Molecular and Cellular Neuroscience 41 (2009) 156–165

Contents lists available at ScienceDirect

Molecular and Cellular Neuroscience

j ourna l homepage: www.e lsev ie r.com/ locate /ymcne

PSD95β regulates plasma membrane Ca(2+) pump localization at thephotoreceptor synapse

Wendy M. Aartsen a, Jean-Pierre Arsanto b, Jean-Paul Chauvin b, Rogier M. Vos a, Inge Versteeg a,Bob Nunes Cardozo a, André Le Bivic b, Jan Wijnholds a,⁎a Department of Neuromedical Genetics, The Netherlands Institute for Neuroscience, Royal Netherlands Academy of Arts and Sciences (KNAW), Meibergdreef 47,1105 BA Amsterdam, The Netherlandsb Université de la Méditerranée and CNRS, UMR 6216, IBDML, Campus de Luminy case 907, 13288, Marseille cedex 09, France

⁎ Corresponding author. Fax: +31 20 5666121.E-mail address: j.wijnholds@nin.knaw.nl (J. Wijnhol

1044-7431/$ – see front matter © 2009 Elsevier Inc. Aldoi:10.1016/j.mcn.2009.02.003

a b s t r a c t

a r t i c l e i n f o

Article history:

At the presynaptic plasma m Received 8 December 2008Revised 27 January 2009Accepted 10 February 2009Available online 21 February 2009

Keywords:Plasma membrane Ca(2+)-ATPasesPMCAMembrane palmitoylated protein 4MPP4PSD-95PSD95Photoreceptor synapsePresynaptic plasma membraneMutant miceRetina

embrane of the photoreceptor the correct localization of the calcium extruder,plasma membrane Ca2+-ATPase (PMCA), is determined by a unique protein complex. Here, the role of twoproteins within the complex; membrane palmitoylated protein 4 (MPP4) and postsynaptic density protein95 (PSD95) is investigated in more details, using Mpp4 and Psd95 mutant mice. MPP4 deficiency results inthe loss of both PMCA and PSD95 from the photoreceptor synapse. Truncation of the C-terminal part of MPP4leads to a loss of PSD95 and mislocalization of PMCA, while truncation of the C-terminal part of PSD95 didnot affect the localization of the complex members. Lentivirus-mediated molecular replacement strategy wasused to selectively express either PSD95α or PSD95β in wild type or Mpp4 mutant primary retinal explants.Silencing of the Psd95 gene resulted in the loss of presynaptic MPP4 and PMCA1. The plasma membranelocalization of MPP4 and PMCA1 could be restored by the expression of PSD95β. We conclude that bothscaffold proteins PSD95β and MPP4 are essential for the modulation of PMCA levels at the presynapticplasma membrane and thereby influence the photoreceptor synaptic calcium handling.

© 2009 Elsevier Inc. All rights reserved.

Introduction

Within the highly polarised neuronal cells of the retina, scaffoldproteins are extremely important for the correct localization andstabilisation of protein complexes at distinct cellular regions(Anderson, 1996; Caruana, 2002; Elias and Nicoll, 2007; Roh andMargolis, 2003). One of the scaffold proteins predominantlyexpressed in the retina is membrane palmitoylated protein 4(MPP4) (Li et al., 2003; Stöhr et al., 2003). MPP4 is a member ofthe p55 subfamily of membrane-associated guanylate kinase(MAGUK) proteins (Stöhr andWeber, 2001). MAGUK proteins containat least one of each of the following protein–protein interactiondomains: a PDZ (PSD95-, DLG-, ZO-1), a SH3 (Src homology 3) and aGUK (guanylate kinase homologue) domain (Anderson, 1996;Caruana, 2002; Dimitratos et al., 1999). Additionally to these threedomains MPP4 exhibits two L27 domains at the N-terminal part of theprotein (Stöhr et al., 2003).

Previously, we described the existence of a protein scaffoldcontaining MPP4, PSD95, DLG1 and VELI3, localized at the presynapticplasma membrane of the mouse photoreceptor synapse. Members of

ds).

l rights reserved.

this complex were identified by studying Mpp4 mutant mice. In thesemice only the N-terminal part of MPP4 containing two L27 domainsis expressed. This truncated form of MPP4 leads to a loss of PSD95and VELI3 at the photoreceptor synapse, without changing the signalfor DLG1 at the presynaptic plasma membrane. Plasma membraneCa2+-ATPases (PMCAs) were suggested to be involved in thecomplex, but no functional differences were found in the electro-retinograms (ERGs) of these Mpp4 mutant mice compared to theirwild type littermates (Aartsen et al., 2006). In contrast, anindependent Mpp4 gene targeted mouse line, generated by Yang etal. (2007), showed changes in the b-wave of the ERG due to thecomplete loss of PMCAs from the photoreceptor terminal upon MPP4deficiency. From now on, we will address our Mpp4 mutant mouse asMpp4L27/L27 (Aartsen et al., 2006) to clearly discriminate it from theMpp4 null mouse (Yang et al., 2007).

PMCAs are ATP-driven ten-membrane spanning proteins that areresponsible for the continuous extrusion of cytosolic Ca2+ from thesynaptic terminals into the extracellular space (Carafoli, 1989). Fourgenes encoding PMCA1–4 are described in mammals. Transcripts arealternatively spliced to generate several variant proteins that are inturn post-translationally modified. Alternative splicing of exonsencoding the C-terminal tail affects pump regulation due todifferences in binding to calmodulin, phosphorylation, and different

Fig. 1. Mutant MPP4 and PSD95 proteins. The protein–protein interacting domains ofwild typeMPP4 are shown together with the epitope of theMPP4 antibody used and thedomains of the truncated form ofMPP4 present in theMpp4L27/L27mouse. The epitope ofthe PSD95 antibody used is able to recognize the second/third PDZ domains of the wildtype PSD95 isoforms (PSD95α containing the palmitoylated cysteines 3 and 5, CxC; andPSD95β containing the N-terminal L27 domain) aswell as the truncated PSD95 isoformspresent in the PSD95 mutant mouse.

157W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

interaction with PDZ domain-containing anchoring proteins. PMCAsbelong to the family of P-type primary ion transport ATPases andthey are expressed ubiquitously (Strehler and Zacharias, 2001;Strehler et al., 2007b; Tempel and Shilling, 2007). Three of the fourPMCAs are present in the photoreceptor synapse; PMCA1, PMCA2and PMCA4 (Krizaj et al., 2002; Stauffer et al., 1995). Together withthe Na+/Ca2+ exchanger (NCX), the dominant Ca2+ extruder incones, and the Sarco/Endoplasmic Reticulum Ca2+-ATPases (SER-CAs), which pump the cytosolic Ca2+ into the lumen of theendoplasmic reticulum, PMCAs are the main regulators of thepresynaptic Ca2+ concentration and subsequently of the neurotrans-mitter release (Morgans et al., 1998; Johnson et al., 2007). At theplasma membrane, PMCA1 and PMCA2 colocalize with the MPP4complex. Although it has not been proven that they form onecomplex, MPP4 is involved in the stabilisation of these PMCAs at theplasma membrane (Yang et al., 2007). In this paper, we show thatespecially the two L27 domains of MPP4 are responsible for therecruitment of PMCAs towards the photoreceptor terminal, however,these domains are not sufficient to target or maintain the complexcorrectly at the presynaptic plasma membrane.

Since PSD95 is lost from the synapse in both Mpp4L27/L27 andMpp4 knockout mice, the changes in PMCA localization mayindirectly be due to the loss of PSD95. Importantly, it has beenshown that PMCA2b and PMCA4b are able to interact with PSD95(Demarco and Strehler, 2001). For this reason we studied the role ofPSD95 in this complex more extensively. PSD95 is a member of theMAGUK family and a scaffold protein involved in the homing ofseveral important membrane proteins, including the serotoninreceptor (Becamel et al., 2004; Colledge et al., 2003). PSD95 itselfhas two different isoforms. The predominant isoform is PSD95α,which has a palmitoylated N-terminus that appears to beparticularly important for its synaptic targeting and dimerisation(Chetkovich et al., 2002; El Husseini et al., 2000; Xu et al., 2008;Hsueh et al., 1997). PSD95β contains a N-terminal L27 domain andexhibits calcium-calmodulin dependent regulation (Schluter et al.,2006; Xu et al., 2008; Chetkovich et al., 2002; Hsueh et al., 1997).Each isoform has its own regulatory effect on, for instance, theAMPA receptor mediated excitatory postsynaptic currents (Schluteret al., 2006). In the retina, we found mRNA transcripts for bothPSD95 isoforms and by using a lentivirus-mediated molecularreplacement strategy, we show that PSD95β is essential for thecorrect localization of MPP4 and PMCAs at the plasma membrane ofphotoreceptor synapses. Since loss of MPP4 affects retinal signalling(Yang et al., 2007), both Mpp4 and Psd95 are candidate eye diseasegenes.

Results

MPP4 and PSD95 mutant proteins

In this study we investigated the role of MPP4 and PSD95 onthe localization of PMCAs at the presynaptic plasma membrane ofthe photoreceptor terminal. The different investigated forms of theproteins MPP4 and PSD95 are depicted in Fig. 1 and the results areseparately outlined in the following paragraphs.

Abnormal localization of PMCA1 in photoreceptor terminals ofMpp4L27/L27 mice

Colocalization of MPP4 with PMCAs at the presynaptic plasmamembrane of photoreceptor terminal could be observed afterimmunofluorescent staining using pan-PMCA antibody and MPP4antibody on wild type retina (Figs. 2A–C). To delineate the exactlocalization of the PMCA isoform 1 (PMCA1), we also used an isoform-specific antibody. These stainings confirmed the presence of PMCA1 atthe photoreceptor presynaptic plasma membrane as described by

Krizaj et al. (2002) (Figs. 2D–F). Due to the combination of hosts thatthese antibodies originated from, we could only establish colocaliza-tion with another member of the protein-complex, PSD95, and notwith MPP4. Similar analysis on the Mpp4L27/L27 retinas revealed adifferent localization for PMCA1 in the photoreceptor terminal andloss of PSD95 (Figs. 2G–I). To investigate in more detail thelocalization of PMCA1 in the photoreceptor terminals, we performedimmuno-EM using the same PMCA1 antibody. The labelling showsthat PMCA1 in wild type animals is found throughout the wholepresynaptic plasma membrane of both photoreceptor rods and cones,of which only rods are shown in Figs. 3A, B. In Mpp4L27/L27

photoreceptor terminals, a substantial amount of PMCA1 labellingwas detected in membrane structures away from the presynapticplasma membrane (Figs. 3C–E), demonstrating abnormal localizationof PMCA1 upon an impaired MPP4 function.

At the level of confocal microscopy, no clear difference could beobserved for the localization of PMCA2 following the expression ofMPP4L27 (Figs. S1A–F). Using the electron microscope, it was revealedthat PMCA2 clusters in adjacent synapses, such that the clusters faceeach other across the plasma membrane (Figs. S2A, B, D). Further-more, PMCA2 labelling was also observed at the invaginations ofbipolar cells (Figs. S2C, D), which confirmed its previous describedlocalization (Krizaj et al., 2002). Besides its correct localization, asubstantial amount of PMCA2 labelling could be found in membranestructures within the cytoplasm, suggesting abnormal localization forPMCA2 in the Mpp4L27/L27 photoreceptor terminals (Figs. S2C, E, F).

Protein levels of all four PMCA isoforms are unaltered in Mpp4L27/L27

retinas

To test whether the abnormal localization of PMCA1 and PMCA2 inthe Mpp4L27/L27 photoreceptor synapse results in changes in theexpression levels of both mRNA and protein of all PMCA isoforms, weperformed real-time qPCR with described primers (Table 2) andWestern blotting. No significant increase in mRNA of PMCA1, PMCA3and PMCA4 could be detected, whereas an increase was observed inthe mRNA of PMCA2 (Table 1).

Using Western blotting, the relative amounts of PMCA1, PMCA2and PMCA3 (migrating at around 130 kDa) in comparison to actin(migrating at around 75 kDa) were determined (Fig. 4). No significantdifferences could be observed in the PMCA/actin ratios for PMCA1–3between wild type and Mpp4L27/L27 retinas (data not shown). PMCA4

Fig. 2. Localization of PMCA1 in the Mpp4L27/L27 photoreceptor terminal. Immunohistochemical stainings depicting the localization of PMCA, MPP4 and PSD95 in photoreceptorsynapses of wild type andMpp4L27/L27 retinas. (A) pan-PMCA inwild type retina, (B) MPP4 inwild type retina, (C) merge of pan-PMCA andMPP4 inwild type retina. The PMCA signalis present in the outer plexiform layer (OPL) in photoreceptor synapses and in the inner plexiform layer (IPL). The signal for MPP4 is mainly found in the OPL and colocalizes with thePMCA signal. (D) In thewild type retina, specific PMCA1 signal is found at the presynaptic plasmamembrane of the photoreceptor terminal and this signal colocalizes with the PSD95signal (E), as shown in the merged image (F). The signal for PMCA1 in the Mpp4L27/L27 retina is not restricted to the presynaptic plasma membrane but spreads widely at thephotoreceptor terminal (G, I), while the signal for PSD95 is completely lost from the terminal area (H, I). Note that the green signal in H is due to aspecific binding of the secondaryanti-mouse antibody. Stainings were performed twice on six independent animals per group at the age of 3 months. ONL, outer nuclear layer; OPL, outer plexiform layer; INL, innernuclear layer; IPL, inner plexiform layer. Scale bars are 10 μm.

158 W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

protein levels could not be established due to theweak signal detectedon Western blot using the JA-9 antibody against PMCA4. Thus,although mRNA levels of PMCA2 were elevated, no differences inPMCA protein levels were detected between wild type and Mpp4L27/L27 retinas.

Ribbon length is affected in Mpp4L27/L27 retinas

Abnormal localization of PMCAs in the photoreceptor terminal islikely to influence the local calcium handling. However, ERGdifferences could not be established in the Mpp4L27/L27 mice (Aartsenet al., 2006). Ribbon length changes upon light adaptation and localcalcium concentrations (Spiwoks-Becker et al., 2004). Ribbon length(n=50) was determined on electron microscopic pictures of rodphotoreceptor synapses derived from light-adapted wild type(n=4) and Mpp4L27/L27 mice (n=4), as the distance between theactive zone and the top of the ribbon (Fig. S3). Mean ribbon lengthin the Mpp4L27/L27 synapses was 0.58±0.03 μm significantly enlargedcompared to 0.48±0.02 μm in the wild type synapses (Mann–Whitney U test: p=0.02), indicative of a changed local calciumconcentration in the Mpp4L27/L27 synapses. This feature is also seen intheMpp4 knockoutmousewithout affecting overallmorphologyof thephotoreceptor terminal (Yang et al., 2007).

MPP4L27-GFP fusion protein is not specifically localized at thepresynaptic plasma membrane

The Mpp4 transcript levels were two-fold reduced in Mpp4L27/L27

retina compared to Mpp4+/+ retinas (Table 2). The Mpp4L27

transcript was determined as described in material and methods.The open reading frame in the Mpp4L27 mRNA codes for two N-terminal L27 domains but, as expected (Aartsen et al., 2006), lacksthe PDZ, SH3 and GUK domains. The two L27 domains weresubcloned into the pEGFP-N3 vector resulting in a CMV promoterdriven MPP4L27-GFP fusion protein. This construct was electropo-rated into both wild type and Mpp4L27/L27 retinas to determine thelocalization of the MPP4L27-GFP fusion protein. It was detected inphotoreceptor cells in a comparable expression pattern in wild typeand Mpp4L27/L27 retinas (Figs. 5A, B). The MPP4L27-GFP fusion proteinexpressed in the wild type retina was detected throughout thephotoreceptor but was absent from the presynaptic plasma mem-brane, the normal localization for MPP4. No colocalization wasobserved with MPP4 or PSD95 (Figs. 5C–E) or synaptosomalassociated protein 25 (SNAP25), a non-related presynaptic plasmamembrane protein that acts as a receptor for the synaptic vesiclesmembrane protein synaptobrevin (Morgans et al., 1996) (Fig. 5F). InMpp4L27/L27 terminals, in the absence of MPP4 and PSD95, no

Fig. 3. Immuno-EM shows abnormal localization of PMCA1 in theMpp4L27/L27 photoreceptor terminal. Immuno-EM pictures of the wild type photoreceptor rod terminals show thatthe 10 nm gold particles labelling PMCA1 are located in the presynaptic plasma membrane (arrow-heads in A, B). In the Mpp4L27/L27 photoreceptor synapse, large amounts of goldparticles labelling PMCA1 (double arrows-heads) are observed in membrane structures in the cytosol (C–E). Stainings were performed twice on four independent animals per groupat the age of 3 months. R, ribbon; H, horizontal cell; mi, mitochondrion. Scale bars are 500 nm.

159W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

colocalization was detected between the MPP4L27-GFP fusion proteinand PMCA1 (Fig. 5G).

MPP4-complex members localize normally in Psd95 mutant retinas

Both Mpp4 null and Mpp4L27/L27 mouse strains lack the stainingfor PSD95 at the presynaptic plasma membrane and the total amountof PSD95 protein is strongly reduced (Aartsen et al., 2006; Yang et al.,2007). The Psd95-mutant mouse model (Migaud et al., 1998) wasused to study the role of PSD95 in the correct localization of PMCAs atthe presynaptic plasma membrane of photoreceptors. As describedpreviously, this mouse model is expressing a truncated form of PSD95,

Table 1Results of the qPCR in fold change.

Gene name qPCR (fold change) p value

PMCA1 +2.5 0.3PMCA2 +4.6a 0.001a

PMCA3 +2.2 0.003PMCA4 −1.1 0.8Mpp4 −2.1 0.002

− and + indicate lower and higher expression levels in the Mpp4L27/L27 retinacompared to wild type, respectively.; p values were calculated using the Student's t testwith two tails.

a A difference in mRNA expression of more than 2-fold was considered to besignificant.

which lacks the SH3 and GUK protein–protein interaction domains,while leaving the first two PDZ domains intact (Fig. 1). The synapticplasticity in these mice is changed, as shown by the enhanced long-term potentiation (LTP) and reduced long-term depression (LTD).This leads to a defect in learning and memory, while the expressionlevels and the localization of the NMDA-receptor is unaffected(Migaud et al., 1998). Immunofluorescent stainings show that thelocalization of truncated PSD95 (Figs. 6A–F), MPP4 (Figs. 6G–L) andVELI3 (data not shown), as well as PMCA1 (Figs. 6A–L), DLG1 andPMCA2 (Figs. S4A–F) was unaffected in the photoreceptor synapses of

Fig. 4. PMCA protein levels are not affected by the loss of MPP4. Protein levels forPMCA1, 2 and 3 were determined in 2 animals per genotype (+/+ and L27/L27). Actinprotein levels were used as loading control. The LI-COR's Odyssey imager was used tocalculate the ratio between PMCA and actin protein levels. No significant differenceswere found between the ratios. +/+, Wild type; L27/L27, Mpp4L27/L27.

Table 2qPCR primers.

Gene ID 5′-primer 3′-primer

PMCA1 GCCATAGTACATTGGGCCTTTC ATCGCAGCTCCTTCAATCCA(Duncan et al., 2006)

PMCA2 ACTCCTGGGTCAGCATTCC TAGTAGCACGAGCGGTCA(Duncan et al., 2006)

PMCA3 GGCCTCTCCTTCTATGCACCTC CTGCCCCACCAGACACATTC(Duncan et al., 2006)

PMCA4 TCCCAGTGGCTGAGATTGTG TCTTCAGATCATTTTCCCTGGATTAG(Duncan et al., 2006)

Psd95α CCCCAACATGGACTGTCTCT ACTCCATCTCCCCCTCTGTTPsd95β TGACTAAGTGGACATCCTGGAC ATATCCTGGGGCTTCTAGGGMpp4 AAGGATGAAGACCTACAAGAGATGGA TGATCAAAAAACTGGCCAAACTGACTG1a ACCAACAGCAGACTTCCAGGAT AGACTGGCAAGAAGGAGTGGTAARS27aa AAGGTGGATGAAAATGGCAAA CCATGAAAACTCCCAGCACCA

a Reference genes.

160 W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

Psd95mutant retinas compared towild type retinas (Figs. 6A–L). Theseresults indicate that the SH3 and GUK domains of PSD95 are notessential for correct localization of PMCA1 and 2 or MPP4 atphotoreceptor synapses.

PSD95β is involved in the correct localization of the MPP4-complexmembers

According to the results obtained with the Psd95 mutant mousemodel, the C-terminus of PSD95 is not required for the correctlocalization of PMCAs at the photoreceptor plasma membrane. So weinvestigated the importance of the N-terminal part of PSD95. Twoisoforms of PSD95 that differ in the N-terminus can be discriminated:PSD95α that contains two palmitoylation sites and is the most

Fig. 5. The MPP4L27-GFP fusion protein is not observed at the presynaptic plasma membraneexplants. GFP expression is observed throughout the photoreceptor cell with a pattern oterminals. A and B are 3D projections of a 1.0 μm z-stack (n=12) and scale bars are 2.5 μm.and PMCA1 revealed no specific presynaptic plasma membrane localization for the MPP4Mpp4L27/L27; L27-GFP, MPP4L27-GFP; WT, wild type.

prominent isoform found in neuronal tissues, and PSD95β that lacksthe palmitoylation sites but contains a single L27 protein–proteininteraction domain. Transcripts for both isoforms can be found in theretina (Fig. S5). To study which of the PSD95 isoforms is involved inthe correct localization of PMCAs at the presynaptic plasmamembrane of photoreceptor terminals, we used a lentivirus-mediatedmolecular replacement strategy. Lentiviral vectors were electropo-rated into primary retina cultures resulting in down regulation ofboth endogenous PSD95 isoforms via H1-driven transcription ofshRNA against Psd95. Simultaneously, the ubiquitin promoter wasused to drive expression of either GFP, PSD95α fused to GFP, orPSD95β fused to GFP. The Psd95 shRNA does not recognize thetranscript encoding PSD95α or PSD95β fused to GFP, due to silentmutations (Schluter et al., 2006). The photoreceptors electroporatedwith the vector expressing Psd95 shRNA and GFP were positive forGFP, while down regulation of PSD95 was demonstrated by the lack offluorescent (red) signal in the antibody staining used to detect PSD95(Fig. 7A). Loss of PSD95 in photoreceptors expressing Psd95 shRNA ismore clearly seen in 3-dimensional reconstructions, as shown in thesupplementary data (Supplementary Movie 1A). PSD95 downregulation is observed in 76% of the synapses (n=50). PSD95 downregulation is accompanied by the loss of MPP4 (Fig. 7B andSupplementary Movie 1B) and PMCA1 (Fig. 7C and SupplementaryMovie 1C) in 68 and 74% of the synapses, respectively. Previously, wehave shown that MPP4 is required for correct localization (andstabilisation) of PSD95 (Aartsen et al., 2006), additionally the dataabove suggest that PSD95 in turn is required for correct localization ofMPP4.

In case of endogenous PSD95 down regulation, the expressedfusion protein PSD95α-GFP can be found throughout the wholephotoreceptor in wild type (Figs. S6A, B) and Mpp4L27/L27 retinal

. The MPP4L27-GFP fusion protein was expressed via electroporation into primary retinaf concentrated GFP spots towards wild type (A) and Mpp4L27/L27 (B) photoreceptor(C–G) Immunohistochemical stainings using antibodies against MPP4, PSD95, SNAP25L27-GFP fusion protein. Stainings were performed twice. Scale bars are 5 μm. L27/L27,

Fig. 6. Normal localization of MPP4-complex members in the Psd95 mutant retina. Immunohistochemistry shows wild type localization of PSD95 (A) and PMCA1 (B) at thepresynaptic photoreceptor plasma membrane. Using the antibody against the N-terminal part of PSD95 enabled visualization of truncated PSD95 at the presynaptic plasmamembrane in the Psd95mutant terminals (D). Correct localization shown for PMCA1 Psd95mutant photoreceptor terminals (E) and confirmed by the staining with pan-PMCA (G, J).The presynaptic plasma membrane localization of MPP4 in wild type (H) and Psd95mutant (K) photoreceptor terminals. (C, F, I, L) Merged signals showing colocalization. Stainingswere performed twice on three independent animals per group. Scale bars are 10 μm.

161W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

explants (data not shown). In contrast, the expressed fusion proteinPSD95β-GFP, in the absence of endogenous PSD95, is observedmainly in the synapse of the photoreceptors at the plasma membrane(Fig. 7D and Supplementary Movie 1D). In addition, when the sameprotein is expressed in the Mpp4L27/L27 retina, only a few cells arepositive and the protein is not found at the presynaptic plasmamembrane (Figs. S6C, D). These last observations show that PSD95βis the only isoform recruited specifically towards the presynapticmembrane of the photoreceptor. Moreover, 92% of the wild typesynapses that express the PSD95β-GFP fusion protein are alsopositive for MPP4 and PMCA1 (Figs. 7E, F), while the endogenousPSD95 is down regulated. Thus, the loss of the MPP4/PSD95/PMCAcomplex in photoreceptor synapses that lack PSD95 can be rescuedby expression of PSD95β. These results indicate that the PSD95βisoform is part of the MPP4-complex and involved in the correctlocalization of PMCAs at the plasma membrane of the photoreceptorterminal.

Discussion

Scaffold proteins are indispensable for assembling importantproteins like adhesion molecules, cytoskeletal proteins, receptors,and ion channels at restricted areas of the plasma membrane. Aunique scaffold complex consisting of MPP4/PSD95/VELI3/DLG1(Aartsen et al., 2006) is involved in the retention of PMCAs at thepresynaptic plasma membrane of the photoreceptor terminal. Here,we demonstrate that in this process, the two L27 domains at theN-terminal part of MPP4 are responsible for the recruitment of PMCAstowards the photoreceptor terminal. MPP4's C-terminal part togetherwith PSD95β is involved in the specific localization of PMCAs at thepresynaptic plasma membrane.

Four different PMCAs can be distinguished (PMCA1–4) of whichPMCA1, PMCA2 and PMCA4 are present in the photoreceptor synapse(Stauffer et al., 1995; Krizaj et al., 2002). These calcium extruders are

involved in the precise regulation of the cytosolic and local calciumhomeostasis (Strehler et al., 2007a). In wild type animals, PMCA1signal was found along the plasma membrane of the photoreceptorsynapse. PMCA2 was found in clusters in the plasma membrane atadjacent synapses, both patterns are in accordance with previouslydescribed results (Krizaj et al., 2002). A comparable non-uniformdistribution for PMCAswas found in the cerebellar cortex (Burette andWeinberg, 2007). Complete loss of PMCAs from the photoreceptorterminals was observed in the Mpp4 knockout mouse, due to thecomplete absence of MPP4 (Yang et al., 2007). In contrast, in theMpp4L27/L27 retina, PMCAs are maintained at the photoreceptorterminal. However, the PMCA1 staining is not restricted to the plasmamembrane as seen in thewild type photoreceptor terminals. Immuno-EM showed that a significant amount of PMCA1 and PMCA2 waslocalized at synaptic membrane structures away from the presynapticplasma membrane. Therefore, the data suggests that MPP4L27 isinvolved in the retention or recruitment of PMCA1 and PMCA2 at thephotoreceptor terminal.

The Mpp4L27/L27 mutant carries a hygromycin resistance cassetteinserted between exon 6 and exon 9 (Aartsen et al., 2006). A mRNAtranscript is still produced from this allele, leaving the possibility fortranslation of the N-terminal part encoding the two L27 domains ofMPP4. Expression of the L27 domains of MPP4 fused to GFP in wildtype and Mpp4 mutant retina resulted in concentrated spots insidethe photoreceptor cell but absent from the synapse. No MPP4L27-GFPstaining was observed in both wild type and Mpp4L27/L27 mutantphotoreceptor terminals, as MPP4, PSD95, SNAP25, and PMCA1 didnot colocalize with the MPP4L27-GFP fusion protein. The abovedescribed expression pattern of MPP4L27-GFP fusion protein differsat the photoreceptor terminal from the GFP expression found in cellselectroporated with wild type GFP expression vector (together withshRNA against Psd95). In cells in which PSD95 was insufficientlydown-regulated the GFP signal overlapped with the signal for MPP4,PSD95 or PMCA1. Additionally, the MPP4L27 in Mpp4L27/L27 retinas

Fig. 7. PSD95β is a crucial member of the MPP4-complex and essential for the correct localization of PMCA1. Lentivirus-mediated molecular replacement strategy was used to downregulate endogenous Psd95 expression and simultaneously express GFP, PSD95α-GFP or PSD95β-GFP in the electroporated cells of primary retina explants. (A) In wild type retinas,down regulation of endogenous PSD95 in photoreceptors is observed as lack of immunostaining for PSD95 (red color) in 76% of the electroporated cells (green GFP positive cells).(B) The down regulation of endogenous PSD95 results in 68% of the electroporated cells in the loss of immunostaining for MPP4 (red color) and (C) in 74% of the electroporatedcells in the loss of immunostaining for PMCA1 (red color). The signal for fusion protein PSD95β-GFP in wild type photoreceptors was observed mainly at the presynaptic plasmamembrane confirmed by the immunostaining for PSD95 (D). In 92% of the electroporated wild type photoreceptors, the presynaptic plasma membranes became positive for MPP4(G) and PMCA1 (H) when the fusion protein PSD95β-GFP is present while endogenous PSD95 is down regulated. Highlighted are the presynaptic localization of PSD95β-GFPdetected with anti-PSD95 (G) and its colocalization with MPP4 (H) and PMCA1 (I), all in the absence of endogenous PSD95. ONL, outer nuclear layer; OPL outer plexiform layer; INL,inner nuclear layer. Scale bars are 10 μm.

162 W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

does not co-localize with the PMCA1 localized at synaptic membranestructures away from the presynaptic plasma membrane. However,the two N-terminal L27 domains of MPP4 expressed in Mpp4L27/L27

retinas appeared essential to retain PMCA1 at the photoreceptorsynapse. We hypothesize that the two L27 domains of MPP4 arenecessary to get the PMCA1 towards the photoreceptor terminals buttheir interaction is temporary and not sufficient to localize PMCA1 atthe presynaptic plasma membrane. This might be due to impairedtransport towards the presynaptic plasma membrane or to instabilityof the complex formed. Both PSD95 andMPP4 are required for a stablePMCA1 complex at the plasma membrane of photoreceptor synapses.

PMCAs are the predominant Ca2+ extruder in photoreceptorsynaptic terminals pumping Ca2+ across the plasma membrane(Morgans et al., 1998; Krizaj et al., 2002; Thoreson, 2007), and they

are essential in proper signal transduction, since spatial and temporalCa2+ fluctuations modulate the glutamate release upon lightexposure. It should be emphasized that PMCA retention in theendoplasmic reticulum results in their inactivity, as shown formutations N879D or Q971E in PMCA, or PMCA overexpression(Guerini et al., 1996; Brini et al., 2000). Thus, abnormal localizationof PMCA could change the synaptic Ca2+ homeostasis and subse-quently the glutamate release. That synaptic transmission is indeedaffected by the lack of functional PMCA2, is shown by the flattenedERG in the deafwaddler mouse (Duncan et al., 2006).

The synaptic ribbons in the Mpp4L27/L27 mutant were elongatedcompared to thewild type ribbons. Longer ribbons have been linked toaltered cytosolic Ca2+ homeostasis (Spiwoks-Becker et al., 2004), andthe difference in length is comparable to the findings described for the

163W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

Mpp4 knockout mouse (Yang et al., 2007). Adaptive and compensa-tory mechanisms other than those mediated by PMCA isoforms (Fig.3), such as SERCA2 and IP3RII might contribute to the fact that thechanges in cytosolic Ca2+ homeostasis were not translated into analtered ERG, which is in contrast with the altered ERG found in theMpp4 knockoutmice (Yang et al., 2007). Alternatively, the discrepancymight be due to different ERG recording conditions or the fact thatabnormal localization of PMCA as seen in the Mpp4L27/L27 mutantresults in just a minor reduction of its efficiency in calcium extrusion.

The lack of PSD95 in the photoreceptor synapses is amutual featureof the Mpp4 knockout and Mpp4L27/L27 mutant mice. Recently, it hasbeen described that Psd95 mRNA is localized at the neuronal synapseand its stability is a key determinant in the appearance of fragile Xmental retardation (Zalfa et al., 2007). Moreover, PSD95 has beendescribed to have an important role in the localization of the serotoninreceptor (Becamel et al., 2004; Gavarini et al., 2006) and the AMPAR atthe plasma membrane (Xu et al., 2008). For the AMPARs, the C-terminal end of PSD95 is required for recruitment towards thepostsynaptic density. Here, we investigated the role of PSD95 in thelocalization of the MPP4-complex members at the plasma membrane.

Firstly, we tested the presence of MPP4, PMCA1 and PMCA2 at theplasmamembrane of the photoreceptor synapse of Psd95mutant eyesgenerated by Migaud et al. (1998). In these mutants, all MPP4-complex members were still present at the plasma membrane in theabsence of the C-terminal part of PSD95 encoding the SH3 and GUKdomains. The PMCA “b”-splice forms are able to bind PDZ domains ofPSD95 and SAP97 via their C-terminus (Demarco and Strehler, 2001).Since only the C-terminal part of PSD95was absent in the eyes of thesemice, the N-terminal part containing the PDZ and L27 or palmitoyla-tion domains seem to be sufficient to keep the full complex at itscorrect position at the presynaptic plasma membrane. On the otherhand, the C-terminal part of PSD95 has a function in the AMPARcalcium sensing and the coupling to intracellular signalling cascades,in addition to its role in the correct localization of AMPAR at thepostsynaptic density (Xu et al., 2008; Schluter et al., 2006). Whetherthe regulation or turnover of PMCA at the plasma membrane or itsefficiency was unaffected in these Psd95 mutant photoreceptorsynapses is unclear.

Secondly, we focused on the N-terminal end of PSD95. Alternativesplicing of the N-terminus results in PSD95β containing a L27 domaininstead of a pair of cysteines subjected to palmitoylation in PSD95α(Chetkovich et al., 2002; El Husseini et al., 2000). Both isoformsexhibit different ways of clustering at the plasma membrane andregulation of the coupled effector protein. Via a lentivirus-mediatedmolecular replacement strategy designed by Schluter et al. (2006),we were able to separately express the two isoforms and study theireffect on the other MPP4-complex members. Efficient down regula-tion of endogenous PSD95 was found in 76% of the electroporatedphotoreceptors, which resulted in the loss of MPP4 and PMCA1. Theseresults are in agreement with the results from the Mpp4 knockoutmouse (Yang et al., 2007), where the absence of MPP4 results in acomplete loss of PMCA from the presynaptic plasma membrane.Thus, not only the presence of MPP4 but also that of PSD95 is crucialfor the maintenance of the whole complex at the plasma membrane.While endogenous PSD95 was down regulated, we expressed aPSD95α-GFP or PSD95β-GFP fusion protein. Bipolar, ganglion andphotoreceptor cells were positive for PSD95α expression, in the latterthe signal was present throughout the whole cell. In contrast, PSD95βspecifically localized at the presynaptic membrane of the photo-receptor. However, in the Mpp4L27/L27 mutant photoreceptor, thesignal for PSD95β was strongly reduced and no longer restricted tothe presynaptic membrane. While present at the presynapticmembrane, PSD95β is accompanied by MPP4 and PMCA1. Thus, inthe absence of endogenous PSD95, expression of PSD95β restored theMPP4-complex at the plasma membrane, which strongly suggeststhat PSD95β is an essential member of the MPP4-complex and crucial

for the correct localization of PMCAs. Indeed, MPP4 selectivelyassociates with PSD95β via interactions between their L27 domains(Förster et al., 2009). However, the presence of only the two L27domains of MPP4 is not enough to retain PSD95β at the presynapticplasma membrane. Interestingly, defects in both MPP4 and PSD95βcan be causal to impaired calcium handling via changes in the PMCA-dependent calcium extrusion from the photoreceptor synapse. Thus,mutations in the human MPP4 as well as the PSD95 gene might becausal to a changed visual perception.

Experimental methods

Mpp4 knockout model

As described previously, we used homozygous Mpp4L27/L27 miceobtained by generating a mutant Mpp4 allele that contains a frameshift in the beginning of exon 7, which encodes the PDZ domain ofMPP4 (Aartsen et al., 2006). The homozygous Mpp4L27/L27 as well asthewild typemouse stocks weremaintained as a cross of C57BL/6 and129/Ola (50%/50%). The mouse stocks were kept at a 12 h dark/12 hdimmed light cycle (100 lx). Psd95 mutant mice were generated asdescribed previously byMigaud et al. (1998). All animals were treatedaccording to the guidelines established at the institutions inwhich theexperiments were performed.

Immunohistochemical analysis

Eyes fromMpp4L27/L27 mice and their wild type littermates, as wellas from Psd95 mutant mice and their wild type littermates wereenucleated and embedded for cryosections or paraffin sections.Cryosections (7 μm) and paraffin sections (4 μm) were used for theimmunohistochemical analysis of several proteins that are localized inthe outer plexiform layer (OPL), as described previously (Aartsen etal., 2006). Epitopes used to raise antibodies against MPP4 aredescribed by van de Pavert et al. (2004) and Kantardzhieva et al.(2005). The anti-MPP4 (AK4) antibodies were raised against aminoacids 345–359. Primary antibodies against PSD95 and pan-PMCA(5F10) were purchased from Affinity Bioreagents, and antibodiesagainst PMCA1–4 from Sigma-Aldrich. The PMCA4 (JA-9) antibodywas a gift from A. Filoteo. Secondary antibodies were IgGs conjugatedto Cy3, Alexa488, or FITC (Jackson ImmunoResearch and Invitrogen).For immunohistochemistry on cryosections, the sections wererehydrated in PBS and blocked for 1 h in 10% normal serum, 0.4%Triton X-100 and 1% bovine serum albumin (BSA) in PBS, followed bythe incubation overnight at 4 °C with primary antibody in 0.3% serum,0.4% Triton X-100 and 1% BSA in PBS. Sections were washed threetimes with PBS and incubated with secondary antibody diluted in 0.1%serum and 1% BSA in PBS at room temperature for 1 h. Paraffinsections were deparaffinised, boiled for 7 min in EDTA buffer (4 mMTris, 1 mM EDTA, pH 8.0) using a microwave and slowly cooled toroom temperature (2 h). After 1 h of blocking with 10% serum and 1%BSA in PBS, the primary antibody (in 1% BSA in PBS) was applied,followed by overnight incubation at 4 °C. After washing three timeswith PBS the sections were incubated with secondary antibody (in0.1% BSA in PBS) at room temperature for 1 h. Evaluation of thestaining was performed using a confocal laser scanning microscopy(Zeiss 501) and pictures were made with Zeiss LSM image browserv3.2. All stainings were repeated at least twice.

Immuno-electron microscopy

Protocols for immuno-EM were described previously (Aartsen etal., 2006; van Rossum et al., 2006). In short, four Mpp4+/+ and fourMpp4L27/L27 female animals at the age of 3monthswere sacrificedwithan overdose of pentobarbital. The thoraxwas opened and a needlewasplaced in the left cardiac ventricle for retrograde perfusion-fixation

164 W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

(1 min pre-perfusion: 0.1 M sodium cacodylate in saline; pH 7.4;3–5 min perfusion fixation: 1% paraformaldehyde, 1.25% glutaralde-hyde in 0.1 M sodium cacodylate buffer; pH 7.4). The eyes wereenucleated and fixed in 4% paraformaldehyde, 0.1 M sodiumcacodylate in saline for 30 min followed by incubation with 5%sucrose for 30 min and 30% sucrose overnight. The cryosubstitutionmethod used in this study is a slight modification of that described formammalian retina (Brandstatter et al., 1999). Because of the light-dependent variation in ribbon length (Adly et al., 1999), ribbon lengthwas determined on ultrathin sections of the eyes from light adaptedanimals, all sacrificed after 2 h of light adaptation. Mann–Whitney Utest was performed using 4 animals per group of which 50 ribbonsweremeasured per animal (Fig. S3). Moreover, ultrathin sections wereincubated overnight at 4 °C with primary antibodies (rabbit polyclonalagainst PMCA1 or PMCA2, from Sigma) diluted 1:20 or 1:10 in 2% goatserum in 0.05 M Tris-buffered solution (TBS) pH 7.6. After washingwith 5% goat serum in TBS, the sections were incubated at roomtemperature for 1 h with colloidal gold 10 nm-conjugated goat anti-rabbit IgGs diluted 1:25 in 2% goat serum in TBS. The immunostainedultrathin sections were examined with a Zeiss 912 EM.

PCR, sequencing and real-time quantitative PCR

Protocols were adapted from van de Pavert et al. (2007a,b) withminor modifications. Total RNA was isolated from mouse retinas,obtained from sixMpp4+/+ and sixMpp4L27/L27 female animals at theage of 3 months, using Trizol reagent (Invitrogen). For each sample,1 μg total RNA was used to produce cDNA with Superscript III PlusRNase H-reverse Transcriptase (Invitrogen) using random hexamerprimers at 50 °C during 50 min, according to the manufacturer. Toverify the sequence of the truncated Mpp4 mRNA produced inMpp4L27/L27 mice, 100 ng of cDNA was used as template in a PCR withforward primer 5′-CCC GAC AGT GAA GAA GCA AT-3′ located in exon 6and reverse primer 5′-TGGGGCCAGTAATCAATCAT-3′ located in exon10, followed by cloning of the resulting fragment into the pJet1.2 vector(Fermentas Life Sciences). The PCR fragment was sequenced using thepJet1.2 forward sequencing primer and a primer for the hygromycincassette: 5′-ATT TCG GCT CCA ACA ATG TC-3′. cDNAwas used for real-time qPCR (40 cycles performed according to the manufacturer) andmonitoring of SYBR Green I dye fluorescence on a ABI Prism 7300Sequence Detection System (Applied Biosystems, Nieuwerkerk a/dIJssel, The Netherlands). Primers used for PMCA1–4, PSD95α andPSD95β are described in Table 1. Values were calculated and correctedusing two amplified reference genes per sample. Expression levels inwild type specimenswere set to 100%, and expression levels inmutantmice were expressed as fold change compared to wild type,determined in three qPCR runs. Student t-test was performed forstatistic analyses. As in all PCR-based strategies, the amount of productformed doubles in each cycle. Therefore, the detection system used isnot sensitive enough to distinguish differences smaller than one cyclethreshold (CT). Thus, only a difference in mRNA expression of morethan 2-fold was considered to be significant.

Western blotting

For protein detection, retinas of Mpp4L27/L27 (n=6; 3 months ofage) and Mpp4+/+ (n=6; 3 months of age) mice were isolated.Retinas were washed in PBS and immediately snap-frozen in liquidnitrogen. Tissues were homogenised in SDS-sample buffer (0.125 MTris–HCl, 21% glycerol, 4% SDS; pH 6.8) through short ultrasonification (twice) and prolonged shaking at 14 °C until the tissueswere fully dissolved. Samples were centrifuged at 14,000 ×g at 4 °Cfor 15 min and supernatants were stored at −20 °C until further use.Protein concentrations were determined using the BCA proteindetection kit (Pierce Biotechnology, Rockford, USA). An amount of10–20 μg protein per sample was heated in sample buffer supple-

mented with DTT (50 mM) at 70 °C for 10 min and loaded onto a 9%SDS-PAGE gel (Invitrogen). After electrophoresis the samples weretransferred onto nitrocellulose membranes by wet-blotting over-night. Membranes were blocked (1% caseine in Tris-buffered saline)and protein detection was performed via primary and secondaryantibodies (conjugated to IRDye 800CW or Cy5). Bands werevisualized and quantified using the Odyssey Infrared Imaging system(LI-Cor Biosciences, Nebraska USA).

Primary retina explants

Primary retina explants were prepared as described before by vanRossum et al. (2006). Briefly, at postnatal day 1.5 (P1.5), the eyes wereenucleated and placed in a 35 mm Petri dish containing Dulbecco'smodified Eagle's media (DMEM) (Gibco 31966-021, Invitrogen,Carlsbad, CA, USA) supplemented with 100 mg/ml streptomycin and100 U/ml penicillin (Gibco 15140-122, Invitrogen). For electropora-tion the eyes were transferred to Hanks' balanced salt solution (HBSS,Gibco, 14185-45, Invitrogen). The eyes were opened along the oraserrata. The cornea, lens and vitreous were removed and the wholeretina was then carefully dissected free from the retinal pigmentepithelium (RPE) and sclera. Dissected retinas were placed into amicro-electroporation chamber (Nepagene, Chiba, Japan, modelCUY532, 3 mm×10 mm×5 mm) containing a DNA solution at aconcentration of 1 mg/ml in HBSS. DNA transfer was performed byelectroporation from the scleral side with five square pulses of 20 V of50ms durationwith 950ms intervals using the pulse generator CUY21(Nepagene). Retinas were cultured for 14–21 days on an 0.4 μm poreMillicell culture plate insert (30 mm PICM03050, Millipore, Billerica,USA) in six-well plates containing DMEM, which was refreshed every2–3 days.

DNA used for electroporation

To visualize the localization of the MPP4L27-protein in both wildtype and mutant retinas, we generated a construct encoding a fusionprotein consisting of the MPP4 L27 domains and GFP driven by theCMV promoter. A Mpp4 PCR product generated with the primers:forward 5′-GGT GGT CTC GAG CCA CCA TGA GAC AGT CTG ACA GAGGAG C-3′ and reverse: 5′-GGT GGT GGT ACC TTG ACG CTT GAT GGTTGC TCC CAG-3′was cloned into the XhoI and KpnI sites in the pEGFP-N3 vector. This construct was electroporated into the primary retina ofP1.5 mice and expression was determined 14 days later by detectingthe GFP signal using a confocal microscope.

To determine the function of PSD95α versus PSD95β in thephotoreceptor synapse to investigate the localization of MPP4 andPMCAs, we used the lentiviral vector constructs as described bySchluter et al. (2006) for electroporation into primary retina explants.All these constructs contained the FUGW vector backbone using theH1 promoter cassette to drive the expression of the short hairpintargeting Psd95. The construct that simultaneously expresses GFP viathe ubiquitin promoter was used to study the effect of PSD95 down-regulation. The two other vectors that simultaneously express eitherthe fusion protein PSD95α-GFP or PSD95β-GFP were used to studyexpression of PSD95α and PSD95β in the photoreceptor synapse,respectively. Silent mutations were introduced in the targeted regionof recombinant PSD95α and PSD95β allowing their expression in thepresence of shPsd95. Expression was determined 14 days afterelectroporation by detecting the GFP signal by confocal microscopy.

Acknowledgments

The authors would like to thank Jane Robinson and Seth Grant forthe gift of the Psd95 mutant mouse eyes. The PMCA4 (JA-9) antibodywas a kind gift of A. Filoteo. Many thanks to the lab of R. Malenka forthe generous gift of Psd95 vectors used in the lentivirus-mediated

165W.M. Aartsen et al. / Molecular and Cellular Neuroscience 41 (2009) 156–165

molecular replacement strategy. This work was technically sup-ported by E. Romero and A. van den Brink. Le Bivic's group is “Equipelabellisée de la Ligue Nationale contre le Cancer”. This work wassupported in part by Grant from the European Commission[HEALTH-F2-2008-200234 to J.W. and A.L.B.], Stichting OOG andRotterdamse Vereniging Blindenbelangen [to J.W.], ANR NeuroscienceDYOR [to A.L.B.] and by the Royal Netherlands Academy of Arts andSciences [to J.W.].

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.mcn.2009.02.003.

References

Aartsen, W.M., Kantardzhieva, A., Klooster, J., van Rossum, A.G., van de Pavert, S.A.,Versteeg, I., Cardozo, B.N., Tonagel, F., Beck, S.C., Tanimoto, N., Seeliger, M.W.,Wijnholds, J., 2006. Mpp4 recruits Psd95 and Veli3 towards the photoreceptorsynapse. Hum. Mol. Genet. 15, 1291–1302.

Adly, M.A., Spiwoks-Becker, I., Vollrath, L., 1999. Ultrastructural changes of photo-receptor synaptic ribbons in relation to time of day and illumination. Invest.Ophthalmol. Vis. Sci. 40, 2165–2172.

Anderson, J.M., 1996. Cell signalling: MAGUK magic. Curr. Biol. 6, 382–384.Becamel, C., Gavarini, S., Chanrion, B., Alonso, G., Galeotti, N., Dumuis, A., Bockaert, J.,

Marin, P., 2004. The serotonin 5-HT2A and 5-HT2C receptors interact with specificsets of PDZ proteins. J. Biol. Chem. 279, 20257–20266.

Brandstatter, J.H., Fletcher, E.L., Garner, C.C., Gundelfinger, E.D., Wassle, H., 1999.Differential expression of the presynaptic cytomatrix protein bassoon amongribbon synapses in the mammalian retina. Eur. J. Neurosci. 11, 3683–3693.

Brini,M., Bano, D.,Manni, S., Rizzuto, R., Carafoli, E., 2000. Effects of PMCA andSERCA pumpoverexpression on the kinetics of cell Ca(2+) signalling. EMBO J. 19, 4926–4935.

Burette, A., Weinberg, R.J., 2007. Perisynaptic organization of plasma membranecalcium pumps in cerebellar cortex. J. Comp. Neurol. 500, 1127–1135.

Carafoli, E., 1989. The plasma membrane calcium pump: structure, function andregulation. Biochem. Soc. Trans. 17, 808–810.

Caruana, G., 2002. Genetic studies defineMAGUK proteins as regulators of epithelial cellpolarity. Int. J. Dev. Biol. 46, 511–518.

Chetkovich, D.M., Bunn, R.C., Kuo, S.H., Kawasaki, Y., Kohwi, M., Bredt, D.S., 2002.Postsynaptic targeting of alternative postsynaptic density-95 isoforms by distinctmechanisms. J. Neurosci. 22, 6415–6425.

Colledge, M., Snyder, E.M., Crozier, R.A., Soderling, J.A., Jin, Y., Langeberg, L.K., Lu, H., Bear,M.F., Scott, J.D., 2003. Ubiquitination regulates PSD-95 degradation and AMPAreceptor surface expression. Neuron 40, 595–607.

Demarco, S.J., Strehler, E.E., 2001. Plasma membrane Ca2+-ATPase isoforms 2b and 4binteract promiscuously and selectively with members of the membrane-associatedguanylate kinase family of PDZ (PSD95/Dlg/ZO-1) domain-containing proteins.J. Biol. Chem. 276, 21594–21600.

Dimitratos, S.D., Woods, D.F., Stathakis, D.G., Bryant, P.J., 1999. Signaling pathways arefocused at specialized regions of the plasma membrane by scaffolding proteins ofthe MAGUK family. Bioessays 21, 912–921.

Duncan, J.L., Yang, H., Doan, T., Silverstein, R.S., Murphy, G.J., Nune, G., Liu, X.,Copenhagen, D., Tempel, B.L., Rieke, F., Krizaj, D., 2006. Scotopic visual signaling inthe mouse retina is modulated by high-affinity plasma membrane calciumextrusion. J. Neurosci. 26, 7201–7211.

El Husseini, A.E., Craven, S.E., Chetkovich, D.M., Firestein, B.L., Schnell, E., Aoki, C., Bredt,D.S., 2000. Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting,postsynaptic targeting, and ion channel clustering. J. Cell. Biol. 148, 159–172.

Elias, G.M., Nicoll, R.A., 2007. Synaptic trafficking of glutamate receptors by MAGUKscaffolding proteins. Trends Cell Biol. 17, 343–352.

Förster, J.R., Lochnit,G., Stöhr, H., 2009. Proteomic analysis of themembranepalmitoylatedprotein-4 (MPP4)-associated protein complex in the retina. Exp. Eye Res. 88, 39–48.

Gavarini, S., Becamel, C., Altier, C., Lory, P., Poncet, J., Wijnholds, J., Bockaert, J., Marin, P.,2006. Opposite effects of PSD-95 and MPP3 PDZ proteins on serotonin 5-hydroxytryptamine2C receptor desensitization and membrane stability. Mol. Biol.Cell 17, 4619–4631.

Guerini, D., Foletti, D., Vellani, F., Carafoli, E., 1996. Mutation of conserved residues intransmembrane domains 4,6 and 8 causes loss of Ca2+ transport by the plasmamembrane Ca2+ pump. Biochemistry 35, 3290–3296.

Hsueh, Y.P., Kim, E., Sheng, M., 1997. Disulfide-linked head-to-head multimerization inthe mechanism of ion channel clustering by PSD-95. Neuron 18, 803–814.

Johnson Jr., J.E., Perkins, G.A., Giddabasappa, A., Chaney, S., Xiao, W., White, A.D., Brown,J.M., Waggoner, J., Ellisman, M.H., Fox, D.A., 2007. Spatiotemporal regulation of ATPand Ca2+ dynamics in vertebrate rod and cone ribbon synapses. Mol. Vis. 13,887–919.

Kantardzhieva, A., Gosens, I., Alexeeva, S., Punte, I.M., Versteeg, I., Krieger, E., Neefjes-Mol,C.A., den Hollander, A.I., Letteboer, S.J., Klooster, J., Cremers, F.P., Roepman, R.,Wijnholds, J., 2005. MPP5 recruits MPP4 to the CRB1 complex in photoreceptors.Invest. Ophthalmol. Vis. Sci. 46, 2192–2201.

Krizaj, D., Demarco, S.J., Johnson, J., Strehler, E.E., Copenhagen, D.R., 2002. Cell-specificexpression of plasma membrane calcium ATPase isoforms in retinal neurons.J. Comp. Neurol. 451, 1–21.

Li, M., Zhang, S.S., Barnstable, C.J., 2003. Developmental and tissue expression patternsof mouse Mpp4 gene. Biochem. Biophys. Res. Commun. 307, 229–235.

Migaud, M., Charlesworth, P., Dempster, M., Webster, L.C., Watabe, A.M., Makhinson, M.,He, Y., Ramsay, M.F., Morris, R.G., Morrison, J.H., O'Dell, T.J., Grant, S.G., 1998.Enhanced long-term potentiation and impaired learning in mice with mutantpostsynaptic density-95 protein. Nature 396, 433–439.

Morgans, C.W., Brandstatter, J.H., Kellerman, J., Betz, H., Wassle, H., 1996. A SNAREcomplex containing syntaxin 3 is present in ribbon synapses of the retina.J. Neurosci. 16, 6713–6721.

Morgans, C.W., El Far, O., Berntson, A., Wassle, H., Taylor, W.R., 1998. Calcium extrusionfrom mammalian photoreceptor terminals. J. Neurosci. 18, 2467–2474.

Roh, M.H., Margolis, B., 2003. Composition and function of PDZ protein complexesduring cell polarization. Am. J. Physiol. Renal. Physiol. 285, F377–F387.

Schluter, O.M., Xu, W., Malenka, R.C., 2006. Alternative N-terminal domains of PSD-95and SAP97 govern activity-dependent regulation of synaptic AMPA receptorfunction. Neuron 51, 99–111.

Spiwoks-Becker, I., Glas, M., Lasarzik, I., Vollrath, L., 2004. Mouse photoreceptorsynaptic ribbons lose and regain material in response to illumination changes. Eur.J. Neurosci. 19, 1559–1571.

Stauffer, T.P., Guerini, D., Carafoli, E., 1995. Tissue distribution of the four gene productsof the plasma membrane Ca2+ pump. A study using specific antibodies. J. Biol.Chem. 270, 12184–12190.

Stöhr, H., Weber, B.H., 2001. Cloning and characterization of the human retina-specificgeneMPP4, a novel member of the p55 subfamily of MAGUK proteins. Genomics 74,377–384.

Stöhr, H., Stojic, J., Weber, B.H.F., 2003. Cellular localization of the MPP4 protein in themammalian retina. Invest. Ophthalmol. Vis. Sci. 44, 5067–5074.

Strehler, E.E., Zacharias, D.A., 2001. Role of alternative splicing in generating isoformdiversity among plasma membrane calcium pumps. Physiol. Rev. 81, 21–50.

Strehler, E.E., Caride, A.J., Filoteo, A.G., Xiong, Y., Penniston, J.T., Enyedi, A., 2007a. Plasmamembrane Ca2+ ATPases as dynamic regulators of cellular calcium handling.Ann. N. Y. Acad. Sci. 1099, 226–236.

Strehler, E.E., Filoteo, A.G., Penniston, J.T., Caride, A.J., 2007b. Plasma-membrane Ca(2+)pumps: structural diversity as the basis for functional versatility. Biochem. Soc.Trans. 35, 919–922.

Tempel, B.L., Shilling, D.J., 2007. The plasma membrane calcium ATPase and disease.Subcell. Biochem. 45, 365–383.

Thoreson, W.B., 2007. Kinetics of synaptic transmission at ribbon synapses of rods andcones. Mol. Neurobiol. 36, 205–223.

van de Pavert, S.A., Kantardzhieva, A., Malysheva, A., Meuleman, J., Versteeg, I., Levelt, C.,Klooster, J., Geiger, S., Seeliger, M.W., Rashbass, P., Le Bivic, A., Wijnholds, J., 2004.Crumbs homologue 1 is required formaintenance of photoreceptor cell polarizationand adhesion during light exposure. J. Cell. Sci. 117, 4169–4177.

van de Pavert, S.A., Meuleman, J., Malysheva, A., Aartsen, W.M., Versteeg, I., Tonagel, F.,Kamphuis, W., McCabe, C.J., Seeliger, M.W.,Wijnholds, J., 2007a. A single amino acidsubstitution (Cys249Trp) in Crb1 causes retinal degeneration and deregulatesexpression of pituitary tumor transforming gene Pttg1. J. Neurosci. 27, 564–573.

van de Pavert, S.A., Sanz, A.S., Aartsen,W.M., Vos, R.M., Versteeg, I., Beck, S.C., Klooster, J.,Seeliger, M.W., Wijnholds, J., 2007b. Crb1 is a determinant of retinal apical Mullerglia cell features. Glia 55, 1486–1497.

van Rossum, A.G., Aartsen, W.M., Meuleman, J., Klooster, J., Malysheva, A., Versteeg, I.,Arsanto, J.P., Le Bivic, A., Wijnholds, J., 2006. Pals1/Mpp5 is required for correctlocalization of Crb1 at the subapical region in polarized Muller glia cells. Hum. Mol.Genet. 15, 2659–2672.

Xu, W., Schluter, O.M., Steiner, P., Czervionke, B.L., Sabatini, B., Malenka, R.C., 2008.Molecular dissociation of the role of PSD-95 in regulating synaptic strength andLTD. Neuron 57, 248–262.

Yang, J., Pawlyk, B., Wen, X.H., Adamian, M., Soloviev, M., Michaud, N., Zhao, Y.,Sandberg, M.A., Makino, C.L., Li, T., 2007. Mpp4 is required for proper localization ofplasmamembrane calcium ATPases andmaintenance of calcium homeostasis at therod photoreceptor synaptic terminals. Hum. Mol. Genet. 16, 1017–1029.

Zalfa, F., Eleuteri, B., Dickson, K.S., Mercaldo, V., De Rubeis, S., di Penta, A., Tabolacci, E.,Chiurazzi, P., Neri, G., Grant, S.G., Bagni, C., 2007. A new function for the fragile Xmental retardation protein in regulation of PSD-95 mRNA stability. Nat. Neurosci.10, 578–587.