Biochimica et Biophysica Acta 1831 (2013) 1293–1301

Contents lists available at SciVerse ScienceDirect

Biochimica et Biophysica Acta

j ourna l homepage: www.e lsev ie r .com/ locate /bba l ip

Partial deletion of β9 loop in pancreatic lipase-related protein 2 reducesenzyme activity with a larger effect on long acyl chain substrates

Kaouthar Dridi a, Sawsan Amara a, Sofiane Bezzine b, Jorge A. Rodriguez a,1,Frédéric Carrière a,⁎, Hélène Gaussier a,⁎a CNRS-Aix-Marseille Université, Enzymologie Interfaciale et Physiologie de la Lipolyse-UMR 7282, 31 chemin Joseph Aiguier, 13402 Marseille Cedex 20, Franceb Laboratoire de Biochimie et de Génie Enzymatique des Lipases, Ecole Nationale d'Ingénieurs de Sfax, Route Soukra km 4, 3038 Sfax, Tunisia

⁎ Corresponding authors. Tel.: +33 4 91 16 41 34; faE-mail addresses: carriere@imm.cnrs.fr (F. Carrière),

(H. Gaussier).1 Present address: Unidad de Biotecnología Industr

Asistencia en Tecnología y Diseño del Estado de JaliscCol. Colinas de la Normal, 44270 Guadalajara, Mexico.

1388-1981/$ – see front matter © 2013 Elsevier B.V. Allhttp://dx.doi.org/10.1016/j.bbalip.2013.04.010

a b s t r a c t

a r t i c l e i n f o

Article history:Received 30 November 2012Received in revised form 28 March 2013Accepted 16 April 2013Available online 30 April 2013

Keywords:Acyl enzymeEnzyme inhibitionLipase–lipid interactionLipolysisPLRP2Substrate recognition

Structural studies on pancreatic lipase have revealed a complex architecture of surface loops surrounding theenzyme active site and potentially involved in interactions with lipids. Two of them, the lid and β9 loop, ex-pose a large hydrophobic surface and are considered as acyl chain binding sites based on their interactionwith an alkyl phosphonate inhibitor. While the role of the lid in substrate recognition and selectivity hasbeen extensively studied, the implication of β9 loop in acyl chain stabilization remained hypothetical. Thecharacterization of an enzyme with a natural deletion of the lid, guinea pig pancreatic lipase-related protein2 (GPLRP2), suggests however an essential contribution of the β9 loop in the stabilization of the acyl enzymeintermediate formed during the lipolysis reaction. A GPLRP2 mutant with a seven-residue deletion of β9 loop(GPLRP2-Δβ9) was produced and its enzyme activity was measured using various substrates (triglycerides,monoglycerides, galactolipids, phospholipids, vinyl esters) with short, medium and long acyl chains. Whatev-er the substrate tested, GPLRP2-Δβ9 activity is drastically reduced compared to that of wild-type GPLRP2 andthis effect is more pronounced as the length of substrate acyl chain increases. Changes in relative substrateselectivity and stereoselectivity remained however weak. The deletion within β9 loop has also a negativeeffect on the rate of enzyme inhibition by alkyl phosphonates. All these findings indicate that the reducedenzyme turnover observed with GPLRP2-Δβ9 results from a weaker stabilization of the acyl enzyme interme-diate due to a loss of hydrophobic interactions.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

The pancreatic lipase (PL) gene family includes a wide variety oflipolytic enzymes, frommammals to insects, involved in various physi-ological functions such as lipid digestion, lipoprotein metabolism andlipid signaling [1–5]. These enzymes are either highly selective for agiven substrate such as phosphatidylserine-specific phospholipase A1(PS-PLA1) [6] or poorly selective such as pancreatic lipase-related pro-tein 2 (PLRP2). This later enzyme hydrolyzes a wide range of substratesin vitro [7–15] and combines the main lipolytic activities found in thePL family: lipase, phospholipase A1 and galactolipase.

Structural knowledge on this enzyme family was first obtainedfrom the X-ray 3D structures of the classical human pancreatic lipase(HPL) [16,17]. Paradoxically, this enzyme is probably the most

x: +33 4 91 71 58 57.gaussier@imm.cnrs.fr

ial, Centro de Investigación yo A.C., Av. Normalistas #800,

rights reserved.

complex in terms of modular organization and catalytic machinery.It is made of a N-terminal catalytic domain with an α/β hydrolasefold connected with a β-sandwich C-terminal domain structurally re-lated to C2 lipid-binding domains [18]. This later domain is essentialfor the interaction with lipid aggregates but it also provides a bindingsite for colipase, a specific HPL cofactor that allows anchoring the li-pase at the lipid–water interface in the presence of competing amphi-philes [19]. Within the catalytic domain containing a Ser–His–Asptriad, the access to the lipase active site is controlled by a lid thatcan change its conformation, from closed to open, in the presence ofamphiphiles and lipids [17]. The lid opening is tightly linked withstructural rearrangements in the vicinity of the active site and theseconformational changes are essential for creating a functional en-zyme. Co-crystallization of HPL with colipase and substrate analogshas allowed the identification of oxyanion hole residues as well astwo acyl chain binding sites constituted by hydrophobic residuesfrom the lid and from the β9 loop (Fig. 1A) [17,20]. Based on thesefindings, the role of the lid in substrate recognition has been studiedextensively in pancreatic lipase, as well as in several other lipasesshowing this structural feature [21–25]. Within the PL gene family,the discovery of an enzyme with a natural deletion of the lid, theguinea pig PLRP2 (GPLRP2), was very important for improving our

A

C D

Lid β9 loop

β9 loop

HO

O

OO

O

O

BLid β9 loop

sn-2

sn-3or sn-1

sn-1or sn-3

HÖ-Ser152

N-Leu153Phe77-NOxyanion hole

Catalytic serine

Fig. 1. Molecular surface representations of HPL (A), GPLRP2-wt (C) and GPLRP2-Δβ9 (D). Hydrophobic residues are indicated by white surfaces. In panel A, the C11 alkylphosphonate inhibitor co-crystallized with HPL (PDB ID: 1LPB) is displayed. The two conformers interacting with the lid and the β9 loop are shown as red and blue sticks andvan der Waals spheres, respectively. These two conformers are also displayed at the same positions in GPLRP2-wt (C) and GPLRP2-Δβ9 (D), after all 3D models have beensuperimposed based on their α/β hydrolase fold and residues from the catalytic triad. Panel B shows a tentative model for triglyceride docking and hydrolysis within the activesite of HPL. The active site serine (Ser152) as well the oxyanion amino acid residues (Phe77, Leu253) are indicated.

1294 K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

knowledge on the lid function [7]. The characterization of this pancre-atic lipase with a single acyl chain binding site also suggested an es-sential contribution to catalysis of the β9 loop [26]. A model for thehydrolysis of glycerolipids by pancreatic lipases has been proposedin which the β9 loop is involved in the stabilization of the leavingacyl chain at the sn-1 or sn-3 position of triglycerides [20] and atthe sn-1 position of phospholipids and galactolipids [1]. This hypoth-esis remained however unexplored so far.

The extension of the PL gene family members and sequencecomparisons reveal various deletions within the lid and the β9 loop

203 223215213

β9 loop

Fig. 2. Partial sequence alignment of representative enzymes from the pancreatic lipase gen223 in HPL) and the lid domain (residues 237–262 in HPL). Fully conserved amino acid residthe amino acid numbering in HPL is based on Winkler's HPL 3D structure [16]. Abbreviationstein 2; GPLRP2, guinea pig pancreatic related lipase 2; GPLRP2-Δβ9, GPLRP2 mutant with alipase; EL, human endothelial lipase; PS-PLA1, human phosphatidylserine-specific phospholpholipase A1 α; DolmI, phospholipase A1 from the venom of Dolichovespula maculata horn

(Fig. 2), as well as deletion of the C-terminal domain in somecases [1,4,5]. The phospholipase A1 from Dolichovespula maculatavenom (DolmI PLA1) thus presents a large deletion of the lid domain,a deletion of 7 residues in the β9 loop, the entire lack of theC-terminal domain, and shares 40% homology with the N-terminalcatalytic domain of pancreatic lipases [26,27]. DolmI PLA1 wasreported to display a high phospholipase activity and a very lowlipase activity [27]. More recently, similar deletions were observedin new members of the PL family identified from EST libraries oflepidopteran midgut [4,5], such as the LIP12 enzyme from Epiphyas

237 261 263

Lid*

e family. The selected amino acid sequence stretch includes the β9 loop (residues 203–ues are indicated by black boxes. The catalytic triad histidine is indicated by a star. NB:: HPL, classical human pancreatic lipase; HPLRP2, human pancreatic lipase-related pro-7-residue deletion in the β9 loop; LPL, human lipoprotein lipase; HL, human hepatic

ipase A1; mPA-PLA1α, human membrane-associated phosphatidic acid-selective phos-et; EpLIP12, a representative lepidopteran lipase from Epiphyas postvittana.

1295K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

postvittana (EpLIP12; Table 2). These enzymes have not been charac-terized so far but high galactolipase and phospholipase activities weremeasured from the midgut of E. postvittana, larva, a folivore lepidop-teran [28]. More generally, the combined deletions within the lid andthe β9 loop increase the accessibility and the hydrophilicity of the ac-tive site and are associated with a substrate preference for lipids withlarge polar heads rather than for triglycerides [29]. The role of surfaceloops in the substrate specificity of PS-PLA1 and membrane-associated phosphatidic acid-selective PLA1α (mPA-PLA1α) was in-vestigated by exchanging their lid, β5 and β9 loops in various mu-tants expressed in HEK293 cells [30]. Results obtained with secretedmutants suggest a critical role of the β5 loop in substrate selectivity.However, no conclusions on the role of the β9 loop could be drawnbecause most of the corresponding mutants were exclusivelydetected inside the producing cells and their activity was not exam-ined. Very recently, a previously unreported heterozygous missensemutation (D207H) of the β9 loop of mPA-PLA1α was identified andassociated with autosomal recessive wooly hair with associatedhypotrichosis [31]. The D207H mPA-PLA1α mutant was produced inHEK293 cells and its activity on phosphatidic acid was found to bemarkedly reduced compared to that of wild-type mPA-PLA1α. Theseresults support a crucial role of the β9 loop in enzyme activity.

The present study was dedicated to a better understanding of β9loop role in substrate recognition, enzyme activity and selectivity.GPLRP2 was chosen as a template for designing a β9 loop mutantbased on the deletions observed in DolmI and EpLIP12. This mutantwas produced using the baculovirus expression system, purified andbiochemically characterized by measuring its enzyme activities onvarious substrates (triglycerides, monoglycerides, galactolipids, phos-pholipids, vinyl esters) with short, medium and long acyl chains.These activities, as well as inhibition by alkyl phosphonates andstereoselectivity were compared to those of the wild type GPLRP2.

2. Materials and methods

2.1. DNA sources and preparation procedures

GPLRP2 cDNA was obtained from the total mRNA isolated fromguinea pig pancreas as previously described by Hjorth et al. [7]. A1579 bp DNA fragment including the complete coding sequencewas inserted into the Xba I site of the pcDV 1 vector. Plasmid DNAswere isolated from Escherichia coli cell cultures using the alkalinelysis procedure followed by phenol/chloroform extraction [32]. Plas-mids, including the baculovirus transfer vector pVL1393 used forinsect cell co-transfection, were purified using the Wizard® PlusMidipreps DNA Purification System (Promega). Restriction enzymedigestion and ligation steps were performed with T4 DNA ligase asrecommended by the enzyme suppliers. Plasmid DNAs were intro-duced into E. coli (ElectroMAX DH10B cells, Life Technologies,Gaithersburg, MD) by electroporation using a gene pulser (Bio-Rad).DNA sequencing was carried out by Genome Express (Grenoble,France).

2.1.1. Site-directed mutagenesis by PCRTheβ9 loopmutationwas performed using the PCR overlap extension

technique [33] with internal oligonucleotides carrying the specific muta-tion, and two external oligonucleotides corresponding to the 5′ and 3′ends of GPLRP2 cDNA, respectively. PCR reactions were carried outusing pfu DNA polymerase (Stratagene). PCR 1 was carried out usingGPLRP2 cDNA in pcDV1 (1579bpXba I insert) as template and the follow-ing primer pair: FrC#118 CCGGAATTCCATGATGCTGTTTGCGTGC (Forward;EcoRI site underlined) and FrC#65 CATTCCAAAACCGATATCTGTGTGAATCACATCC (Reverse; EcoRV site underlined), for 25 cycles of 1 minat 94 °C, 2 min at 50 °C, and 3 min at 72 °C. PCR 2 was carried outusing GPLRP2 cDNA in pcDV1 as template and primers FrC#64ACAGATATCGGTTTTGGAATGAGCCAAAAG (Forward; EcoRV site underlined)

and FrC#63 GGAAGATCTTTTAACAAGGGGAAAGGG (Reverse; BglII siteunderlined), for 25 cycles of 1 min at 94 °C, 2 min at 50 °C, and 3 minat 72 °C. PCR 3 was carried out using the purified products of PCR 1 andPCR 2 as templates, and primers FrC#118 and FrC#63 for 30 cycles of1 min at 94 °C, 2 min at 50 °C, and 3 min at 72 °C. Primers FrC#118and FrC#63 were designed for introducing EcoRI and BglII sites at the 5′and 3′ ends, respectively. The product of PCR 3 (GPLRP2-Δβ9 DNA) wascloned into the EcoRI and BglII sites of the pVL1393 baculovirus transfervector (Invitrogen, San Diego, CA).

2.2. Production of GPLRP2-Δβ9 using the baculovirus expression system

The production of GPLRP2-Δβ9 mutant in insect cells wasperformed as previously described for other pancreatic lipases [34,35].The pVL1393 transfer vector containing GPLRP2-Δβ9 DNA was usedfor the co-transfection of Sf9 cells (Spodoptera frugiperda) with the lin-earized genomic DNA from Autographa californica virus (AcMNPV DNAfrom the BaculoGold Transfection Kit, Pharmingen). The Sf9 cellswere grown in monolayers at 27 °C in tissue culture flasks, usingTNM-FH medium (Sigma) supplemented with 10% fetal calf serum(Bio-Wittaker) and 1% of an antibiotic–antimycotic solution (GibcoBRL-Life Technologies). Recombinant viruses were collected after6 days of growth in transfected insect cells and were amplified by twoadditional Sf9 cell infection cycles. The titers of the viral stocks wereassessed from the formation of plaques on insect cell monolayers andexpressed as plaque-forming units (pfu). The titer of the viral stockused for the production of GPLRP2-Δβ9 was 107 pfu/mL. To ensurethat the recombinant virus containedGPLRP2-Δβ9DNA, the virus geno-mic DNA was purified and subjected to PCR with reverse and forwardprimer specific to GPLRP2-Δβ9 DNA (data not shown).

The GPLRP2-Δβ9 mutant was produced in High-Five™ cellsforming monolayers in 175 cm2 culture flasks containing Excell 400serum-free culture medium (JRH-Bioscience). The recombinantvirus produced in Sf9 cells was added to the High-Five™ cells at amultiplicity of infection of 2 pfu per cell. After 6 h of incubation, theculture supernatant was removed and replaced by fresh Excell 400medium. The culture medium was then sampled every day for5 days in order to measure the lipase production levels.

2.3. Purification of GPLRP2-Δβ9 mutant

GPLRP2-Δβ9mutant was purified following the one-step procedurereported previously for the purification of human pancreatic lipase(HPL) expressed in insect cells [34]. In order to avoid proteolysisof the recombinant protein due to intracellular proteases releasedinto the medium during cell lysis, the cultures of recombinantbaculovirus-infected Sf9 cells were harvested after 3 days. The cellswere pelleted by centrifugation at 10,000 rpm for 10 min and the su-pernatant was lyophilized during 24 h. The dry material was dissolvedin a few mL of distilled water and dialyzed overnight against a 10 mMMES pH 6.5 buffer. Prior to chromatography, the solution was passedthrough a 0.8 μm Millipore filter. Using FPLC (Pharmacia), cation ex-change chromatography was performed on a Mono S HR 5/5 columnequilibrated in 10 mM MES buffer. After sample injection, a linearNaCl concentration gradient was applied and GPLRP2-Δβ9 was elutedat 100 mMNaCl. The flow rate was adjusted to 1 mL/min and the pres-sure was maintained between 20 and 25 bars. The protein elution pro-file was recorded spectrophotometrically at 280 nm and the lipaseactivity was measured potentiometrically in all fractions collectedusing tributyrin as substrate.

2.4. Production and purification of wild-type (wt) GPLRP2

GPLRP2-wt was produced in Aspergillus oryzae as reportedin Hjorth et al. [7] and according to Christensen et al. [36]. Theprotein secreted into the Aspergillus culture medium was purified to

1296 K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

homogeneity after cationic exchange chromatography on a Mono S HR5/5 column (Pharmacia) and stored in 10 mM MES, 50 mM NaCl,and pH 6.5 buffer. GPLRP2-wt was produced in its mature formand its experimentally determined molecular mass (47,725 ± 9 Da)was found to be close (+48 Da) to the theoretical molecular massdeduced from the polypeptide amino acid sequence (47,677 Da),indicating the absence of glycosylation or other post-translationalmodifications.

2.5. Protein analysis

The GPLRP2-Δβ9 mutant present in the insect cell culture mediumand purification fractions was analyzed by electrophoresis on 12%polyacrylamide gels in the presence of SDS as described by Laemmli[37]. The amino acid compositions of GPLRP2-wt and GPLRP2-Δβ9samples were analyzed as previously described [34] and used for de-termining protein concentrations. Purified proteins were subjected toN-terminal sequence analysis using an Applied Biosystem Model473A gas-phase sequencer and to MALDI-TOF mass spectrometryusing a Voyager DE-RP equipment (Perspective Biosystems Inc.).

2.6. Lipolytic activity measurements

All the enzyme activities of GPLRP2-wt and GPLRP2-Δβ9 mutantwere measured potentiometrically in a thermostated vessel (37 °C) byusing the pH-stat technique (TTT 80 Radiometer, Copenhagen) andthe titration by NaOH of the free fatty acids (FFA) released at a constantpH. Assays with triglycerides, monoglycerides and vinyl esters as sub-strates were performed at pH 7.5 and for those with galactolipids andphospholipids at pH 8.0. The enzyme samples (3–15 μL) were addedwith a calibrated syringe and all assays were preformed in triplicate.For assays with long acyl chain substrates, the low level of free fattyacids (FFA) ionization at pH 7.5 prompted us to perform back titration.After incubating the enzyme with substrate for 3 min at pH 7.5, the pHend-point value was then increased to pH 9 in order to ensure full ion-ization and titration of FFA. Control experiments without any enzymewere performed in order to determine the amounts of NaOH requiredto increase the pH value to pH 9 regardless of the FFA titration. Final re-sults were corrected for the back titration values. The specific activitieswere expressed in international units (U) permilligram of enzyme. OneU corresponds to 1 μmol of fatty acid released per minute.

The hydrolysis rates of emulsified triglycerides and vinyl esterwere measured with a mechanically stirred emulsion of either500 μL tributyrin (TC4), 250 μL trioctanoin (TC8), 5 mL of olive oilemulsified (10% wt/wt) in gum arabic (10% wt/wt) or 100 μL vinylester (vinyl butyrate, VC4; vinyl octanoate, VC8; vinyl palmitate,VC16) in a final volume of 15 mL 1 mM Tris, 150 mM NaCl, 5 mMCaCl2 and 0.5 mM sodium taurodeoxycholate (NaTDC).

The hydrolysis rate of monoglycerides was measured using 100 μLof either monobutyrin (MC4) or monocaprylin (MC8) or monoolein(MC18:1) mechanically stirred in a final volume of 15 mL 1 mMTris, 150 mM NaCl, 5 mM CaCl2 and 4 mM NaTDC. Using NaTDC at aconcentration above its critical micellar concentration ensures theformation of mixed micelles and optimum conditions for measuringlipolytic enzyme activity on monoglycerides. It is worth noticingthat the commercial (Sigma-Aldrich) monoglycerides used in thisstudy are sn-1(3)-monoglycerides.

The hydrolysis of galactolipidswas determined usingmonogalactosyldiacylglycerol (MGDG), mixed with NaTDC in order to form a micellarsubstrate in the reaction mixture. The substrate was either a syntheticmedium-chain fatty acid MGDG (1,2-dioctanoyl 3-monogalactosyl glyc-erol, C8-MGDG) or a natural long chain MGDG extracted and purified(95% purity) from leek (Allium porrum L.). These natural MGDG weregenerously provided by Gattefossé SAS (St Priest, France). They mainlycontained long chain fatty acids, including 48% wt/wt of C18:3. Toprepare the galactolipid dispersion, 25 mg of MGDG (10 mM final

concentration) was mixed with 5 mL of assay solution containing0.33 mM Tris–HCl pH 8, 0.1 M NaCl and 13.33 mM NaTDC and thensubjected to ultrasonic treatment for 6–8 min in a water bath (HF-Frequ35 kHz) [38]. Under these conditions, MGDG forms mixedmicelles withthe bile salts present in the reaction mixture.

The phospholipase activity of GPLRP2-wt and GPLRP2-Δβ9 mutantwas measured on synthetic medium chain (1,2-dioctanoyl phosphati-dylcholine, C8-PC; Sigma Aldrich) and natural long chain(L-α-phosphatidylcholine from egg yolk, Egg PC; Sigma Aldrich) phos-pholipids. To prepare the medium-chain phospholipid substrate,25 mg of C8-PC were mixed with 5 mL of 0.33 mM Tris–HCl pH 8,0.1 M NaCl and 13.33 mM NaTDC and then subjected to ultrasonictreatment for 6–8 min in a water bath (HF-Frequ 35 kHz) [38]. Forthe assays with Egg PC (17 mM final concentration), conditionsconsisted of a mechanically stirred emulsion of 5 mL substrate solution(4 g Egg PC in 100 mL) added to 10 mL 1 mMTris pH 8, 150 mMNaCl,5 mM CaCl2 and 13.33 mM NaTDC. In this case, the substrate wasdispersed in water in the form of mixed phospholipid/bile salt micelles.

2.7. Lipase inhibition

Inhibition studies by methyl arachidonyl fluorophosphonate(MAPF) and C11-alkyl phosphonate were performed at room temper-ature. The kinetics of inactivation were followed by incubation of4.6 μM GPLRP2-wt or GPLRP2-Δβ9 mutant, with MAFP or C11-alkylphosphonate at a lipase to inhibitor molar ratio of 1:1 and 1:20.Stock solutions of MAFP and C11-alkyl phosphonate were preparedin DMSO at concentrations of 0.2 and 10 mM, and stored at −20 °C.In all experiments, the final DMSO concentration never exceeded5%. The residual lipase activity was measured by taking aliquots atdifferent time intervals using the pH-stat technique and TC4 as sub-strate in the presence of 0.5 mM NaTDC.

2.8. Stereoselectivity determination

The lipase stereoselectivity was investigated by analyzing the diglyc-eride enantiomers formed during the lipolysis of the prochiral trioleinsubstrate as described previously [39]. The diglycerides were derivatizedwith 4-nitrophenyl isocyanate to obtain enantiomeric carbamates, whichwere then separated by chiral high-performance liquid chromatography(HPLC) on a CHIRALPAK IB column (Chiral Technologies Europe). Theenantiomeric excess (ee) of 1,2-sn-diolein versus 2,3-sn-diolein wasthen calculated to determine the lipase stereopreference [39]. Beforederivatization, it was checked that no acyl migration had occurred fromthe secondary to primary ester position in the diglycerides formed.

2.9. Structural modeling

Models of GPLRP2-wt and GPLRP2-Δβ9 3D structures were builtusing Swiss-model server [40,41] based on the known X-ray structureof a GPLRP2/HPL chimera (PDB ID: 1GPL) containing the N-terminalcatalytic domain of GPLRP2 and the C-terminal domain of HPL [26].

3. Results

3.1. Construction, expression, purification and structural analysis of theGPLRP2-Δβ9 mutant

A deletion mutant of GPLRP2, called GPLRP2-Δβ9 in this work, wasdesigned by deleting the peptide stretch 207-SPILPSL-213 locatedwith-in the β9 loop based on the sequence alignment of GPLRP2 with DolmIPLA1 and EpLIP12 (Fig. 2). Using GPLRP2 cDNA as a template, the mu-tated DNA was obtained by the polymerase chain reaction overlap ex-tension method [33] and was further subcloned into a baculovirustransfer vector for the production and amplification of a recombinantvirus used as expression vector. GPLRP2-Δβ9 was then produced in

1297K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

insect cells with a yield reaching 40 mg of recombinant protein per literof insect cell suspension cultures. The use of GPLRP2 signal peptideallowed the secretion of GPLRP2-Δβ9 in the culture medium that washarvested at day 3 post-infection in order to avoid any undesirable pro-teolysis upon cell lysis occurring after day 3. Using a serum-free medi-um allowed to purify the secreted GPLRP2-Δβ9 in one step using aMono S Cationic Exchange Chromatography (Fig. 3A). The purified pro-tein was subjected to N-terminal amino acid sequence analysis and thesequence obtained (AEVCYSHL) confirmed that the mutant was pro-duced under its mature form and that GPLRP2 signal peptide wascorrectly cleaved. The 20 first amino acid residues of GPLRP2-Δβ9were identical to those of mature GPLRP2-wt [7].

The molecular mass of GPLRP2-Δβ9 (46,988.45 ± 18.51 Da) wasexperimentally determined by MALDI-TOF analysis (Fig. 3B) and wasshown to be very similar to the theoretical molecular mass of the poly-peptide chain only. This result indicated that the potential glycosylationsite (N334FT) found at the junction between the N and the C-terminaldomains of GPLRP2 was not used. Overall, the detection of a singleamino acid sequence, SDS–PAGE analysis (Fig. 3A) and mass spectrom-etry (Fig. 3B) confirmed the production of a homogeneous preparationof purified GPLRP2-Δβ9 before performing enzyme assays.

3.2. Lipolytic activities of GPLRP2-Δβ9 and wild-type GPLRP2 on varioussubstrates

The specific activities of GPLRP2-wt and its β9 deletionmutant weremeasured on various lipid substrates: triglycerides, monoglycerides,galactolipids, phospholipids and vinyl esters, with short (C4), medium(C8) and long chain fatty acids. In this later case, both synthetic (C18)and natural long chain substrates from olive oil, leek and egg yolkwere used. Both forms of GPLRP2 showed the same order of substratepreference with monoglycerides > galactolipids > vinyl esters >triglycerides > phospholipids (Table 1). Whatever the substrate tested,GPLRP2-Δβ9 showed however much lower specific activities rangingfrom 1.2 to 14.2% of GPLRP2-wt specific activities (Table 1). The highestspecific activity of GPLRP2-Δβ9 (403 ± 46 U/mg on MC4) was thus9.5% of GPLRP2-wt specific activity on the same monoglyceride sub-strate (4242 ± 430 U/mg). The lowest specific activity of GPLRP2-Δβ9(10 ± 9 U/mg on Egg PC) was only 1.2% of GPLRP2-wt specific activityon the same phospholipid substrate (812 ± 100 U/mg). Specific

m

Rel

ativ

e in

ten

sity

(a.

u.)

MW : 46988.45 ± 18.51

Fig. 3. Purification and mass spectrometry analysis of GPLRP2-Δβ9 expressed in baculovirus47 kDa) obtained after a single purification step of cation exchange chromatography on a Ma series of multiple protonated ions, corresponding to an average molecular mass of 46,988

activities on long acyl chain substrates were lower than those on shorteracyl chain substrates for both enzymes (Table 1 and Fig. 4), exceptfor GPLRP2-wt activity on PC. Increasing the acyl chain length fromC4 to C8 and C18 had however a higher impact on the decrease ofGPLRP2-Δβ9 activity than on GPLRP2-wt activity (Fig. 4). The differencebetween GPLRP2-Δβ9 andGPLRP2-wtwas particularly remarkablewithsubstrates bearing a single acyl chain: GPLRP2-Δβ9 activity on mono-glycerides decreased 10.6-fold from C4 to C18 while it was only1.4-fold for GPLRP2-wt (Fig. 4B). Using vinyl esters, enzyme activity de-creased 15.2-fold from C4 to C18 with GPLRP2-Δβ9 and 3.5-fold withGPLRP2-wt (Fig. 4C). It is worth noticing that the specific activities ofGPLRP2 on synthetic vinyl ester substrates were in the same order ofmagnitude as those measured with acylglycerols (Table 1).

Although monoglycerides were found to be a better substrate thanPC for GPLRP2 (Table 1), the β9 loop mutation had similar effects onthe acyl chain length dependence of GPLRP2 activity towards thesetwo substrates. GPLRP2-wt showed 1.3-fold (PC) and 1.5-fold (mono-glycerides) higher activities on the long chain (Egg PC and MC18:1)than on the medium chain (C8-PC and MC8) substrates. With theGPLRP2-Δβ9 mutant, the situation was reversed and activities on me-dium chain substrates were respectively 7.8-fold (PC) and 7.9-fold(monoglycerides) higher than those on long chain substrates.

3.3. Inhibition of GPLRP2-Δβ9 and GPLRP2-wt

The effects of two lipase inhibitors with different chain length(C11-alkyl phosphonate and MAFP (C20)) on GPLRP2-wt andGPLRP2-Δβ9 were tested by measuring residual lipase activity ontributyrin after incubating the enzyme solution with the inhibitor at a1:1 or 1:20 molar ratio (Fig. 5). At a 1:1 enzyme-inhibitor molar ratio,residual activities of GPLRP2-wt and GPLRP2-Δβ9 after 60 min of incu-bation were 55.8 ± 6.3% and 88.4 ± 9.1% with C11-alkyl phosphonate(Fig. 5A) and 60.9 ± 6.3% and 87.5 ± 0%, with MAFP (Fig. 5B), respec-tively. No significant differences between C11-alkyl phosphonate andMAFP were observed under these conditions. Higher inhibition rateswere recorded using a 1:20 enzyme-inhibitor molar ratio (Fig. 5A andB) and half-inhibition times (t1/2) were determined (Table 2). In thiscase, lipase inhibition byMAFPwas 4 to 5-fold faster than that obtainedwith C11-alkyl phosphonate. The inhibition of GPLRP2-Δβ9 was

/z

946743

30

20

14

kDa

Mw GPLRP2Δβ9

AB

-infected insect cells. Panel A: 12% acrylamide SDS–PAGE analysis of the protein (~46–ono S HR/s 5/5 column. Panel B: MALDI-TOF spectrum of purified GPLRP2-Δβ9 showing.45 ± 18.51 Da.

Table 1Specific activities (U/mg) of GPLRP2 and its Δβ9mutant on various substrates using thepH stat technique. Specific assay conditions for each substrate are described in the Ma-terials and methods section. 1 U = 1 μmol of fatty acid released per min. Values aremean ± SD (n = 3).

Substrates GPLRP2-wt GPLRP2-Δβ9

U/mg U/mg % of wt

TC4 2065 ± 89 243 ± 2 11.8TC8 675 ± 43 42 ± 26 6.2Olive oil TG 754 ± 151 44 ± 5 5.8C8-MGDG 3286 ± 857 394 ± 76 12.0Leek MGDG 2435 ± 123 198 ± 17 8.1C8-PC 551 ± 50 78 ± 34 14.2Egg PC 812 ± 100 10 ± 9 1.2MC4 4242 ± 430 403 ± 46 9.5MC8 2440 ± 372 300 ± 15 12.3MC18:1 3130 ± 301 38 ± 18 1.2VC4 2841 ± 531 258 ± 52 9.1VC8 2884 ± 696 99 ± 7 3.4VC16 812 ± 181 17 ± 6 2.1

1298 K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

however found to be 3.3 to 4-fold slower than that of GPLRP2-wt withC11-alkyl phosphonate and MAFP, respectively.

3.4. Stereoselectivity of GPLRP2-Δβ9 and GPLRP2-wt

The effect of β9 loop deletion on GPLRP2 stereoselectivity wastested by measuring the enantiomeric excess of 1,2-sn-diolein vs.2,3-sn-diolein (ee, %) generated upon the hydrolysis of the prochiralsubstrate triolein. It was checked that no 1,3-sn-diolein was generat-ed during the reaction. The lipolysis reactions were stopped at lowhydrolysis level (7.00 ± 2.83% for GPLRP2-wt and 7.96 ± 3.46% forGPLRP2-Δβ9, respectively) to make sure that the measured ee mainlyreflects the conversion of triglycerides into diglycerides. GPLRP2-Δβ9was found to be more stereoselective than GPLRP2-wt, exhibiting eeof 3.26 ± 0.71% and 1.12 ± 0.51%, respectively. These values indicatethat GPLRP2 is not a highly stereoselective lipase towards triolein butthe change in the stereoselectivity resulting from the β9 loop deletionwas found to be significant (P b 0.001; n = 8; Student's t test).

4. Discussion

4.1. Hypothesis on the role of the β9 loop

Structure resolution ofHPL co-crystallizedwith C11 alkylphosphonateallowed the assignment of residues involved in the stabilization of the

Acyl chain length

0

25

50

75

100

% o

f sp

ecif

ic a

ctiv

ity

on

C4

sub

stra

te

GPLRP2-wt

GPLRP2-Δβ9

A: Triglycerides B: Monoglycerid

4 8 18 4 8

Fig. 4. Variations with the acyl chain length in the activities of GPLRP2-wt and GPLRP2 Δβ9 ostrate class, activities are expressed as % of the specific activity measured with the C4 subs

inhibitor alkyl chain on either the lid domain or the β9 loop (Fig. 1A)[20] and supported the location of the two acyl binding sites, primarilyidentified by van Tilbeurgh et al. [17]. Other studies on GPLRP2, a pan-creatic lipase with a natural lid deletion, and HPL lid mutagenesishave confirmed the involvement of the lid in catalysis and substratespecificity [7,21]. The contribution of the β9 loop was not investigatedto the same extent although sequence alignmentswithin the pancreaticlipase gene family revealed that several members had various deletionswithin the β9 loop (Fig. 2) while displaying distinct substrate specific-ities [1,4]. The HPL β9 loop was found to interact with the alkyl chainof the C11-phosphonate inhibitor via hydrophobic contacts with bothresidues L213 and F215, which are probably involved in acyl chain sta-bilization during the hydrolysis of acylglycerols. It was shown that thisloop adopts the same conformation in the open (presence of inhibitor)and closed (no inhibitor) 3D structures of HPL [16,17,20]. This confor-mation of the β9 loop was stabilized by either interactions with the in-hibitor alkyl chain or by van der Waals interactions of β9 loop residues(I209, V210, L213, F215) with residues from the closed lid (L242, V246,I248, I251, W252, F258, A260). In both cases, X-ray crystallography re-vealed a well defined electron density for the β9 loop.

The X-ray structure of a GPLRP2/HPL chimera [26] revealed thatthe lid deletion in GPLRP2 (Fig. 2) provides a larger access to the en-zyme active site while suppressing one alkyl chain binding site iden-tified in HPL co-crystallized with C11 alkylphosphonate (Fig. 1A andC). Some hydrophobic residues lining the active site crevice of HPL(Y114, P180, I209, P211, L213, F215) are however conserved inGPLRP2 with the exception of V210 which is replaced by a leucinein GPLRP2. Most of these residues belong to the β9 loop (residues203 to 223; see Fig. 2) and therefore to the second alkyl chain bindingsite identified in HPL. One important feature of the GPLRP2/HPL chi-mera X-ray structure, compared to HPL, is however the absence ofelectron density for the distal part of the β9 loop [26]. In the absenceof the lid and inhibitors, this loop makes no contact with the proteincore and appears to be disordered. The β9 loop of GPLRP2-wtdisplayed in Fig. 1C was therefore modeled based on its sequence ho-mology with the β9 loop of HPL (Fig. 2) and the known conformationof this later (Fig. 1A). Together with the conserved residues formingthe oxyanion hole (F77, L153), the hydrophobic residues of the β9loop were suspected to stabilize the substrate acyl chain in the firsttetrahedral intermediate of ester bond hydrolysis by HPL, as well asthe acyl–enzyme intermediate formed during the reaction. By analo-gy with the known mechanism of action of chymotrypsin, the hydro-phobic interactions provided by the β9 loop residues could play amajor role in lowering substrate entropy and free energy of activa-tion, and thus in enzymatic rate enhancement. The prevalence of

(carbon number)

es C: Vinylesters

18 4 8 180

25

50

75

100

n triglycerides (A), monoglycerides (B) and vinyl esters (C). For each enzyme and sub-trate.

A: inhibition by C11 alkylphosphonate

0

20

40

60

80

100

Time (min)

Res

idu

al li

pas

e ac

tivi

ty (

%)

B: inhibition by MAFP

0

20

40

60

80

100

0 10 20 30 40 50 60 0 10 20 30 40 50 60

1:1

1:20

GPLRP2-wtGPLRP2-Δβ9GPLRP2-wtGPLRP2-Δβ9

Enzymeto inhibitormolar ratio

Fig. 5. Residual lipase activity of GPLRP2-wt and GPLRP2-Δβ9 upon their incubation with C11-alkyl phosphonate (A) andmethyl arachidonyl fluorophosphonate (MAFP) (B). Lipaseactivity was determined using tributyrin as substrate and the pH-stat technique. Enzyme to inhibitor molar ratio of 1:1 (triangles) and 1:20 (squares) were tested.

1299K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

the β9 loop versus the lid for the stabilization of the acyl–enzyme in-termediate was further supported by the observation of large dele-tions within the lid sequence of several members of the pancreaticlipase gene family (Fig. 2) and thus, the suppression of the corre-sponding alkyl chain binding site in these enzymes. A model for thedocking of a triacylglycerol substrate molecule within the lipase ac-tive site and the subsequent ester bond hydrolysis can be proposed(Fig. 1B) based on HPL and GPLRP2 structural studies, and the obser-vation that pancreatic lipase is a sn-1,3-regioselective lipase hydro-lyzing only ester bonds of primary alcohols in acylglycerols with arather low stereo-discrimination of the sn-1 and sn-3 positions [39].The hypothesis can be made that the sn-1 (or sn-3) acyl chain is sta-bilized by the β9 loop while the sn-3 (or sn-1) acyl chain runs alongthe lid and the sn-2 acyl chain occupies a central position in the cata-lytic crevice and could be still in contact with the water–lipid inter-face (Fig. 1B). The acyl chain stabilized by the β9 loop is the leavingone after the nucleophilic attack of the ester function by the hydroxylgroup of the catalytic serine residue (S152 in HPL), the formation of afirst tetrahedral intermediate stabilized by the oxyanion hole (F77,L153 in HPL), the departure of the alcohol moiety (diacylglycerol)and the formation of the acyl–enzyme intermediate before furtherhydrolysis.

4.2. Partial deletion of the β9 loop results in lower enzyme activities

It appeared however that part of the β9 loop could also be deleted inseveral pancreatic lipase-related enzymes such as the hornet DolmIPLA1 [27], PS-PLA1 [6], mPA-PLA1α [29] and more recently the newmembers identified in lepidopterans [5], such as EpLIP12 (Fig. 2).While the key hydrophobic residue corresponding to F215 in HPL is

Table 2Half-inhibition times (min) estimated from the residual activities of GPLRP2-wt andGPLRP2-Δβ9 upon their incubation with C11-alkyl phosphonate and MAFP, at an en-zyme to inhibitor molar ratio of 1:20. Half inhibition times were estimated manuallyfrom the data displayed in Fig. 5.

C11-alkyl phosphonate MAFP

GPLRP2-wt 5 1GPLRP2-Δβ9 16.5 4Δβ9 to wt ratio 3.3 4

conserved in most enzymes, except in EpLIP12, the hydrophobic tip ofthe β9 loop is deleted in PS-PLA1, mPA-PLA1α, DolmI and EpLIP12.This part of the β9 loop includes the L213 residue important for theC11 alkyl chain stabilization in HPL, and other hydrophobic residues(P208, I209, V210, P211) thatmight bemore important for the stabiliza-tion of longer alkyl chains as suggested in themodel depicted in Fig. 1B.This hypothesis was investigated in the present study by deleting thepeptide stretch 207-SPILPSL-213 of the β9 loop based on the deletionsobserved in both DolmI PLA1 and EpLIP12 (Fig. 2). GPLRP2 was chosenas a target enzyme because it contains only one acyl chain binding siteconstituted by the β9 loop and it hydrolyzes a large range of substratesbearing either three (triglycerides), two (phospholipids, galactolipids)or one (monoglycerides) acyl chain esterified onto the glycerol back-bone, as well as various polar heads at the sn-3 position. TheGPLRP2-Δβ9 deletion mutant produced by site-directed mutagenesisand expression in insect cells was thus an interesting tool to reach a bet-ter understanding on substrate stabilization and selectivity within thepancreatic lipase gene family.

The available X-ray structure of the GPLRP2/HPL chimera allowedmodeling GPLRP2-Δβ9 (Fig. 1D) and its comparison with GPLRP2-wt(Fig. 1C) and open HPL (Fig. 1A) 3D structures. The shorter β9 loop ofGPLRP2-Δβ9 shows a clear hydrophilic pattern due to the deletion ofseven, mostly hydrophobic, residues. The shortening of the β9 loop inGPLRP2-Δβ9 leads to an increase in active site accessibility (Fig. 1D).The phenylalanine residue of GPLRP2-Δβ9 corresponding to F215 inHPL remains superimposed with this residue in both HPL and GPLRP2,supporting the hypothesis that an aromatic or a hydrophobic (I, V, L) res-idue at this position is instrumental in the acyl chain stabilization [26].

Whatever the substrate tested, the enzyme activity of GPLRP2-Δβ9was drastically reduced compared to that of GPLRP2-wt (Table 1),supporting the hypothesis that the β9 loop plays a critical role in catal-ysis. One cannot exclude that the reduced activity of GPLRP2-Δβ9mightresult from conformational changes in the proximity of the mutationand the active site residues. Comparison of the 3D structures of HPL[17,20], GPLRP2-HPL chimera [26] andHPLRP2 [42] has shownhoweverthat the β9 loop ismobile and can adopt various conformationswithoutaffecting the geometry of the active site, with a complete superimposi-tion of the catalytic triad and oxyanion hole residues of open HPL,GPLRP2-HPL chimera and HPLRP2.

The β9 loop deletion had similar effects on the hydrolysis of allacylglycerol substrates, including PC and sn-1(3)-monoglycerides.

1300 K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

Since these substrates only share the glycerol backbone and one acylchain esterified at sn-1 position as common structural features, ourfindings indicate first a role of the β9 loop in the recognition of themonoacylglycerol motif. The additional results obtained with syn-thetic monoesters bearing a different alcohol group (e.g., vinyl esters)further suggest that the β9 loop is involved in the recognition of theacyl chain of the ester substrate. Some changes in the relative sub-strate selectivity of GPLRP2-Δβ9 versus that of GPLRP2-wt were ob-served but they remained rather weak with a maximum increase ofabout 2-fold for the phospholipase to triglyceride lipase activityratio (2.28-fold), the galactolipase to triglyceride lipase activity ratio(1.93-fold) and the monoglyceride to triglyceride lipase activityratio (1.98-fold) using C8 substrates. The effect of the β9 loop dele-tion on GPLRP2 stereoselectivity towards the prochiral triolein sub-strate was also found to be moderate.

4.3. Partial deletion of the β9 loop decreases the affinity for long acylchain substrates and alkyl phosphonate inhibitors

The role of the β9 loop in the stabilization of the substrate acyl chainwas further supported by the results obtainedwith substrates of variouschain lengths. As often observed with lipolytic enzymes, specific activi-ties of GPLRP2-wt and GPLRP2-Δβ9 decreased when the acyl chainlength was increased, but this phenomenon was amplified inGPLRP2-Δβ9 (Table 1 and Fig. 4). It is usually assumed that the affinityof the substrate for lipase active site results from a compromise be-tween steric hindrance and stabilizing interactions occurring betweenacyl chains and the enzyme. This is illustrated in the present work bythe kinetic properties of GPLRP2-wt. Substituting short (C4) by long(C18 and natural substrates) acyl chain results in a 63% drop in lipaseactivity on triglycerides (754 ± 151 vs. 2065 ± 89 U/mg) while theactivity on monoglycerides is only reduced by 26% (3130 ± 301 vs.4242 ± 430 U/mg). In GPLRP2-Δβ9, the steric hindrance is less impor-tant because of the partial deletion of the β9 loop (Fig. 1D), but the ac-tivities on triglycerides and monoglycerides are reduced by 82% and91%, respectively, when short acyl chains are replaced by long ones. Itis therefore obvious that the peptide stretch 207-SPILPSL-213 plays arole in the stabilization of long acyl chains. This finding is particularlyremarkablewith substrates bearing a single acyl chain likemonoglycer-ides and vinyl esters, supporting the hypothesis that the acyl chainbinding site provided by the β9 loop is instrumental in the stabilizationof the acyl–enzyme intermediate (Fig. 1B).

The role of the β9 loop was further supported by the inhibitiontests performed with the alkyl phosphonate inhibitor bearing a singleC11 alkyl chain. Using this type of inhibitor allows mimicking the firsttetrahedral intermediate generated during the enzymatic hydrolysisof fatty acid esters and it is assumed that the inhibitor alkyl chain oc-cupies the same position as the fatty acid in the lipase active site. Thedeletion within the β9 loop should therefore also affect the lipase–inhibitor interactions and the rate of inhibition. This hypothesis wasconfirmed by measuring a lower rate of GPLRP2-Δβ9 inhibition byC11-alkyl phosphonate compared to that of GPLRP2-wt (Fig. 5;Table 2). MAFP, a phosphonate inhibitor with a longer hydrocarbonchain (C20), was also tested after it was recently shown to be an in-hibitor of PLRP2 [43]. GPLRP2 inhibition by MAFP was 5-fold more ef-ficient than that observed with C11-alkyl phosphonate (Fig. 5;Table 2), but again the inhibition of GPLRP2-Δβ9 was weaker. Therate of GPLRP2 inhibition therefore increased with the inhibitoralkyl chain length, probably due to additional hydrophobic interac-tions, but decreased when a part of the β9 loop was deleted. Thehigher inhibition by MAFP versus C11-alkyl phosphonate might alsoresult from the insaturations (4 double bonds) present on the C20arachidonyl chain of MAFP and resulting conformations with moreaffinity for the lipase active site than the linear saturated chainof C11-alkyl phosphonate. However, the respective effects of alkyl

chain length and insaturations could not be tested separately in thisstudy.

In conclusion, this study confirmed the previous hypothesis raisedfrom the structural characterization of pancreatic lipase and relatedenzymes: the β9 loop is essential for stabilizing the leaving acylchain in the course of the lipolysis reaction. It also plays an importantrole in the lipase interaction with lipophilic inhibitors and has to betaken into account for the design of future lipase inhibitors with in-creased efficacy.

Acknowledgements

The authors would like to thank Dr. Régine Lebrun, Rémi Puppo andSabrina Lignon (IBiSa proteomics platform of the Institut deMicrobiologie de la Méditerranée, Marseille, France) for their technicalsupport during the mass spectrometry experiments and Mrs. FrancineFerrato for her technical assistance during the purification procedures.We are grateful to Magali Arnaud and Jean-David Rodier (GattefosséSAS, St Priest, France) for providing purified MGDG from leek. Thiswork received the financial support of Agence Nationale de la Recherchein the framework of the GALACTOLIPASE project (ANR-09-CP2D-06-01)and the LISA Carnot Institute (ANR-07-CARN-009-01). The PhD thesis ofMrs. Kaouthar Dridi was supported by a fellowship from the FrenchMinistry of Research and Education.

References

[1] F. Carrière, C. Withers-Martinez, H. van Tilbeurgh, A. Roussel, C. Cambillau, R.Verger, Structural basis for the substrate selectivity of pancreatic lipases andsome related proteins, Biochim. Biophys. Acta 1376 (1998) 417–432.

[2] J. Aoki, A. Inoue, K. Makide, N. Saiki, H. Arai, Structure and function of extracellu-lar phospholipase A1 belonging to the pancreatic lipase gene family, Biochimie 89(2007) 197–204.

[3] T.G. Kirchgessner, J.C. Chuat, C. Heinzmann, J. Etienne, S. Guilhot, K. Svenson, D.Ameis, C. Pilon, L. d'Auriol, A. Andalibi, M.C. Schotz, F. Galibert, A.J. Lusis, Organi-zation of the human lipoprotein lipase gene and evolution of the lipase genefamily, Proc. Natl. Acad. Sci. U. S. A. 86 (1989) 9647–9651.

[4] I. Horne, V.S. Haritos, J.G. Oakeshott, Comparative and functional genomics oflipases in holometabolous insects, Insect Biochem. Mol. Biol. 39 (2009) 547–567.

[5] J.T. Christeller, J. Poulton, N.M. Markwick, R.M. Simpson, The effect of diet on theexpression of lipase genes in the midgut of the lightbrown apple moth (Epiphyaspostvittana Walker; Tortricidae), Insect Mol. Biol. 19 (2010) 9–25.

[6] T. Sato, J. Aoki, Y. Nagai, N. Dohmae, K. Takio, T. Doi, H. Arai, K. Inoue, Serinephospholipid-specific phospholipase A that is secreted from activated platelets.A new member of the lipase family, J. Biol. Chem. 272 (1997) 2192–2198.

[7] A. Hjorth, F. Carrière, C. Cudrey, H. Wöldike, E. Boel, D.M. Lawson, F. Ferrato, C.Cambillau, G.G. Dodson, L. Thim, R. Verger, A structural domain (the lid) foundin pancreatic lipases is absent in the guinea pig (phospho)lipase, Biochemistry32 (1993) 4702–4707.

[8] K. Thirstrup, R. Verger, F. Carrière, Evidence for a pancreatic lipase subfamily withnew kinetic properties, Biochemistry 33 (1994) 2748–2756.

[9] M.L. Jennens, M.E. Lowe, Rat GP-3 is a pancreatic lipase with kinetic propertiesthat differ from colipase-dependent pancreatic lipase, J. Lipid Res. 36 (1995)2374–2382.

[10] L. Andersson, F. Carrière, M. Lowe, A. Nilsson, R. Verger, Pancreatic lipase-relatedprotein 2 but not classical pancreatic lipase hydrolyzes galactolipids, Biochim.Biophys. Acta 1302 (1996) 236–240.

[11] B. Sias, F. Ferrato, P. Grandval, D. Lafont, P. Boullanger, A. De Caro, B. Leboeuf, R.Verger, F. Carriere, Human pancreatic lipase-related protein 2 is a galactolipase,Biochemistry 43 (2004) 10138–10148.

[12] C. Eydoux, J. De Caro, F. Ferrato, P. Boullanger, D. Lafont, R. Laugier, F. Carriere, A.De Caro, Further biochemical characterization of human pancreatic lipase-relatedprotein 2 expressed in yeast cells, J. Lipid Res. 48 (2007) 1539–1549.

[13] S. Amara, N. Barouh, J. Lecomte, D. Lafont, S. Robert, P. Villeneuve, A. De Caro, F.Carriere, Lipolysis of natural long chain and synthetic medium chain galactolipidsby pancreatic lipase-related protein 2, Biochim. Biophys. Acta 1801 (2010) 508–516.

[14] E. Reboul, A. Berton, M. Moussa, C. Kreuzer, I. Crenon, P. Borel, Pancreatic lipaseand pancreatic lipase-related protein 2, but not pancreatic lipase-related protein1, hydrolyze retinyl palmitate in physiological conditions, Biochim. Biophys. Acta1761 (2006) 4–10.

[15] S. Fernandez, V. Jannin, J.D. Rodier, N. Ritter, B. Mahler, F. Carriere, Comparativestudy on digestive lipase activities on the self emulsifying excipient Labrasol,medium chain glycerides and PEG esters, Biochim. Biophys. Acta 1771 (2007)633–640.

[16] F.K. Winkler, A. d'Arcy, W. Hunziker, Structure of human pancreatic lipase, Nature343 (1990) 771–774.

1301K. Dridi et al. / Biochimica et Biophysica Acta 1831 (2013) 1293–1301

[17] H. van Tilbeurgh, M.-P. Egloff, C. Martinez, N. Rugani, R. Verger, C. Cambillau, In-terfacial activation of the lipase–procolipase complex by mixed micelles revealedby X-Ray crystallography, Nature 362 (1993) 814–820.

[18] H. Chahinian, B. Sias, F. Carriere, The C-terminal domain of pancreatic lipase: functionaland structural analogies with c2 domains, Curr. Protein Pept. Sci. 1 (2000) 91–103.

[19] H. van Tilbeurgh, L. Sarda, R. Verger, C. Cambillau, Structure of the pancreaticlipase–procolipase complex, Nature 359 (1992) 159–162.

[20] M.-P. Egloff, F. Marguet, G. Buono, R. Verger, C. Cambillau, H. van Tilbeurgh, The2.46 Å resolution structure of the pancreatic lipase–colipase complex inhibitedby a C11 alkyl phosphonate, Biochemistry 34 (1995) 2751–2762.

[21] F. Carrière, K. Thirstrup, S. Hjorth, F. Ferrato, C. Withers-Martinez, C. Cambillau, E.Boel, L. Thim, R. Verger, Pancreatic lipase structure–function relationships bydomain exchange, Biochemistry 36 (1997) 239–248.

[22] N. Griffon, E.C. Budreck, C.J. Long, U.C. Broedl, D.H. Marchadier, J.M. Glick, D.J.Rader, Substrate specificity of lipoprotein lipase and endothelial lipase: studiesof lid chimeras, J. Lipid Res. 47 (2006) 1803–1811.

[23] S. Brocca, F. Secundo, M. Ossola, L. Alberghina, G. Carrea, M. Lotti, Sequence of thelid affects activity and specificity of Candida rugosa lipase isoenzymes, Protein Sci.12 (2003) 2312–2319.

[24] A. Svendsen, I.G. Clausen, S.A. Patkar, K. Borch, T. Thellersen, Protein engineeringof microbial lipases of industrial interest, Methods Enzymol. 284 (1997) 317–340.

[25] S. Bezzine, F. Ferrato, M.G. Ivanova, V. Lopez, R. Verger, F. Carriere, Human pancre-atic lipase: colipase dependence and interfacial binding of lid domain mutants,Biochemistry 38 (1999) 5499–5510.

[26] C.Withers-Martinez, F. Carrière, R. Verger, D. Bourgeois, C. Cambillau, A pancreaticlipase with a phospholipase A1 activity: crystal structure of a chimeric pancreaticlipase-related protein 2 from guinea pig, Structure 4 (1996) 1363–1374.

[27] L. Soldatova, L. Kochoumian, T.P. King, Sequence similarity of a hornet (D. maculata)venom allergen phospholipase A1 with mammalian lipases, FEBS Lett. 320 (1993)145–149.

[28] J.T. Christeller, S. Amara, F. Carriere, Galactolipase, phospholipase andtriacylglycerol lipase activities in the midgut of six species of lepidopteran larvaefeeding on different lipid diets, J. Insect Physiol. 57 (2011) 1232–1239.

[29] T. Hiramatsu, H. Sonoda, Y. Takanezawa, R. Morikawa, M. Ishida, K. Kasahara, Y.Sanai, R. Taguchi, J. Aoki, H. Arai, Biochemical and molecular characterization oftwo phosphatidic acid-selective phospholipase A1s, mPA-PLA1alpha andmPA-PLA1beta, J. Biol. Chem. 278 (2003) 49438–49447.

[30] N. Arima, A. Inoue, K. Makide, T. Nonaka, J. Aoki, Surface loops of extracellularphospholipase A(1) determine both substrate specificity and preference forlysophospholipids, J. Lipid Res. 53 (2012) 513–521.

[31] S. Shinkuma, A. Inoue, J. Aoki, W. Nishie, K. Natsuga, H. Ujiie, T. Nomura, R. Abe, M.Akiyama, H. Shimizu, The beta9 loop domain of PA-PLA1alpha has a crucial role in au-tosomal recessivewoolly hair/hypotrichosis, J. Invest.Dermatol. 132 (2012)2093–2095.

[32] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular cloning. A laboratory manual, 2nded. Cold Spring Harbor Laboratory Press, New York, 1989.

[33] R. Higuchi, Using PCR to engineer DNA, in: H.A. Erlich (Ed.), PCR Technology:Principles and Applications for DNA Amplification, W.H. Freeman and Co., NewYork, 1992, pp. 61–70.

[34] K. Thirstrup, F. Carriere, S. Hjorth, P.B. Rasmussen, H. Woldike, P.F. Nielsen, L.Thim, One-step purification and characterization of human pancreatic lipaseexpressed in insect cells, FEBS Lett. 327 (1993) 79–84.

[35] S. Bezzine, F. Ferrato, V. Lopez, A. De Caro, R. Verger, F. Carrière, One-step purifi-cation and biochemical characterization of pancreatic lipases expressed in insectcells, in: M.H. Doolitle, K. Reue (Eds.), Lipase and Phospholipase Protocols, Vol.109, Humana Press Inc., Totowa, NJ, 1999, pp. 187–202.

[36] T. Christensen, H. Wöldike, E. Boel, S.B. Mortensen, K. Hjortshöj, L. Thim, M.T.Hansen, High level expression of recombinant genes in Aspergillus oryzae, Nat.Biotechnol. 6 (1988) 1419–1422.

[37] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head ofbacteriophage T4, Nature 227 (1970) 680–685.

[38] S. Amara, D. Lafont, B. Fiorentino, P. Boullanger, F. Carriere, A. De Caro, Continuousmeasurement of galactolipid hydrolysis by pancreatic lipolytic enzymes using thepH-stat technique and a medium chain monogalactosyl diglyceride as substrate,Biochim. Biophys. Acta 1791 (2009) 983–990.

[39] J.A. Rodriguez, L.D. Mendoza, F. Pezzotti, N. Vanthuyne, J. Leclaire, R. Verger, G.Buono, F. Carriere, F. Fotiadu, Novel chromatographic resolution of chiraldiacylglycerols and analysis of the stereoselective hydrolysis of triacylglycerolsby lipases, Anal. Biochem. 375 (2008) 196–208.

[40] K. Arnold, L. Bordoli, J. Kopp, T. Schwede, The SWISS-MODEL workspace: aweb-based environment for protein structure homology modelling, Bioinformat-ics 22 (2006) 195–201.

[41] M.C. Peitsch, T.N. Wells, D.R. Stampf, J.L. Sussman, The Swiss-3DImage collectionand PDB-Browser on theWorld-WideWeb, Trends Biochem. Sci. 20 (1995) 82–84.

[42] C. Eydoux, S. Spinelli, T.L. Davis, J.R. Walker, A. Seitova, S. Dhe-Paganon, A. DeCaro, C. Cambillau, F. Carriere, Structure of human pancreatic lipase-related pro-tein 2 with the lid in an open conformation, Biochemistry 47 (2008) 9553–9564.

[43] S. Amara, V. Delorme, M. Record, F. Carriere, Inhibition of phospholipase A1,lipase and galactolipase activities of pancreatic lipase-related protein 2 by methylarachidonyl fluorophosphonate (MAFP), Biochim. Biophys. Acta 1821 (2012)1379–1385.