ± 3.063.06

# of oocytes 6.62 6.62 ± 2.292.29 4.82 4.82 ± 3.063.06 0.0280.028

Mature oocytes 0.73 0.73 ± 0.150.15 0.69 0.69 ± 0.230.23

Fertilization Rate % 75 75 6666 0.0220.022

Endometrium thickness 89.589.5 81.8 81.8

Pregnancies (%) 26.326.3 9.19.1

ProtocolProtocol

33rdrd –– 66thth DayDayof cycleof cycle

GnRH ‐ 15 DAYS hCGhCG –– 7 Days7 Days

EE2 2 40 pg/ml40 pg/ml

Control Control –– 7 Days7 DayscDNAcDNA copiescopies

cDNA copiescDNAcDNA copiescopiescDNA copiescDNAcDNA copiescopies

rFSH

cDNA copiescDNAcDNA copiescopies

hCGhCG hCGhCG + 1 Day+ 1 Day

Demographic profile of patientsDemographic profile of patients(medians (medians ±± S.D.)S.D.)


ControlControl

Group BGroup Bn=19n=19hCGhCG

PP

Age (years)Age (years) 32 32 ±± 3.393.39 33 33 ±± 3.123.12 N/SN/S

Duration of infertility Duration of infertility (Years)(Years) 5 5 ±± 3.153.15 5 5 ±± 3.553.55 N/SN/S

Weight (Weight (KgsKgs)) 66.5 66.5 ±± 17.317.3 65 65 ±± 13.413.4 N/SN/S

Height (cm)Height (cm) 161 161 ±± 7.87.8 163 163 ±± 55 N/SN/S

FSHFSH 6.2 6.2 ±± 1.71.7 7.2 7.2 ±± 2.82.8 N/SN/S

LHLH 4.7 4.7 ±± 2.62.6 4.3 4.3 ±± 3.83.8 N/SN/S

PRLPRL 9.8 9.8 ±± 4.24.2 10.4 10.4 ±± 7.87.8 N/SN/S

Hormonal profile of patientsHormonal profile of patients(medians (medians ±± S.D.)S.D.)

Group AGroup AControlControl

Group BGroup BhCGhCG

PP

Serum E2 on Day 1 of FSH Serum E2 on Day 1 of FSH administration (pg/ml)administration (pg/ml) 183 183 ±± 171.8171.8 213 213 ±± 206.5206.5 N/SN/S

Serum E2 on the day of Serum E2 on the day of hCGhCGadministration (pg/ml)administration (pg/ml) 1800 1800 ±± 813.6813.6 1356 1356 ±± 1041.41041.4 N/SN/S

Total dose (IU)Total dose (IU) 3200 3200 ±± 896.4896.4 3800 3800 ±± 1095.61095.6 N/SN/S

No. of No. of oocytesoocytes 7 7 ±± 3.83.8 8 8 ±± 3.43.4 N/SN/S

Pregnancy rate (%)Pregnancy rate (%) 23.1 %23.1 % 36.8 %36.8 % --

Hormonal profile of patientsHormonal profile of patients(medians)(medians)

Hormonal profileHormonal profile of patientsof patients(medians(medians))

Embryo Embryo –– EndometriumEndometrium QualityQuality



% % OocytesOocytes FertilizedFertilized 88.9 88.9 ±± 19.4 %19.4 % 83.3 83.3 ±± 14.8 %14.8 %

Quality of Quality of EndometriumEndometrium

-- GoodGood 45.6 %45.6 % 64.7 %64.7 %

-- PoorPoor 54.5%54.5% 35.3 %35.3 %

Serum Serum cDNAcDNA copies of copies of hCGhCG(medians (medians ±± S.D.)S.D.)

Group 1 (control) vs. Group 2 (Group 1 (control) vs. Group 2 (hCGhCG))

33rdrd –– 66thth daydayof cycleof cycle

77thth daydayof of hCGhCG admadm..

Day before Day before hCGhCG

OocyteOocytecollectioncollection

Pregnancy Pregnancy RateRate

Group 1 Group 1 –– ControlControl N/DN/D 123 123 ±± 198.3198.3 N/DN/D 103.3 103.3 ±± 279.5279.5 23.1 %23.1 %

Group 2 Group 2 –– hCGhCG 12.3 12.3 ±± 8080 17.3 17.3 ±± 150.5150.5 25.9 25.9 ±± 109109 46.9 46.9 ±± 229.4229.4 36.8%36.8%

Group 2 Group 2 –– Pregnant vs. NonPregnant vs. Non--pregnantpregnant

Group 2 Group 2 –– hCGhCGPregnantPregnant

16.3 16.3 ±± 16.316.3 494.2 494.2 ±± 419.2419.2 114.6 114.6 ±± 111.3111.3 51.6 51.6 ±± 25.125.1 100 %100 %

Group 2 Group 2 –– hCGhCGNonNon--pregnantpregnant

31.7 31.7 ±± 25.825.8 789.7 789.7 ±± 340.2340.2 N/DN/D 714.7 714.7 ±± 300.3300.3 0 %0 %

Serum Serum cDNAcDNA copies of copies of hCGhCG(medians(medians))

Serum Serum cDNAcDNA copies of copies of hCGhCG depending on E2 conc. at depending on E2 conc. at the day of the day of hCGhCG administration administration

(medians (medians ±± S.D.)S.D.)







Control Control -- E2 < 1500 E2 < 1500 pg/mlpg/ml(n=5)(n=5)

N/DN/D 19 19 ±± 57.657.6 N/DN/D 88.8 88.8 ±± 160.4160.4 0 %0 %

hCGhCG -- E2 < 1500 E2 < 1500 pg/mlpg/ml(n=8)(n=8)

12.3 12.3 ±± 103.5103.5 19.7 19.7 ±± 193.2193.2 17.3 17.3 ±± 105.8105.8 92.1 92.1 ±± 273.9273.9 38%38%

Control Control -- E2 > 1500 E2 > 1500 pg/mlpg/ml(n=11)(n=11)

1.8 1.8 ±± 60.760.7 132.5 132.5 ±± 246.1246.1 127.3 127.3 ±± 392.5392.5 288 288 ±± 365.3365.3 27%27%

hCGhCG -- E2 > 1500 E2 > 1500 pg/mlpg/ml(n=8)(n=8)

22.6 22.6 ±± 23.823.8 9.5 9.5 ±± 47.747.7 56 56 ±± 119.4119.4 28.2 28.2 ±± 190.1190.1 50 %50 %

Serum Serum cDNAcDNA copies of copies of hCGhCG depending on E2 conc. at the depending on E2 conc. at the day of day of hCGhCG administration administration

(medians)(medians)

Demographic profile of patientsDemographic profile of patients


ControlControl

Group BGroup Bn=6n=6hCGhCG

PP

Age (years)Age (years) 31.5 31.5 ±± 1.81.8 32 32 ±± 11 N/SN/S

Duration of infertility Duration of infertility (Years)(Years) 5.7 5.7 ±± 1.11.1 7.7 7.7 ±± 1.91.9 N/SN/S

Weight (Weight (KgsKgs)) 63 63 ±± 3.53.5 65.8 65.8 ±± 8.18.1 N/SN/S

Height (cm)Height (cm) 159 159 ±± 2.52.5 160.8 160.8 ±± 2.32.3 N/SN/S

FSHFSH 6.94 6.94 ±± 0.70.7 9.3 9.3 ±± 1.41.4 N/SN/S

LHLH 5.6 5.6 ±± 1.51.5 7.23 7.23 ±± 2.52.5 N/SN/S

PRLPRL 12.6 12.6 ±± 1.91.9 7.4 7.4 ±± 1.61.6 N/SN/S

Hormonal profile of patientsHormonal profile of patients



PP

Serum E2 on Day 1 of FSH Serum E2 on Day 1 of FSH administration (pg/ml)administration (pg/ml) 149.2 149.2 ±± 30.430.4 171.7 171.7 ±± 50.350.3 N/SN/S

Serum E2 on the day of Serum E2 on the day of hCGhCGadministration (pg/ml)administration (pg/ml) 1219 1219 ±± 240.4240.4 1449 1449 ±± 355355 N/SN/S

Serum E2 on Day 1 after Serum E2 on Day 1 after hCGhCGadministration (pg/ml)administration (pg/ml) 1705.7 1705.7 ±± 234.7234.7 1740.2 1740.2 ±± 544.9544.9 N/SN/S

Total dose (IU)Total dose (IU) 3733 3733 ±± 437437 3967 3967 ±± 384384 N/SN/S

No. of No. of oocytesoocytes 9 9 ±± 22 7 7 ±± 11 N/SN/S

FertilizaedFertilizaed oocytesoocytes 6 6 ±± 1.51.5 4 4 ±± 0.50.5 N/SN/S

Pregnancy rate per transfer (%)Pregnancy rate per transfer (%) 16.7 %16.7 % 50 %50 % --

Embryo Embryo –– EndometriumEndometrium QualityQuality



Embryo QualityEmbryo Quality

-- GoodGood 33.3 %33.3 % 67.7 %67.7 %

-- PoorPoor 67 %67 % 33.3 %33.3 %

Quality of Quality of EndometriumEndometrium

-- GoodGood 16.7 %16.7 % 83.3 %83.3 %

-- PoorPoor 83.3%83.3% 16.7 %16.7 %

ProtocolProtocol

Control: Control: 228.5 228.5 ±± 67.767.7 c/c/µµllhCGhCG group: group: 383.1 383.1 ±± 200.4200.4 c/c/µµll

33rdrd –– 66thth DayDayof cycleof cycle

Control : Control : 0.9 0.9 ±± 0.90.9

hCGhCG group: group: 24 24 ±± 14.114.1 c/c/µµll

GnRH ‐ 15 DAYShCGhCG –– 7 Days7 Days

642 642 ±± 250.3250.3 c/c/µµll

EE2 2 40 pg/ml40 pg/ml

Control Control –– 7 Days7 Days134.7134.7±± 4.3 4.3 c/c/µµll

cDNAcDNA copiescopies

cDNA copiescDNAcDNA copiescopiescDNA copiescDNAcDNA copiescopies

rFSHControl: Control: 257 257 ±± 196.6196.6 c/c/µµllhCGhCG group:group:86 86 ±± 3434c/c/µµll

cDNA copiescDNAcDNA copiescopies

hCGhCG hCGhCG + 1 Day+ 1 Day

Serum Serum cDNAcDNA copies of copies of hCGhCG







Group 1 Group 1 –– ControlControl 0.9 0.9 ±± 0.90.9 134.7 134.7 ±± 4.34.3 257 257 ±± 196.6196.6 228.5 228.5 ±± 67.767.7 16.7 %16.7 %

Group 2 Group 2 –– hCGhCG 24 24 ±± 14.114.1 642 642 ±± 250.3250.3 86 86 ±± 3434 383.1 383.1 ±± 200.4200.4 50 %50 %

Group 2 Group 2 –– Pregnant vs. NonPregnant vs. Non--pregnantpregnant

Group 2 Group 2 –– hCGhCGNonNon--PregnantPregnant

16.3 16.3 ±± 16.316.3 494.2 494.2 ±± 419.2419.2 114.6 114.6 ±± 111.3111.3 51.6 51.6 ±± 25.125.10 %0 %

Group 2 Group 2 –– hCGhCGpregnantpregnant

31.7 31.7 ±± 25.825.8 789.7 789.7 ±± 340.2340.2 N/DN/D 714.7 714.7 ±± 300.3300.3 100 %100 %

3η – 6η ηµέρα 7η ηµέρα hCG Πριν την hCG Λήψη Κύηση

Patient 1 2,63 - 57,6 - ναι

Patient 2 - 139 1030 304 όχι

Patient 3 µη ανιχν. - -. - όχι

Patient 4 - 126 197 93,5 όχι

Patient 5 - 139 µη ανιχν. 5940 όχι

Patient 6 µη ανιχν. - µη ανιχν. 288 όχι

2.632.63 135 135 265265 16311631

Patient 1 µη ανιχν. 19,7 84 97 όχι

Patient 2 48,8 1330 166 47,6 όχι

Patient 3 µη ανιχν. 133 93,7 10,2 όχι

Patient 4 82,9 460 - 724 ναι

Patient 5 µη ανιχν. 1470 µη ανιχν. 1230 ναι

Patient 6 12,3 439 - 190Ναι

hCG

Control

ΣΥΜΠΕΡΑΣΜΑΤΑΣΥΜΠΕΡΑΣΜΑΤΑ

•• ΣεΣε αυτήναυτήν τηντην προκαταρκτικήπροκαταρκτική µελέτηµελέτη, , αποδεικνύεταιαποδεικνύεταιότιότι υπάρχειυπάρχει µιαµια τάσητάση οιοι ασθενείςασθενείς νανα παρουσιάπαρουσιάζοζουνυνλίγαλίγα ααντίγραφαντίγραφα cc--DNA (61.3%). DNA (61.3%). ΑυτόΑυτό τοτο γενετικόγενετικόπροφίλπροφίλ δίνειδίνει περισσότεραπερισσότερα ωοωοθυλάκιαθυλάκια καικαι λιγότερλιγότερααανώριµαανώριµα ωωάριαάρια, , ενώενώ ηη E2 E2 είναιείναι υψηλότερυψηλότερηη στστιςιςασθενασθενείςείς µεµε χαµηλάχαµηλά αντίγραφααντίγραφα cc--DNA. DNA.

•• ΕπίσηςΕπίσης ηη FSH FSH τηντην 33ηη ηµέραηµέρα τουτου κύκλουκύκλου ήτανήτανελαφρώςελαφρώς αυξηµένηαυξηµένη στιςστις ασθενείςασθενείς µεµε ππολλάολλάανταντίίγργρααφφαα, , ενώενώ ηη PRL PRL ήτανήταν υψηλότερηυψηλότερη στιςστις ασθενείςασθενείςµεµε λλίίγαγα αντίγραφααντίγραφα cc--DNADNA. .

ΣΧΟΛΙΑΣΧΟΛΙΑ((πολυµορφισµοίπολυµορφισµοί))

•• ΗΗ επίδρασηεπίδραση τωντων πολυµορφισµπολυµορφισµώνών µπορείµπορεί νανα είναιείναι µικρµικρήή. . ΠροκειµένουΠροκειµένου νανα εξασφαλιστείεξασφαλιστεί ηη επίτευξηεπίτευξη µιαµιαςς ευεργετικήευεργετικήςςεπίδρασηεπίδρασηςς, , απαιτείταιαπαιτείται µιαµια σειράσειρά µοριακώνµοριακών τεχνικώντεχνικών κακαθώςθώςκαικαι ηη εξέτασηεξέταση εκατοντάδεκατοντάδωνων χιλιάδχιλιάδωνων πολυµορφισµώνπολυµορφισµών στιςστιςκατάλληλεςκατάλληλες φαινοτυπικέςφαινοτυπικές οµάδεςοµάδες όπωςόπως οιοι ""πτωχέςπτωχέςαπαντήτριεςαπαντήτριες". ".

•• ΗΗ ανάλυσηανάλυση τουτου γονότυπουγονότυπου τωντων ασθενώνασθενών πουπου υποβάλλονταιυποβάλλονται σεσεωοθηκικήωοθηκική διέγερσηδιέγερση θαθα µπορούσεµπορούσε νανα είναιείναι έναένα ελκυστικόελκυστικό««εργαλείοεργαλείο»» γιαγια τηντην εξατοµεξατοµίίκεκευυσσηη ττωνων δόσεωνδόσεων τηςτης FFSH SH σύµφωνασύµφωνα µεµε ττοο γενετικγενετικόό προφίλπροφίλ τωντων ασθενώνασθενών ωςως προςπρος τηντηνωοθηκικήωοθηκική ευαισθησίαευαισθησία. .

ΣΧΟΛΙΑΣΧΟΛΙΑ ((αντίγραφααντίγραφα cDNAcDNA))

•• ΗΗ συχνότητασυχνότητα καικαι ηη κατακατανοµήνοµή τωντων αντιγράφωναντιγράφων cc--DNA DNA ήτανήτανστατιστικώςστατιστικώς διαφορετικδιαφορετικήή µεταξύµεταξύ τωντων οµάδωνοµάδων. .

•• ΤαΤα αποτελέσµατααποτελέσµατα αναδεικνύουναναδεικνύουν τοτο ρόλορόλο τουτου LH/LH/hCGhCG--R R στηνστην έκβασηέκβαση τηςτης διέγερεσηςδιέγερεσης τωντων ωοθηκώνωοθηκών. .

•• ΕντούτοιςΕντούτοις, , ηη σηµασίασηµασία τουτου παράγονταπαράγοντα αυτούαυτού δενδεν είναιείναισαφσαφήςής. . ΤαΤα αντίγραφααντίγραφα cc--DNA DNA τουτου LH/LH/hCGhCG--RR µπορµπορείεί ναναεξαρτώνταιεξαρτώνται καικαι νανα αλληλεπιδρούναλληλεπιδρούν καικαι µεµε άλλουςάλλουςπεριβαλλοντικούςπεριβαλλοντικούς καικαι γενετικούςγενετικούς παράγοντεςπαράγοντες πουπου θαθαµπορούσανµπορούσαν νανα συµβάλσυµβάλλλουνουν στηστη βελτίωσηβελτίωση τατα πρωτπρωτοοκκόόλλλλωνωνπρόκλησηςπρόκλησης ωοωοθυλακιορρηξίαςθυλακιορρηξίας στοστο µέλλονµέλλον..


•• In this preliminary study, it is shown that there is a In this preliminary study, it is shown that there is a tendency for patients to present with the low copies of tendency for patients to present with the low copies of cDNAcDNA (61,3%). This genetic profile gives more follicles (61,3%). This genetic profile gives more follicles and less immature and less immature oocytesoocytes, , while the serum E2 is higherwhile the serum E2 is higherin the low copies of in the low copies of cDNAcDNA patients.patients.

•• Also FSH level on day 3 of menstrual cycle was slightly Also FSH level on day 3 of menstrual cycle was slightly elevated in high copies profiles, while PRL was elevated elevated in high copies profiles, while PRL was elevated in the low copies group.in the low copies group.

Remarks Remarks (polymorphisms)(polymorphisms)

•• The impact of these factors (polymorphisms) may be The impact of these factors (polymorphisms) may be small. In order to ensure that a beneficial effect is small. In order to ensure that a beneficial effect is achieved, an array of molecular tools will be needed and achieved, an array of molecular tools will be needed and hundreds of thousands of polymorphisms must be hundreds of thousands of polymorphisms must be examined in appropriate phenotypic groups such as examined in appropriate phenotypic groups such as ““poor responderpoor responder”” patients. patients.

•• GGenotyping of patients scheduled for ovarian stimulation enotyping of patients scheduled for ovarian stimulation could be an attractive tool to individualize FSH could be an attractive tool to individualize FSH dosdosageageaccording to according to the the geneticgenetic differences in ovarian differences in ovarian sensitivity. sensitivity.

Remarks Remarks ((cDNAcDNA copies)copies)

The frequency and distribution of cDNA copies The frequency and distribution of cDNA copies was significantly different between groups . was significantly different between groups .

The results support a role of LH/ The results support a role of LH/ hCGhCG R in COS R in COS outcome.outcome.

However, the importance of this factor for the However, the importance of this factor for the moment is not clearly established. The c DNA moment is not clearly established. The c DNA copies of LH/copies of LH/hCGhCG R may act in concert with other R may act in concert with other environmental and genetic factors that could environmental and genetic factors that could contribute to improve the ovulation protocols in contribute to improve the ovulation protocols in the future. the future.

ΗΗ προσαρµογήπροσαρµογή τηςτης φαρµακευτικήςφαρµακευτικής αγωγήςαγωγής((πολλαπλήςπολλαπλής ωορρηξίαςωορρηξίας) ) γιαγια κάθεκάθε ασθενήασθενήσύµφωνασύµφωνα µεµε τοτο γενετικόγενετικό τουτουχαρακτηριστικόχαρακτηριστικό µπορείµπορεί νανα είναιείναι ηηπρόκλησηπρόκληση τουτου µέλλοντοςµέλλοντος . .

ΑΑ ΜΑΙΕΥΤΙΚΗΜΑΙΕΥΤΙΚΗ ΚΑΙΚΑΙ ΓΥΝΑΙΚΟΛΟΓΙΚΗΓΥΝΑΙΚΟΛΟΓΙΚΗ ΚΛΙΝΙΚΗΚΛΙΝΙΚΗ ΠΑΝΕΠΙΣΤΗΜΙΟΥΠΑΝΕΠΙΣΤΗΜΙΟΥ ΑΘΗΝΩΝΑΘΗΝΩΝ

∆ΙΕΥΘΥΝΤΗΣ∆ΙΕΥΘΥΝΤΗΣ :: ΚΑΘΗΓΗΤΗΣ Α.ΑΝΤΣΑΚΛΗΣ

ΕΡΓΑΣΤΗΡΙΟΕΡΓΑΣΤΗΡΙΟ ΑΝΑΓΕΝΝΕΤΙΚΗΣΑΝΑΓΕΝΝΕΤΙΚΗΣΙΑΤΡΙΚΗΣΙΑΤΡΙΚΗΣ

ΚΚ..ΣΤΕΦΑΝΙ∆ΗΣΣΤΕΦΑΝΙ∆ΗΣ,,ΚΚ..ΑΝΑΣΤΑΣΙΑ∆ΟΥΑΝΑΣΤΑΣΙΑ∆ΟΥ,,ΒΒ..ΝΤΙΝΟΠΟΥΛΟΥΝΤΙΝΟΠΟΥΛΟΥ..

ΕΡΓΑΣΤΗΡΙΟΕΡΓΑΣΤΗΡΙΟ ΜΟΡΙΑΚΗΣΜΟΡΙΑΚΗΣΒΙΟΛΟΓΙΑΣΒΙΟΛΟΓΙΑΣΕΕ..ΚΙΑΠΕΚΟΥΚΙΑΠΕΚΟΥ..ΠΠ..ΜΠΕΡΕΤΣΟΣΜΠΕΡΕΤΣΟΣ,,ΓΓ..ΚΑΛΟΦΩΛΙΑΣΚΑΛΟΦΩΛΙΑΣ ,,ΘΘ..ΜΑΥΡΕΛΗΜΑΥΡΕΛΗ

Receptors genotype of FSH,LH/hCG are a predictor marker ......• Pharmaco-metabonomic phenotyping...

Documents

Transcript of Receptors genotype of FSH,LH/hCG are a predictor marker ......• Pharmaco-metabonomic phenotyping...