Molecular Characterization of Metalo-β-lactamase producing … · 2018. 7. 1. · system kit cat....

Egyptian Journal of Medical Microbiology, October 2010 Vol. 19, No. 4

131

Molecular Characterization of Metalo-β-lactamase producing Clinical Pseudomonas aeruginosa Isolates from Mansoura

University Hospitals, Egypt

Habib, E.(1), Hassan, R.(1), Abd El Galil, K.(1), Shokralla, S. (1,2) and EL-Naggar, F. (1)

(1) Department of Microbiology, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt. (2) Department of integrative biology, University of Guelph, Ontario

N1G2W1, Canada.

ABSTARCT Background: Pseudomonas aeruginosa plays an important role in opportunistic and nosocomial infections affecting individuals with predisposing conditions. Methods: In this respect, we evaluated the production of MBLs among 100 clinical isolates of Pseudomonas aeruginosa sources in Mansoura University Hospitals. Results: Most isolates were highly resistant to penicillins and cephalosporins. On the other hand, most strains were sensitive to imipenem as 91% of the isolates were susceptible. The effect of MBL inhibitors using a simple disk diffusion test revealed the efficiency of EDTA and 2-mercaptoethanol as Metalo-β-lactamase inhibitors due the observed expansion of the growth-inhibitory zone of the two inhibitors. Cupric chloride also gave a clear result, but with a weak inhibitory effect. IMP and VIM genes were amplified from both genomic and plasmid DNA extracted from 26 isolates. The amplification primers of both markers were specifically designed to amplify 600 bp for IMP and 500 bp for VIM. On the other hand, two isolates did not harbor IMP gene on their plasmids while six isolates did not contain VIM on their plasmids. Subsequent sequencing of the generated amplicons showed different types of mutation in the sequenced regions of the tested resistance genetic markers. They include insertion, deletion and substitution mutations. Moreover, the region 178-822 of IMP and the region 111-627 of VIM, commonly found in resistant Pseudomonas aeruginosa, are the most predominant variable regions. Conclusion: particular PCR and subsequent sequencing provide a useful tool for accurate and cost efficient characterization of MBLs producing Pseudomonas aeruginosa isolates. The accuracy of the sequencing method can answer the epidemiological questions that can’t be answered by the traditional microbiological methods. This approach will help in choosing the best effective antibiotic to overcome the nosocomial infection.

INTRODUCTION

Pseudomonas aeruginosa (Ps. aeruginosa) is most often involved in opportunistic and nosocomial infections affecting individuals with predisposing conditions (e.g. extensive burns, trauma to the skin or conjunctiva, urinary tract manipulations and cystic fibrosis). Moreover, Ps. aeruginosa is the third leading cause of hospital-acquired infections(1). Ps. aeruginosa producing MBLs was first reported from Japan in 1991(2) and since then has been described from various parts of the world, including Asia, Europe, Australia, South America, and North America. Metalo-β-lactamase (MBLs), require divalent cations, usually zinc, as metal cofactors for enzyme activity(3). MBLs belong to Ambler class B β-lactamases based on their amino acid sequence homology, and to group 3 according to the Bush classification based on their

substrate profiles (imipenem hydrolysis), universal inhibition by ethylene diamine tetra-acetic acid (EDTA) and lack of inhibition by serine β-lactamase inhibitors(4-5)

Organisms harboring MBLs have been reported in several countries, signaling the urgent need for accurate diagnostic tests by clinical laboratories as well as the requirement for more potent antimicrobial agents to be effectively eradicate the growth of this group of organisms. Unfortunately, the number of the effective new drugs against these pathogens is limited(6).

A variety of structurally disparate compounds have been examined as MBLs inhibitors, including thio-ester derivatives(7-8), trifluoromethyl alcohols and ketones(9), thiols(10-

11), sulfonyl hydrazones(12), tricyclic natural products(13), succinic acid derivatives(14), biphenyl tetrazoles(15), cysteinyl peptides(16),


132

mercaptocarboxylates(17), 1-β methylcarbapenem(18), cefotetan(19), thioxocephalosporins(20), and penicillin derivatives(21).

Acquired MBLs include four major genetically mobile types: IMP enzymes, VIM enzymes, SPM enzymes and GIM enzymes(6). IMP and VIM enzymes have similarly broad kinetic activity, rapidly hydrolyzing all β-lactams except monobactams and they are resistant to conventional inhibitors of β-lactamases(22).

The aim of the present study is to evaluate the MBLs production among different isolates of Ps. aeruginosa collected from various clinical sources in Mansoura University Hospitals, Egypt.

MATERIALS & METHODS I- Clinical Isolates:

In the present study, 100 isolates of Ps. aeruginosa were collected from different University hospitals in Mansoura, Dakahlia governorate, Egypt. The specimens were processed immediately using standard procedures and were identified according to Barrow and Feltham(23) and Collee et al.,(24). Antibiotic sensitivity testing of the isolated strains was done by disk diffusion method according to Bauer et al.,(25). II- Phenotypic characterization of tested

isolates: The samples were inoculated on cetrimide

agar and nutrient agar plates. The overnight formed colonies at 37°C were examined and identified. The isolates were tested for their negative gram-stain, colonial morphology, pigment production(26), gelatin liquefaction, oxidase test and oxidation of sugars(24). III- Screening for Metallo-β-Lactamases

production: A simple disk diffusion test was constructed for detection of metallo-β-Lactamases in clinically isolated ceftazidime (CAZ) - resistant Ps. aeruginosa. Briefly: A colony of each isolate was suspended and diluted with nutrient broth to 106 CFU/ml and spread on a nutrient agar plate with a sterile swab. Two commercially supplied Oxoid disks each containing 30 µg of CAZ was

then placed on the plates, the distance between the two CAZ disks was kept at about 4 to 5 cm and a filter disk was placed near one of the CAZ disks within a center- to- center distance of 1.0 to 2.5 cm. Two to five microlitres of each inhibitor solution was added to the filter disks on the agar surface, and each agar plate was incubated at 370C overnight. The concentration and the amount of each inhibitor solution added to filter disk were as follows: 100mM (5µl) for CuCl2; 100mM (5µl) for EDTA,; 100mM (5µl) for FeCl3; and 100mM (5µl) for 2-mercaptoethanol. IV- Molecular investigation methods 1- DNA extraction

The plasmid contents of the selected 26 isolated strains were extracted using wizard® plus small volume minipreps DNA purification system kit cat. No. A1330 supplied by Promega corporation according to Promega protocol 2006 protocol and the genomic DNA of these isolates were also prepared using QIA amp® DNA mini Kit Cat. No. 51304 supplied by Qiagen Inc. according to the manufacturer instructions for bacteria 2003. DNA was eluted by adding 50µl EB buffer (10 mM Tris-Hcl, pH 8.5) and visualized by electrophoresis on horizontal gels 2- Primer design and amplification of

variable regions of IMP and VIM genes: The variable regions of IMP and VIM

genes were amplified using the following reaction, twenty five µl master mix (Mgcl2, polymerase, dNTPs), 18 µl RNAse free water, 10 pmol forward primer, 10pmol reverse primer, and 5µl of the DNA template. The touchdown PCR conditions was initiated with heated lid 95oC for 5 min, followed by 15 cycles of 94oC for 1min, 60oC for 1min and 72oC for 1min, then 30 cycles of 94oC for 1min, 53oC for 1min and 72oC 1min and a final 72oC for 10 min and 4oC hold.. Specific amplification and sequencing primers for the tested metallo-β-lactamases encoding markers of Ps. aeruginosa isolates are shown in Table (1). The PCR products of the tested genes were sequenced according to the protocol of Applied biosystems Big dye terminator v3.1 DNA sequencing reaction in 96 well format protocol(27).


133

Table (1): Specific amplification and sequencing primer sets for the tested metallo-β- lactamases genes of Ps. aeruginosa isolates

Gene Name Type Sequense 5`-3` Fw 110 ATGTTCAAACTTTTGAGTAAG VIM Rv 628 CTACTCAACGACTGAGCG Fw 177 ATGAAGAAATTATTTGTTTTATG IMP Rv 823 TTAGTTACTTGGCTGTGATG

RESULTS I- Antimicrobial sensitivity pattern of the

isolated strains All tested Ps. aeruginosa isolates showed

multiple antibiotic resistance patterns to ciprofloxacin, levofloxacin, gentamicin, amikacin, ampicillin, amoxicillin, cephradine, cefuroxime, cefoperazone, ceftazidime, cefepime and imipenem. All Ps. aeruginosa strains were resistant to ampicillin and amoxicillin. Imipenem was the most effective antibiotic as 91 isolates (91%) were susceptible. Concerning the fluoroquinolones used in this study, we found that only 44 isolates (44%) were sensitive to ciprofloxacin and 58 isolates (58%) were sensitive to levofloxacin. In addition 78 isolates (78%) were sensitive to amikacin and 64 isolates (64%) were sensitive to gentamicin. On the other hand 52 isolates only sensitive to cefipime(52%), 46 isolates were sensitive to ceftazidime (46%), 37isolates

was sensitive to cefoperazone (37%), 24 isolates were sensitive to cephradine (24%) and 38 isolates were sensitive to cefuroxime (38%). II- Screening the production of Metallo-β-

Lactamases Figure (1) represents the effect of MBL

inhibitors using a simple disk diffusion test on isolate No. 3. The results revealed that among the MBL used in this study EDTA and 2- mercaptoethanol gave the clearest result of an expansion of the growth-inhibitory zone. Cupric chloride also gave a clear result, but its inhibitory effect was relatively weaker than that of EDTA and 2-mercaptoethanol. However slight change in the appearance of the growth inhibitory zone was observed for tested CAZ-resistant strains when using Fecl3. ferric chloride as a heavy metal salts, EDTA and 2-mercaptoethanol usually formed small clear zone around the filter disk, demonstrating their bactericidal activity, while the growth-inhibitory zone expanded to the disk containing CAZ.

Fig (1): Inhibitory effect of 2-mercaptoethanol(A), cupric chloride (B), EDTA (C) and ferric chloride (D) on IMP producing Ps. aeruginona strain No.3.


134

III- Plasmid profile of tested Ps. aeruginosa clinical isolates In the plasmid profiles of the tested Ps.

aeruginosa, it was observed that isolate no. 1 and 2 have the same plasmid profile which contains 2 distinct bands in each, strains No. 6, 7 and 12 showed the same plasmid profile which contains one plasmid band at 4.6 Kb.

Strains no. 3 and 14 have the same plasmid profile and contain 2 plasmid bands. Strains No. 13, 15, 16, 19, 20, 21, 22, 23 and 25 contain one plasmid at 23.13 Kb and strains No. 17 and 24 have the same plasmids profile which contain 2 plasmid bands and the remaining tested strains, each has a unique characteristic plasmid profile, as shown in Fig (2) and Table (2).

M 1 2 3 4 5 6 7 8 9 10 11 12

Fig (2): Plasmid DNA profiles of Ps. aeruginosa isolates. Lane M was λ Hind III digest marker. Lanes 1to 12 were strains no. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 1 and 2 respectively. Table (2): Plasmid profiling analysis of tested isolates with reference to the source of isolation

Source Strain No. Hospital Clinical source No. of plasmid bands Plasmid size (Kb)

1 UNC Urine 2 9.14, 3 2 UNC Urine 2 9.14, 3 3 UNC Urine 2 23.13, 4.36 4 UNC Urine 2 < 2 5 UNC Urine 1 9.14 6 UNC Urine 1 4.36 7 UNC Urine 1 4.36 8 UNC Urine 1 >23.13 9 UNC Urine 2 9.14, >23.13 10 MUH Blood 3 <2.02 11 MUH Wound 2 23.13, 2.32 12 UNC Urine 1 4.36 13 UNC Urine 1 23.13 14 UNC Urine 2 23.13,4.36 15 UNC Urine 1 23.13 16 UNC Urine 1 23.13 17 UNC Urine 2 9.14, 2.32 18 UNC Urine 1 2 19 UNC Urine 1 23.13 20 MEH Burn 1 23.13 21 MEH Burn 1 23.13 22 MEH Burn 1 23.13 23 MEH Burn 1 23.13 24 MEH Burn 2 9.14, 2.32 25 MEH Burn 1 23.13 26 MUH Blood 2 23.13, >23.13


135

IV- PCR amplification of IMP and VIM genes

The metallo-β-lactamase genes; IMP and VIM were detected and amplified in plasmids and genomic DNA of 26 isolated Ps. aeruginosa strains (Table 3). Amplification and gel electrophoresis of the generated amplicons

of both IMP and VIM genes showed distinct bands at 600 bp and 500 bp respectively. Interestingly, our results showed that two strains only (isolates No. 4 and 11) did not harbor IMP gene on their plasmids and six isolates (strains No. 2,5, 10, 13, 16 and 26) did not contain VIM on their plasmids.

Table (3): Types of IMP and VIM genes among the isolated strains.

Genomic Plasmid Strain No.

IMP Type VIM Type IMP VIM 1 + 1 + 18 + + 2 + 7 + 2 + - 3 + 9 + 2 + + 4 + 1 + 2 - + 5 + 14 + 1 + - 6 + 25 + 2 + + 7 + 18 + 2 + + 8 + 1 + 1 + + 9 + 1 + 1 + + 10 + 1 + 15 + - 11 + 7 + 1 - + 12 + 26 + 1 + + 13 + 10 + 2 + - 14 + 1 + 2 + + 15 + 26 + 2 + + 16 + 1 + 18 + - 17 + 1 + 2 + + 18 + 7 + 2 + + 19 + 9 + 13 + + 20 + 10 + 2 + + 21 + 1 + 2 + + 22 + 1 + 2 + + 23 + 18 + 2 + + 24 + 7 + 1 + + 25 + 10 + 1 + + 26 + 7 + 2 + - +: present -: absent

The alignment of the sequences showed different types of mutation in the tested resistant genes, they include insertion, deletion and substitution mutation. From the obtained sequences, the variable region in IMP gene from tested Ps. aeruginosa isolates were from position 178 to 822. Several mutations could be detected, for example, deletion of A in position 181 in isolates No. 3 and 19 and substitution of C/T in position 184 in isolate No. 4.

Concerning VIM gene, the most predominant variable regions in the sequenced region amongst the tested Ps. aeruginosa isolates is starting from position 111 to 627. The results showed several substitution mutations in the sequenced region for example; substitution mutation of C/G in position 117 in strains No.5, 8, 9, 11, 12, 19, 24 and 25.


136

DISCUSSION

Resistant Gram-negative bacilli produce many types of β-lactamases including (MBLs). Many of these resistant isolates lack options for treatment and represent a serious public health concern(28). Gad et al.,(29) found that 100% of the urinary strains of Ps. aeruginosa were resistant to ampicillin, amoxicillin, cefuroxime and cephradine, in the present study; similar results were obtained as all Ps. aeruginosa urinary tract isolates were resistant to ampicillin and amoxicillin.

In the present study, a simple and inexpensive testing method for screening of IMP producers was performed using thiol compounds (IMP inhibitors) including 2-mercaptoethanol, cupric chloride, ferric chloride and EDTA. For IMP producing strains, the growth-inhibitory zone between the two disks expanded, while no evident change in the shape of the growth inhibitory zone was observed for CAZ-resistant strains producing serine β-lactamases such as AmpC or SHV-12.

CAZ seemed to be the most suitable substrate for this test, because IMP producers usually demonstrated high-level resistance to CAZ (MIC>64 µg/ml) in previous study(30) and a marked inhibitory effect of thiol compounds was usually observed. Plasmid fingerprinting was the first molecular method has been used for demonstrated the similarity of clinical isolates of bacteria in epidemiological studies and has been proved to be more accurate than other methods for indicating similar origins of isolates(31). Moreover, both IMP and VIM genes could be successfully amplified by touchdown PCR protocol as the markers encoding MBLs resistance. The specific well designed amplification primers for both markers could amplify 100% of both markers in genomic DNA

extracted from the Ps. aeruginosa strains isolated from different clinical sources. Interestingly, the same primer sets used to amplify both markers in plasmids showed different results, IMP and VIM genes could be amplified in plasmids of the isolated strains in different patterns 92.3% and 76.9% of the strains respectively. These findings confirm the hypothesis of the expression of MBLs resistance either if they are encoded by genomic or plasmid DNA or both.

Here we utilized the DNA sequencing approach for genotyping VIM and IPM among the tested isolates, from which,, the predominant type of IMP was found to be the IMP-1 group (38.5 %) followed by type 7 (19.2 %) then type 10 (11.5%), the types 9, 18, 26 which present in 2 strains for each and also types 14 and 25 also can be detected in one strain. While, the most common type of VIM is 2 (57.7%) followed by 1 (27%) then type 18 (7.7%) and also 15 and 13 were also detected in one strain for each as seen in Figure (3). Previous studies Hisaaki et al.,(32) showed the same results of the predominant type of MBLs were found to be IMP-1and VIM-2 groups. Moving forward with the sequencing results, in this study, we could use the phylogeny to determine the relatedness between clinical isolates and the source of isolation (Figs 4 & 5).

From the phylogenetic trees, it is clear that Pseudomonas species are sharing the selected region of IMP gene of genomic DNA between individual isolates of 1.0. On the other hand the, intra-species genetic distance between individual isolates at the selected region of VIM gene of genomic DNA was higher up to 0.01. These findings can show the high rate of evolution and the genetic variation in Pseudomonas species.

A B

Fig. (3): Distribution of different genotypes of IMP (A) and VIM (B) among the genomic DNA of the

tested isolates


137

Fig. (4a): Alignment of the sequences of the selected region of IMP gene of genomic DNA among Ps.

aeruginosa isolates.

Fig (4b): Neighbor-joining tree based on the above sequences alignment


138

Fig (5a): Alignment of the sequences of the selected region of VIM gene of genomic DNA among Ps. aeruginosa isolates.

Fig (5b): Neighbor-joining tree based on the above sequences alignment

In conclusion, misuse of extended spectrum cephalosporins and quinolones in hospital setting is responsible for increased incidence and the prevalence of resistance to these antibiotics. Imipenem could be considered as the drug for choice for treatment infections caused by multi-resistant Ps. aeruginosa.

Therefore, the simple disc diffusion method described in this study is very helpful for screening IMP producing strains in daily clinical laboratory testing. Significant genetic variation was observed among different strains represented by the diversity of their plasmid profiles. However, evaluation of plasmid


139

content is not generally useful in delineation of strain relatedness. Plasmid analysis is particularly important to determine the evolution and spread of antibiotic resistance among isolates. PCR analysis along with DNA sequencing usually give satisfactory results in the genotyping of resistance genes and it can be efficiently used in daily testing in clinical laboratories. In other words, DNA sequencing is the gold standard for differentiating subtypes and determining the degree of relatedness between the isolates that can guide us in reducing the appearance of more resistant bacterial strains.

REFERENCES 1. Bown, P. and Izundy, A. (2004):

Antibiotic resistance in clinical isolates of Pseudomonas aeruginosa in Jamaica. Pan. Am. J. Public Health. 16 (2):125-130.

2. Watanabe, M., Iyobe, S., Inoue, M. and Mitsuhashi, S. (1991): Transferable imipenem resistance in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 35 (1): 147-156.

3. Bush, K. (2001): New β-lactamases in gram-negative bacteria: diversity and impact on the selection of antimicrobial therapy. Clin. Infect. Dis. 32 (7):1085-1089.

4. Ambler, R. (1980): The structure of β-lactamases.Philosophical transactions of the Royal Society London Biol. 289 (1036): 321-331.

5. Rasmussen, B. and Bush, K. (1997): Carbapenem hydrolyzing β-lactamases. Antimicrob. Agents Chemother. 41 (2): 223-231.

6. Jones, R., Biedenbach, D., Sader, H., Fritsche, T., Toleman, M. and Walsh, T. (2005): E-merging epidemic of metallo-β-lactamase-mediated resistances. Diagnostic Microb. and Infect. Dis. 51 (2): 77-83.

7. Fitzgerald, P., Wu J. and Toney J. (1998): Unanticipated inhibition of the metallo-β-lactamase from Bacteroides fragilis by 4-morpholineethanesulfonic acid (MES): a crystallographic study at 1.85-A resolution. Biochemistry. 37 (21):6791-6800.

8. Hammond, G., Huber, J., Greenlee, M., Laub, J., Young, K., Silver, L., Balkovec, J., Pryor, K., Wu, J., Leiting, B., Pompliano, D. and Toney, J. (1999): Inhibition of IMP-1 metallo-β-lactamase

and sensitization of IMP-1-producing bacteria by thioester derivatives. FEMS Microbiol. Lett. 179 (2):289-296.

9. Walter, M., Felici, A., Galleni, M., Soto, R., Adlington, R., Baldwin, J., Fre`re, J., Gololobov, M. and Schofield C. (1996): Trifluoromethyl alcohol and ketone inhibitors of metallo-β-lactamases. Bioorg. Med. Chem. Lett. 6 (20):2455-2458.

10. Arakawa, Y., Shibata, N., Shibayama, K., Kurokawa, H., Yagi, T., Fujiwara, H. and Goto, M. (2000): Convenient test for screening metallo-β-lactamase-producing gram-negative bacteria by using thiol compounds. J. Clin. Microbiol. 38(1): 40-43.

11. Siemann, S., Clarke, A., Viswanatha, T. and Dmitrienko, G. (2003): Thiols as classical and slow-binding inhibitors of IMP-1 and other binuclear metallo-β-lactamases. Biochemistry. 42 (6):1673-1683.

12. Siemann, S., Evanoff, D. ,Marrone, L., Clarke, A., and Dmitrienko, G. (2002): N-Arylsulfonyl hydrazones as inhibitors of IMP-1 metallo-β-lactamase. Antimicrob. Agents Chemother. 46 (8):2450-2457.

13. Payne, D., Hueso-Rodriguez, J., Boyd, H., Concha, N., Janson, C. , Gilpin, M., Bateson, J., Cheever, C., Niconovich, N., Pearson, S., Rittenhouse, S., Tew, D., Diez, E., Perez, P., De La Fuente, J., Rees, M. and Rivera-Sagredo, A. (2002): Identification of a series of tricyclic natural products as potent broad-spectrum inhibitors of metallo-β-lactamases. Antimicrob. Agents Chemother. 46 (6):1880-1886.

14. Toney, J., Hammond, G., Fitzgerald, P., Sharma, N., Balkovec, J., Rouen, G., Olson, S., Hammond, M., Greenlee, M., Gao, Y. (2001): Succinic acids as potent inhibitors of plasmid-borne IMP-1 metallo-β-lactamase. J. Biol. Chem. 276 (34):31913-31918.

15. Toney, J., Cleary, K, Hammond, G., Yuan, X., May, W., chins, S. Ashton, W. and Vanderwall, D. (1999): Structure-activity relationships of biphenyl tetrazoles as metallo-β-lactamase inhibitors. Bioorg. Med. Chem. Lett. 9 (18):2741-2746.

16. Bounaga, S., Galleni, M., Laws, A. and Page, M. (2001): Cysteinyl peptide inhibitors of Bacillus cereus zinc β-lactamase. Bioorg. Med. Chem. 9 (2):503-510.


140

17. Greenlee, M., Laub, J., Balkovec, J., Hammond, M., Hammond, G., Pompliano, D. and Epstein-Toney, J. (1999): Synthesis and SAR of thioester and thiol inhibitors of IMP-1 metallo-β-lactamase. Bioorg. Med. Chem. Lett. 9 (17):2549-2554.

18. Nagano, R., Adachi, Y., Hashizume, T. and Morishima, H. (2000): In vitro antibacterial activity and mechanism of action of J.-111,225, a novel 1β-methylcarbapenem, against transferable IMP-1 metallo-β-lactamase producers. J. Antimicrob. Chemother. 45 (3):271-276.

19. Quiroga, M., Franceschini, N., Rossolini, G., Gutkind, G., Bonfiglio, G., Franchino, L. and Amicosante, G. (2000): Interaction of cefotetan and the metallo-β-lactamases produced in Aeromonas spp. and in vitro activity. Chemother. 46 (3):177-183.

20. Tsang, W., Dhanda, A., Schofield, C., Frere, J., Galleni, M. and Page, M. (2004): The inhibition of metallo-β-lactamase by thioxo-cephalosporin derivatives. Bioorg. Med. Chem. Lett. 14 (7):1737-1739.

21. Buynak, J., Chen, H., Vogeti, L., Gadhachanda, V., Buchanan, C., Palzkill, T., Shaw, R., Spencer, J. and Walsh, T. (2004): Penicillin-derived inhibitors that simultaneously target both metallo- and serine- β-lactamases. Bioorg. Med. Chem. Lett. 14 (5):1299-1304.

22. Zhiyong, Z., Xiaoju, L. and Yanyu, G. (2003): Metallo-β-lactamases of non- fermenting Gram-negative bacteria. Reviews in Med. Microbio. 14 (3):79-93.

23. Barrow, G. and Feltham, R. (1993): Cowan and Stell's Manual for Identification of Medical Bacteria. 3rd ed., pp: 136–138. Univeristy press, Cambridge, U.K.

24. Collee, J., Miles, R. and Watt, B. (1996): Tests for the identification of bacteria. In: Mackie and Macartney practical medical microbiology, 14th ed., Vol. I, pp: 413–424. Churchill livingstone, New York.

25. Bauer, A. Kirby, W. Sherris, W. and Turk M. (1966): Antibiotic susceptibility testing by a standardized single disc method. Am. J. Clin. Pathol., 45: 493–496.

26. Govan, J.R.W. (1996): Pseudomonas aeruginosa, Stenotrophomones, Burkholderia. In collee, A.G. Marmion, B.P. and Simmons, A. (eds): Mackie and Macartnay Practical Medical microbiology. Churchill Livingstone, New York, 14th edn, Vo. I, PP: 413 – 424.

27. Sanger, F., Nicklen, S. and Coulson, A. (1977): DNA sequencing with chain–terminating inhibitors. Proc. Nat. Acad. Sci., 74: 5463–5467.

28. Gaynes, R. and Edwards, J. (2005): the National Nosocomial Infections Surveillance System. Overview of nosocomial infections caused by gram-negative bacilli. Clin. Infect. Dis. 41 (6): 848-854.

29. Gad, G., El-Domam, R. and Ashour, H. (2008): Antimicrobial susceptibility profile of Pseudomonas aeruginosa isolates in Egypt. The journal of Urology. 180 (1):176-181.

30. Senda, K., Arakawa, Y., Ichiyama, S., Nakashima, K., Ito, H., Ohsuka, S., Shimokata, K., Kato, N. and Ohta, M. (1996): PCR detection of metallo-β-lactamase gene (bla IMP) in Gram negative rods resistant to broad spectrum β-lactams. J. Clin. Microbial. 34 (12):2909-2913.

31. Tompkins, L. (1985): DNA methods in clinical microbiology. In: "Manual of clinical microbiology." E.H. lemette, A. Balows, W.J. Hauser, Jr. and H. J. Shadomy (ed.), 4th ed., pp:1023–1028. American society for Microbiology, Washington, N.C.

32. Hisaki, N., Komatsu, M., Shibata, N. (2004): metallo-β-lactamase-producing gram-negative bacilli: Laboratory-Based Swweillance in Cooperation with 13 clinical laboratories in the Kinkiki Region of Japan. Journal of Clinical Microbiology.42 (11): 5256-5263.


141

لتوصيف الجزيئى لعترات السودوموناس اورجينوزا المنتجة للبيتالاآتيماز المعدنى والمعزولة ا .من مصادراآلينيكية من مستشفيات جامعه المنصورة بمصر

)١(فاطمة النجار) ٢-١(شادى شكراللة، )١(خالد عبد الجليل،)١(رمضان حسن، )١(د حبيبالسي . جمهورية مصر العربية- جامعة المنصورة- آلية الصيدلة-قسم الميكروبيولوجي)١(

.آندا- انتريو-جامعة جلف-قسم البيولوجيا التكاملية)٢(

ولقد تناولت هذه . المستشفيات والتى لها تأثير مباشر على مختلف الافراد تلعب بكتريا السودوموناس اورجينوزا دورا هاما فى عدوى . عترة من السودوموناس اورجينوزا المعزولة من مصادراآلينيكية مختلفة من مستشفيات جامعه المنصورة١٠٠الدراسة

ا ا بينه ة وجد اختلاف رات . وبناء على نتائج اختبار الحساسية للمضادات الحيوية للعترات المعزول ائج ان معظم العت د اظهرت النت ولقرات آانت ائج أن معظم العت ك أظهرت النت ى النقيض من ذل سفالوسبورن وعل سلين وال المفصولة آانت مقاومة بدرجة عالية لكل من البني

وى % ٩١اآثرحساسية للامبينيم حيث وجد أن ذا المضاد الحي ة له ذه . من العترات المعزولة اظهروا حساسية عالي ذلك استخدمت فى ه آى سودوموناس الدراسة طريقة بسيطة للتعرف عل تج بواسطة ال دنى المن اميز المع ات المفصولة حيث أظهرت البيتالاآت ك فى العين و ذل

. ميرآبتواثانول أظهروا نتيجة واضحة عن الكيوبراس آلوريد و الفريك آلورايد-٢ و EDTAالنتائج أن وادئ ٢٦ على الدانا البلازميدى و الكروموسومى المفصول من IMP و VIMكبير جينات وفى هذه الدراسة تم ت ة باستخدام ب عين

ى ٦ جين بينما IMPووجد أن عترتين لا تحتوى على . مخصصة لكل جين سل وجود . جين VIM عترات لا تحتوى عل د أظهر التسل ولقك . الحذف وطفرات الاستبدال،وتشمل الإدراج . لجينية المقاومةأنواع مختلفة من الطفرات فى المنطقة المختارة للعلامات ا ى ذل وعلاوة عل

ة ، VIM من ٦٢٧-١١١ والمنطقة IMP من ٨٢٢-١٧٨، فإن المنطقة ، والتى توجد عادة في عترات السودوموناس اورجينوزا المقاوم .هي المناطق الأآثر متغير غالبا

ه ة أن ذة الدراس ن ه ستنتج م ل ال : ون رق تفاع رات ط ة لعت اء عالي ق وآف يف دقي ى توص ابع تعط سل المتت سل والتسل رة المتسل بلمى لا يمكن ئلة الت ى الأس السودوموناس اورجينوزا المنتجة للبيتالاآتيماز المعدنى ويمكن القول بأن دقة طريقة التسلسل يمكن أن تجيب عل

ة ة التقليدي اليب الميكروبيولوجي سا . الإجابة عليها بواسطة أس ى عدوى وسي ال للتغلب عل وي فع ار أفضل مضاد حي نهج في اختي ذا ال عد ه .المستشفيات

Molecular Characterization of Metalo-β-lactamase producing … · 2018. 7. 1. · system kit cat....

Documents

Transcript of Molecular Characterization of Metalo-β-lactamase producing … · 2018. 7. 1. · system kit cat....