http://www.jhltonline.org

ORIGINAL PRE-CLINICAL SCIENCE

Implication for transglutaminase 2-mediated activationof �-catenin signaling in neointimal vascular smoothmuscle cells in chronic cardiac allograft rejectionKelly E. Beazley, PhD,a Tianshu Zhang, PhD,b,c Florence Lima, PhD,a

Tatyana Pozharskaya, MS,a Corinne Niger, PhD,a Erdyni Tzitzikov, PhD,b

Agnes M. Azimzadeh, PhD,b and Maria Nurminskaya, PhDa

From the aDepartment of Biochemistry and Molecular Biology, and the bDepartment of Surgery, University of Maryland School ofMedicine, Baltimore, Maryland; and the cDepartment of Cardiac Surgery, The Third Hospital of Hebei Medical University,

Shijiazhuang, Hebei, China.

BACKGROUND: Cardiac allograft vasculopathy (CAV) remains the main cause of long-term transplantrejection. CAV is characterized by hyperproliferation of vascular smooth muscle cells (VSMCs).Canonical �-catenin signaling is a critical regulator of VSMC proliferation in development; however,the role of this pathway and its regulation in CAV progression are obscure. We investigated the activityof �-catenin signaling and the role for a putative activating ligand, transglutaminase 2 (TG2), in chroniccardiac rejection.METHODS: Hearts from Bm12 mice were transplanted into C57BL/6 mice (class II mismatch), andallografts were harvested 8 weeks after transplantation. Accumulation and sub-cellular distribution of�-catenin protein and expression of several components of �-catenin signaling were analyzed ashallmarks of pathway activation. In vitro, platelet-derived growth factor treatment was used to mimicthe inflammatory milieu in VSMC and organotypic heart slice cultures.RESULTS: Activation of �-catenin in allografts compared with isografts or naïve hearts was evidencedby the augmented expression of �-catenin target genes, as well as the accumulation and nuclearlocalization of the �-catenin protein in VSMCs of the occluded allograft vessels. Expression of TG2,an activator of �-catenin signaling in VSMCs, was dramatically increased in allografts. Further, our exvivo data demonstrate that TG2 is required for VSMC proliferation and for �-catenin activation byplatelet-derived growth factor in cardiac tissue.CONCLUSIONS: �-Catenin signaling is activated in occluded vessels in murine cardiac allografts. TG2is implicated as an endogenous activator of this signaling pathway and may therefore have a role in thepathogenesis of CAV during chronic allograft rejection.J Heart Lung Transplant 2012;31:1009–17© 2012 International Society for Heart and Lung Transplantation. All rights reserved.

KEYWORDS:cardiac allograftvasculopathy;�-catenin signaling;vascular smoothmuscle cells;transglutaminase 2;platelet derivedgrowth factor

Cardiac allograft vasculopathy (CAV) is one of the lead-ing causes of chronic rejection for heart transplant recipi-ents. CAV is characterized by neointimal growth and isdescribed as a healing response to immune injury of the

Reprint requests: Maria Nurminskaya, PhD, University of MarylandSchool of Medicine, Department of Biochemistry and Molecular Biology,108 N Greene St, BRF 329, Baltimore, MD 21201. Telephone: 410-706-6853.

E-mail address: mnurminskaya@som.umaryland.edu

1053-2498/$ -see front matter © 2012 International Society for Heart and Lunghttp://dx.doi.org/10.1016/j.healun.2012.04.009

vessels, which leads to progressive thickening of the arterialwall by accumulation of vascular smooth muscle cells(VSMCs) and expansion of the extracellular matrix.1 Dur-ing alloimmune responses, a variety of cytokines andgrowth factors are up-regulated, including platelet-derivedgrowth factor (PDGF),2,3 which is a potent regulator ofproliferation in VSMCs and has been associated with CAVprogression.4 Although the current regimens of anti-rejec-

tion therapies are aimed at suppressing the immune re-

Transplantation. All rights reserved.

1010 The Journal of Heart and Lung Transplantation, Vol 31, No 9, September 2012

sponse, many of these drugs also owe part of their efficacyto the attenuation of VSMC proliferation,5 as has beenshown, for example, for immunosuppressive inhibitors ofmammalian target of rapamycin (mTOR).6 However, im-munosuppressant drugs often confer a high risk of infectionand malignancy,5,6 and there has been only a modest 2% to4% increase in long-term graft survival,7 accentuating aclinical need for novel therapeutic approaches to chronicrejection.

The canonical �-catenin signal transduction cascade (de-scribed in detail previously in several excellent reviews8–11)has been implicated in the regulation of VSMC prolifera-tion. This signaling pathway can be activated by Wnt ligandsand by numerous non-Wnt proteins.8 Pathway activation in-hibits glycogen synthase kinase 3� (GSK-3�)–mediatedphosphorylation of �-catenin, leading to accumulation andtranslocation of the �-catenin protein into the nucleus,where it interacts with transcription factor (TCF)/lymphoidenhancer-binding factor (LEF) transcription factors to pro-mote the synthesis of �-catenin/TCF/LEF–responsivegenes, such as axin 2,12 cyclin D1,13 and numb,14 thatregulate cell proliferation.

Inhibition of �-catenin signaling in vitro prevents cyto-kine-induced proliferation,13 whereas excessively active�-catenin induces proliferation in VSMCs.15 Similarly, invivo, knock down �-catenin in embryonic VSMCs results ina significant reduction of tunica media.16 Despite a growingappreciation of the �-catenin signaling cascade in VSMChyperproliferation, evidence for the activation of this path-way in vivo in neointimal hyperplasia is scant.17

We recently demonstrated that enzyme transglutaminase2 (TG2) binds to the key receptor of �-catenin signaling18

and is critical in its activation in VSMCs.19 TG2 is aubiquitous calcium-dependent enzyme that catalyzes pro-tein cross-linking, polyamination or deamidation20 and reg-ulates various signaling cascades, including �-catenin18,20

and PDGF.21 In the vasculature, TG2 is expressed byVSMCs, endothelial cells, and macrophages,22 and has beenassociated with various vascular pathologies,23 includingthe progression of atherosclerotic lesions,24 nitric oxideinhibition–related hypertension,25 and in injury response inthe carotid artery.21

Here, we examined activation status of the canonical�-catenin signaling pathway in vivo during neointimalgrowth in cardiac vessels and addressed the potential rolefor TG2 in activation of this pathway induced by inflam-matory cytokine PDGF, emulating the pathology of CAV.We demonstrate activation of the �-catenin signaling path-way in the graft tissue from the well-characterized majorhistocompatibility complex class II–mismatched model ofchronic cardiac rejection with limited inflammatory compo-nent26 and localize it to VSMCs in the areas of neointimalthickening. Our results show direct evidence of a role foractive �-catenin signaling in the hyperproliferation ofVSMCs in cardiac transplant tissue. In addition, we show acritical role for TG2 in �-catenin–induced VSMC prolifer-ation and in the PDGF-mediated activation of �-catenin

signaling in heart tissue.

Methods

The animals used in this study received humane care in compli-ance with the Principles of Laboratory Animal Care (NationalSociety for Medical Research). The Institutional Animal Care andUse Committee at the University of Maryland Medical Schoolapproved all animal procedures used in this study.

Cardiac allografts

The mouse strains used were C57BL/6 (H-2b) (BL/6) and B6.C-H-2bm12 (bm12), which differ only at the A-� gene of the I regionof the mouse H-2 complex. In the allograft group, bm12 donorhearts were heterotopically transplanted into BL/6 recipient mice(n � 6). In the isograft group, BALB/c (H-2d) mice were used asdonors and recipients (n � 3). Hearts were transplanted into theabdomen of the recipients as primary vascularized grafts by themicrovascular technique previously described by Isobe et al.27

Graft survival was monitored by daily palpation. All of the cardiacallografts functioned up to 8 weeks (confirmed visually at the timeof harvest).

Graft histology

At the time of explant, cardiac grafts were trisected. The basal partwas fixed in 10% formalin and embedded in paraffin for Verhoeff’selastin staining according to standard protocol.28 The middle part wasstored at –70°C in optimum cutting temperature media (Tissue Tek,Sakura Finetek USA, Inc, Torrance, CA) for immunohistochemistry.The apex was immediately snap-frozen for molecular analysis. Elas-tin-stained sections were used to assess transplant arteriosclerosis.CAV severity was graded as 0 (normal), 1 (1% to 20% occlusion), 2(21% to 40% occlusion), 3 (41% to 60% occlusion), 4 (61% to 80%occlusion) and 5 (� 80% occlusion). The CAV severity score for eachexplant was calculated using the equation: (grade number � vessels) �N [number at each grade]/total number of arterial vessels scored.

Immunohistochemistry

Frozen sections (10 �m) from cardiac grafts and naïvehearts were fixed in 4% paraformaldehyde for 10 minutes at4°C, and free aldehydes were quenched with glycine (100mmol/liter). Non-specific staining was blocked with 5%normal goat serum (Thermo Fisher Scientific Inc, Waltham,MA). Sections were incubated overnight at 4°C in primaryantibodies rabbit anti–�-catenin (1:80; Santa Cruz Biotech-nology, Santa Cruz, CA), rabbit anti-TG2 (1:250; Abcam,Cambridge, MA), rabbit anti-PDGFR� (1:250; Abcam), orfluorescein isothiocyanate (FITC)-conjugated mouse anti-smooth muscle actin (1:100, 1A4; Abcam) and for 90 min-utes at room temperature in secondary antibody (Dylight555-conjugated goat anti-rabbit 1:400; Jackson Immunore-search Laboratories, Inc, West Grove, PA). Sections werestained with 4=,6-diamidino-2-phenylindole (Sigma, St.Louis, MO) to visualize nuclei. Images were taken usinga Leica DMIL fluorescence microscope (Leica Microsys-tems Inc, Buffalo Grove, IL) equipped with a SPOT-RT3real-time CCD camera (Diagnostic Instruments, Sterling

Heights, MI).

1011Beazley et al. �-Catenin Signaling and TG2 in CAV

Organotypic heart slice cultures

The organotypic heart slice cultures were performed asoriginally described.29 Briefly, 1-mm-thick transverse sec-tions of hearts from 3-day-old wild-type and TG2�/� mice(a kind gift from Robert Graham, Victor Chang Cardiovas-cular Institute, Darlinghurst, NSW, Australia)30 were slicedusing a rodent heart matrix (Harvard Apparatus, Holliston,MA). Heart slices were immediately transferred to a Milli-cell-CM 0.4-�m membrane (Millipore Corp, Billerica,MA), and the insert was placed into a well containingmedium (1 ml) in 12-well plates. Heart slices were main-tained for 5 days at 37°C in a humidified atmosphere con-taining 5% CO2 in Dulbecco’s modified Eagle’s medium(DMDM):F12 supplemented with 20% knockout serum re-placement, 1% non-essential amino acids, 2 mmol/liter L-glutamine, 0.1% �-mercaptoethanol, and 0.1% penicillin/streptomycin. Recombinant mouse PDGF-BB (ProSpec,East Brunswick, NJ) was used at 10 ng/ml.

Quantitative real-time polymerase chain reaction

Messenger (m)RNA was isolated using the Qiagen RNeasykit (Valencia, CA) and complementary DNA was synthe-sized with iScript reverse transcriptase (Bio-Rad, Hercules,CA) using a DYAD thermocycler (MJ Research, St. Bruno,QC, Canada). Real-time polymerase chain reaction (PCR)was performed with EVAgreen in a CFX96 (Bio-Rad) usingspecific primers (Table 1) designed using PrimerQuest soft-ware (Integrated DNA Technologies, Coralville, IA) or withSYBRgreen in a Roche Lightcycler 480 (Roche Diagnos-tics, Mannheim, Germany) using the pre-formatted mouseWnt/�-catenin signaling PCR array (SA Biosciences, Qia-

Table 1 Primer Sequences for Mouse Genes Analyzed by Real-

Gene targets Accession Forw

HousekeepingRpl19 NM_009078 AAGA�-actin NM_007393 TAAT

TransglutaminaseTG2 NM_009373 AGGT

�-catenin targetsAxin2 NM_015732 TGACnumb NM_010949 CTTCCTcf4 NM_013685 CGAACyclinD1 (cycD1)�I� NM_007631 GCGT

Wnt LigandsWnt3a NM_009522 CTCCTWnt7a NM_009527 CCTTG

PDGFPDGF-A NM_008808 GTTGPDGF-B NM_011057 CACCPDGF-C NM_019971 ATGCPDGF-D NM_027924 GGCAPDGFR� NM_011058 CTTCAPDGFR� NM_008809 ACGG

PDGF, Platelet-derived growth factor; Rpl19, Ribosomal protein L19.

gen Inc, Valencia, CA). Levels of mRNA expressed asrelative fold expression (using the ��Cq method) in graftswere compared with naïve BL/6 heart tissue (all mousestrains used showed similar baseline expression of genesassayed in this study) or in PDGF-treated heart slices com-pared with untreated control slices.

Cell culture, luciferase activity, and proliferation

The rat aortic smooth muscle cell line (A10 VSMC; AmericanType Culture Collection, Manassas, VA) was maintained inDMEM (Invitrogen, Carlsbad, CA) with 10% fetal bovineserum (FBS; HyClone, Thermo Fisher Scientific) and 100ng/ml penicillin and streptomycin (Invitrogen). A stable A10VSMC �-catenin luciferase reporter cell line (A10-bcat) wasestablished using the Cignal Lenti TCF/LEF Luciferase Re-porter (SA Biosciences) according to the manufacturer’s pro-tocol. For the analysis of �-catenin activity and cell prolifera-tion, A10-bcat cells were seeded at 1 � 104 cells/cm2.

At time 0, cells were transferred to DMEM containing1% FBS and 0.0075 U/ml (0.005 mg/ml) purified TG2(Sigma) for 48 hours. Medium was supplemented withquercetin (100 �mol/liter; Quercegen, Newton, MA),31 orERW-1069 (quinolin-3-ylmethyl(S)-1-(((S)-3-bromo-4,5-dihydroisoxazol-5-yl)methylamino)-3-(5-fluoro-1H-indol-3-yl)-1-oxopropan-2-ylcarbamate) (30 �mol/liter), kindly provided byDr. C. Khosla (Stanford University),32 as indicated. Lu-ciferase activity in total cell lysates, normalized to consti-tutively active Renilla luciferase was measured in a 96-wellplate luminometer (Harta Instruments, Bethesda, MD) usingthe Promega Dual Luciferase Assay Kit (Promega, Madi-son, WI). Total lactate dehydrogenase (LDH) present in celllysates was measured with LDH kit (BioVision Inc, Milpitas,

olymerase Chain Reaction

mer Reverse primer

GGTACTGCCAATGCT TGACCTTCAGGTACAGGCTGTGATATGGCCCAGGTCT CTGGCTGCCTCAACACCTCAA

GAAGAACCCACTTT TTCCACAGACTTCTGCTCCTTGGT

TCCAGATCCCA TGCCCACACTAGGCTGACAAAGTACCTCGGC CCCGTTTTTCCAAAGAAGCCTCCTCCGGGTTTG CGTAGCCGGGCTGATTCATACACCAATCTC CTCCTCTTCGCACTTCTGCTC

ATACCTCTTAGTG GCATGATCTCCACGTAGTTCCTGCTTGTTCTCC GGCGGGGCAATCCACATAG

CCAGCAGCGTCAAG TGACATACTCCACTTTGGCCACCTTTTAAGCACACCCA AAATAACCCTGCCCACACTCTTGGTCACAGAAACCACG AAGGCAGTCACAGCATTGTTGAGCTACCATGATCGG ACAGAGTGATTCCTGGGAGTGCCAACACCCAGA TGTGCTCTCGTCTGCAGGATTTGCCGATACGGTGAT ACAATGCTTGTTGGAGTGTCGCTG

Time P

ard pri

GGAAGTTCTGA

GTCCCT

TCTCCTCAGTTAAGTTACCCTG

CTCGGTTGCG

TAACAGAAAGCACAAGGTCATGAGCAATAC

1012 The Journal of Heart and Lung Transplantation, Vol 31, No 9, September 2012

CA) using a POLARstar Optima plate reader (BMGLABTECH GmbH, Ortenberg, Germany). Relative cell pro-liferation was determined by comparing the total amount ofLDH present in cell lysates after 48 hours in culture withlevels of LDH present in cell lysates at time 0. Experimentswere performed in triplicate.

Statistical analysis

All data are expressed as mean � standard error of the mean(SEM). One-way analysis of variance (ANOVA) was usedfor comparisons between 3 or more groups. Calculationswere done on StatView software (SAS Institute Inc, Cary,NC). Unpaired Student’s t-test was used for comparisonbetween two groups. Data were considered statistically sig-nificant at p � 0.05.

Results

�-Catenin expression in neointimal VSMCs duringchronic allograft rejection

The class II mismatch bm12–to–BL/6 cardiac allograftmodel used is characterized by limited acute cellular rejec-tion.26 It supports allograft function for at least 8 weeks inthe absence of immunosuppressive therapy and results in thedevelopment of severe CAV, with a severity score of 2.9 � 0.3(n � 6) visualized as extensive occlusion of coronary ves-sels surrounded by multifocal patchy parenchymal andperivascular inflammatory infiltrates (Figure 1A; Supple-mental Figure 1, available at JHLTonline.org). Immunohis-

allo

graf

t

isogr

aft

naï

ve

elastin A

allo

graf

t

isogr

aft

naï

ve

-catenin/smB

Figure 1 Nuclear localization of �-catenin in cardiac allograftallograft murine hearts were histologically stained for elastin using(B) Adjacent sections were immunohistochemically probed for smcells—and �-catenin (red), and counterstained with 4=,6-diamidintunica media. (C) Higher magnification of the boxed area in panel

panel A � 25 �m. Scale bar in panel C � 10 �m.

tochemical staining for smooth muscle actin and �-cateninrevealed that the neointimal lesions largely consisted ofVSMCs and that �-catenin protein was increased in theneointimal VSMCs of allograft vessels (Figure 1B; Supple-mental Figure 2A, available at JHLTonline.org). Moreover,an accumulation of nuclear �-catenin was observed in manyneointimal VSMCs of allograft hearts (arrows in Figure1C), implying activation of canonical �-catenin signaling.Of note, elevated �-catenin is detected only in the hyper-proliferating neointimal cells and not in the contractileVSMCs of the vessel wall (outlined with dotted lines inFigure 1B). In contrast, there was little if any intimal changein the 3 isografts harvested at 100 days after transplantation(CAV score 0.1 � 0.1; Figure 1A).

Activation of �-catenin signaling in allograftsby TG2

To further assess whether �-catenin signaling is active dur-ing CAV progression, we analyzed the expression of down-stream �-catenin targets using real-time PCR. Consistentwith the increase in nuclear �-catenin protein, expression ofthe �-catenin target genes axin2, cyclin D1, and numb wasalso significantly increased in allografts with severe CAVcompared with isografts and naïve hearts, which show noCAV (Figure 2A). Likewise, a semi-comprehensive PCR-based microarray analysis of 84 genes related to �-catenin–mediated signal transduction corroborate activation of�-catenin signaling in the allograft tissue by revealing theinduction of several additional �-catenin target genes, in-cluding the transcription factors Lef1, Tcf7, Pitx2, andWisp-1, accompanied by the repression of negative regula-

C allograft

-cat

enin

/DA

PI

DA

PI

-c

aten

in

C

DAPI

lopathy. (A) Frozen sections (10 �m) from naïve, isograft, andrhoeff-Van Gieson method to visualize coronary vessel occlusion.muscle actin (sma, green)—a marker of vascular smooth muscleenylindole (DAPI; blue) to label nuclei. The dotted lines denotewing nuclear localization of �-catenin (arrowheads). Scale bar in

a

vascuthe Veooth

o-2-phB sho

1013Beazley et al. �-Catenin Signaling and TG2 in CAV

tors of the �-catenin pathway, including Dkk1 and Gsk3(Table 2). However, expression of Wnt3a and Wnt7a, pre-viously reported as putative activators of �-catenin in vas-cular tissue,33 was not altered in the allografts (Figure 2B).The microarray analysis further confirmed a limited role forcanonical Wnt ligands in regulation of �-catenin, with 4Wnt proteins being down-regulated, 11 family membersshowing no significant change in expression, and only Wnt2

0.5

1

2

4

8

axin2 cycD1 numb

rela

tive

gene

exp

ress

ion

naïve iso allo

*

**

** A

TS

D

m

B

0

5

10

15

20

25

30

naïve iso allo

rela

tive

TG2

expr

essi

on *

C

Figure 2 Activation of �-catenin signaling in allograft hearts. Rtarget genes, axin 2, cyclin D1 (cycD1), and numb; (B) putative ca2 (TG2) in isograft and allograft murine hearts compared with naprotein L19. Real-time PCR reactions were run in duplicate (n �Data are shown with the standard error of the mean (error bars). (Dimmunohistochemically probed for smooth muscle actin (SMAphenylindole (DAPI, blue) to label nuclei. Scale bar � 15 �m.

Table 2 Analysis of the Canonical �-CCompared With Naïve Hearts

Up-re

Wnt (canonical) Wnt2 (3Wnt (non-canonical) Wnt2 (3

Wnt binding antagonists Sfrp1, 23.73

Negative regulators of �-catenin signaling

�-catenin target genesRelated to proliferation�I� Slc9a3r1

Wisp-1Transcription factors�I� Lef1 (1

Pitx2 (3Tcf7 (10

Other �-catenin targets Fshb (5

being moderately up-regulated, although its role in the ca-nonical �-catenin pathway is uncertain (Table 2).

These results of the PCR analyses suggest that a non-Wnt protein may mediate activation of �-catenin signaling.Elaborating on our recent finding that TG2 can activatecanonical �-catenin signaling in VSMCs in vitro,19 weinvestigated the expression of TG2 in allograft neointima.Expression of TG2 mRNA is dramatically increased 21.8 �

naïve allograft

aïve iso allo

Wnt3a

0

0.2

0.4

0.6

0.8

1

1.2

naïve iso allo

rela

tive

gene

exp

ress

ion

Wnt7a

NS NS

e polymerase chain reaction (PCR) for (A) downstream �-cateninl �-catenin activators Wnt3a and Wnt7a, and (C) transglutaminasen-transplanted controls. Expression was normalized to ribosomaloup were analyzed). *p � 0.05; **p � 0.01; NS, not significant.

zen sections (10 �m) from naïve and allograft murine hearts weren) and TG2 (red), and counterstained with 4=,6-diamidino-2-

Signaling Profile in Allografts

d (fold) Down-regulated (fold)

Wnt1, 8b (2.52, 2.68)Wnt1, 5b, 9a (2.52, 2.57,

3.75)33, 9.06,

Dkk1 (17.29)Gsk3b (2.68)Sox17 (3.52)

))

Aes (3.08)

G2/ MA

API

erge

D

0

0.5

1

1.5

2

2.5

n

rela

tive

gene

exp

ress

ion

eal-timnonicaïve no3–4/gr) Fro, gree

atenin

gulate

.55)

.55)

, 4 (6.)

(2.68(10.793.68).52).49)

.68)

1014 The Journal of Heart and Lung Transplantation, Vol 31, No 9, September 2012

4.6-fold (p � 0.05) in allografts with severe CAV comparedwith isograft and naïve controls (Figure 2C), in contrast toall known Wnt ligands, as shown by the real-time PCR anal-ysis, TG2 protein is increased in VSMCs in the occludedvessels in the rejected allograft (Figure 2D; Supplemental Fig-ure 2B, available at JHLTonline.org).

Regulation of VSMC proliferation and �-cateninsignaling by TG2

To examine the potential role for elevated TG2 in theregulation of �-catenin– dependent VSMC hyperprolif-eration, we used the A10 cell line of aortic smoothmuscle cells. Purified exogenous TG2 (0.0075 U/ml)induced a 52% increase over serum-stimulated prolifer-ation in VSMCs (p � 0.01; Figure 3A, TG2), and this effectwas associated with a 1.9 � 0.1-fold (p � 0.01) increase inthe �-catenin–dependent transcription of a luciferase re-porter in A10 VSMCs (Figure 3B, TG2), indicating TG2-induced activation of �-catenin signaling. The TG2-specificinhibitor ERW-1069 (Figure 3, TG2i) significantly ham-pered the activation of the �-catenin–dependent reportergene and VSMC proliferation, similar to the effects of the�-catenin inhibitor quercetin31 (Figure 3, bcati). These re-sults demonstrate that in vitro VSMC hyperproliferation isdependent on the TG2-induced activation of canonical�-catenin signaling.

A

0.8

1

1.2

1.4

1.6

1.8

2

rela

tive

cell

prol

ifera

tion

** **

1% FBS - + + + + TG2i - - - + - TG2 - - + + +

bcati - - - - +

B

0.5

1

1.5

2

2.5

3

rela

tive

-cat

enin

act

ivity

** **

bcati - - - + TG2i - - + - TG2 - + + +

Figure 3 Catalytic activity of transglutaminase 2 (TG2) is re-quired for �-catenin–dependent vascular smooth muscle cell(VSMC) proliferation in vitro. A10 VSMCs containing a �-catenin–responsive luciferase reporter (A10-bcat) were cultured inmedium containing 1% fetal bovine serum (FBS) supplementedwith purified TG2 (0.0075 U/ml), TG2 inhibitor ERW-1069 (30�m; TG2i), or �-catenin inhibitor quercetin (100 �m; bcati) asindicated. (A) Proliferation of A10-bcat cells after 48 hours wasdetermined by comparing amount of lactate dehydrogenase (LDH)released by total cell lysis of treated cells with amount releasedLDH released by cells at time 0. Cells cultured in the absence ofpurified TG2 served as a control for normal proliferation in culture(n � 3–4/treatment group). **p � 0.01. (B) Luciferase activity,normalized to constitutively expressed Renilla luciferase, wascompared in all groups with untreated A10-bcat cells after 48hours. Data are shown with the standard error of the mean (error

bars).

TG2 is critical for PDGF-induced activation of�-catenin in cardiac tissue

Increased PDGF levels have been observed in cardiac allo-graft tissue.2,3,34 To obtain a more comprehensive mecha-nistic understanding of how PDGF signaling can contributeto CAV in the class II mismatch mouse model, in which�-catenin signaling is activated, we examined the expres-sion of PDGF isoforms and receptors in the cardiac grafts.Of the 4 PDGF isoforms, only PDGF-C mRNA was up-regulated (3.8 � 0.8-fold, p � 0.05) in allograft tissuecompared with naïve hearts and isografts (Figure 4A). Inaddition, PDGF receptor-� (PDGFRa), was significantlyupregulated in allograft and isograft tissues (4.4 � 1.4-foldand 4.2 � 0.1-fold, respectively; Figure 4A; SupplementalFigure 3A, available at JHLTonline.org); however, only ves-sels in the allograft hearts showed punctate staining forPDGFR� indicative of receptor clustering and activation (Fig-ure 4B; Supplemental Figure 3B, available at JHLTonline.org).

We next analyzed whether PDGF activates �-cateninsignaling in cardiac tissue and whether TG2 plays a role inthis activation. For this, we used a recently establishedorganotypic model in which neonatal heart slices are cul-tured at the membrane–air interface. Similar to allografttissue, TG2 and PDGFR� mRNAs were significantly in-creased in wild-type heart slices treated with PDGF (3.0 �0.3-fold and 4.8 � 0.10-fold, respectively; Figure 4C). Inaddition, PDGF treatment induced significant up-regulationof the �-catenin target genes axin2 (56 � 6.9-fold), TCF4(55 � 3.3-fold), and numb (12 � 0.4-fold; Figure 4D, WT),indicating activation of the �-catenin signaling pathway incardiac tissue. Furthermore, genetic ablation of TG2 atten-uated the PDGF-induced expression of the �-catenin targetgenes (Figure 4D, TG-KO) but not of PDGFR� (Figure 4E).These results demonstrate a critical and specific role forTG2 in the PDGF-induced activation of �-catenin signalingin heart tissue.

Discussion

In this study we report our observations of the activation of�-catenin signaling in neointimal VSMCs after cardiac al-lograft transplant, showing increased transcriptional activityof �-catenin in proliferating VSMCs in vitro, and demon-strating coordinate regulation of both processes by TG2-specific inhibitors. These findings suggest that hyperprolif-eration in neointimal VSMCs may be regulated by the�-catenin pathway.

Although canonical �-catenin signaling is usually inac-tive in healthy vascular tissue,35 it is activated in variouscardiovascular disorders, including cardiac wound healingand cardiac hypertrophy,35,36 vascular remodeling inducedby injury,37 and vascular calcification.33,38 In the presentstudy, activation of �-catenin in the vascularized rejectedcardiac allograft tissue was demonstrated by direct immu-nohistochemistry and molecular analysis. We report the in

vivo accumulation of nuclear �-catenin protein in neointi-

1015Beazley et al. �-Catenin Signaling and TG2 in CAV

mal VSMCs of occluded vessels, suggesting activation of�-catenin signaling. Elevated expression of �-catenin targetgenes such as cyclinD1, expressing a key protein in cellcycle progression13), Wisp-1 (a regulator of VSMC prolif-eration in restenosis39), numb (a regulator of Notch degra-dation in response to �-catenin activation14 and phenotypicinstability in VSMC40), and the �-catenin transcriptionalcofactors TCF and LEF,8 further confirm activation of thissignaling pathway in the allograft tissue.

A similar role for �-catenin activation has been proposedin the model of severe neointimal thickening in stent-in-duced endovascular injury.15 However, no direct evidencefor elevated �-catenin activity in the graft tissue has beenobtained in the latter study due to technical reasons withstent embedding, preventing an unequivocal conclusion onthe potential role of this signaling pathway in neointimalgrowth. Thus, our results provide direct evidence that ca-nonical �-catenin signaling is activated in vessels withCAV.

Furthermore, our data suggest a non-Wnt protein maymediate �-catenin activation in severe CAV. In contrast tomoderate changes in the expression of common canonicalWnt ligands, expression of TG2 is dramatically increasedmore than 20-fold in allograft tissue. These findings suggestthat TG2 may contribute to the activation of canonical�-catenin signaling in proliferating neointimal VSMCs dur-

A

0

1

2

3

4

5

6

PDGF-C PDGFRa

rela

tive

gene

exp

ress

ion

naïve iso allo

*

* * PDGFRaSMA

DAP

merge

B

0

10

20

30

40

50

60

70

PDG

F-in

duce

d ch

ange

in

gene

exp

ress

ion

D

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

5

TG2 PDGFRa

rela

tive

gene

exp

ress

ion

PDGF: - + - +

**

*

C

Figure 4 Transglutaminase 2 (TG2) is critical for platelet-derivepolymerase chain reaction (PCR) for PDGF-C and PDGF recepnon-transplanted controls. Expression was normalized to ribosomaanimals/group were analyzed). *p � 0.05. (B) Frozen sections (1histochemically probed for smooth muscle actin (SMA, green) and(DAPI, blue) to label nuclei. Scale bar � 15 �m. Real-time PCRtreated for 5 days with PDGF (10 ng/ml; black bars), or (D) �-catfrom wild-type (black bars) or TG2-null (dark grey bars, TG-KO) mto �-actin, and data are shown as increase in expression comparedHeart slices from three to four animals were combined for analysiserror of the mean (error bars).

ing CAV, while Wnt2—which is also increased 2-fold in the

allograft tissue—has previously been shown to have noeffect on VSMC proliferation.17 In agreement with a pro-posed role for TG2 in CAV, elevated levels of this enzymeinduce, while its inhibition attenuates, the activation of�-catenin signaling and VSMC proliferation in vitro. Im-portantly, the �-catenin inhibitor quercetin31 also attenuatesTG2-induced proliferation, suggesting that canonical �-cateninsignaling mediates TG2-induced VSMC hyperproliferation,and therefore, TG2 itself and the downstream activation of�-catenin may both be potential therapeutic targets to pre-vent neointimal hyperplasia in vivo.

We have demonstrated that genetic ablation of TG2attenuates activation of �-catenin signaling in response toPDGF. This finding adds to the mechanistic understandingof PDGF-induced VSMC proliferation in vitro,4,13,17 and�-catenin regulation by PDGF in a Wnt-independent man-ner.15,41 Although the precise mechanism of this regulationhas not been determined, our data identify the induction ofTG2 as a key step in the regulation of �-catenin by PDGFin cardiac tissue. Considering the observed increase inPDGF in cardiac allografts in patients2 and in animal mod-els3 and that blockade of PDGFR� attenuates coronarymyointimal hyperplasia in rat allografts,34 a better under-standing of the molecular mechanisms of PDGF activity inCAV may benefit the development of novel therapeutics.

In addition to mediating the effects of PDGF on cell

aïve isograft allograft

tcf4 numb

T TG-KO

**

*

**

* 0

1

2

3

4

5

6

PDGFRa

PDG

F-in

duce

d ch

ange

in

gene

exp

ress

ion

WT TG-KO

E ** *

th factor (PDGD)–induced activation of �-catenin. (A) Real-timePDGFR-�) in isograft and allograft hearts compared with naïvein L19. Real-time PCR reactions were run in duplicate (n � 3–4from naïve, isograft, and allograft murine hearts were immuno-R� (red), and counterstained with 4’,6-diamidino-2-phenylindole2 and PDGFR-� in cultured heart slices from (C) wild-type micerget genes axin2, tcf4, and numb and (E) PDGFR� in heart slicesated for 5 days with PDGF (10 ng/ml). Expression was normalizedntreated control cultures from wild-type or TG2-null heart slices.0.05; **p � 0.01. Data in the graphs are shown with the standard

n

I

axin2

W

** **

d growtor-� (l prote0 �m)PDGF

for TGenin taice trewith u

. *p �

proliferation via the �-catenin pathway, as demonstrated by

1016 The Journal of Heart and Lung Transplantation, Vol 31, No 9, September 2012

our data, TG2 has been also shown to augment PDGFeffects on cell migration, acting as a scaffolding proteinthrough fibronectin adhesive complexes to cluster the PDGFreceptors.42 Taking into account a role of activated�-catenin in fibronectin synthesis in VSMCs,15 a tieredregulation of these two processes can be postulated withPDGF-dependent induction of TG2 being a primary (cen-tral) step.

Furthermore, accumulating evidence suggests a role forTG2 as a common regulator of neointimal growth in variousdiseases, including atherosclerotic lesions,24 carotid arteryballoon injury,21 and nitric oxide inhibition–related hyper-tension.25 Therefore, our data imply that inhibitors specificfor the TG2 enzyme, which already show promise in thetreatment of neurodegenerative disease and cancer,43 mayprotect from CAV and thus provide a new approach to thetreatment of this condition, which remains a significantbarrier to long-term graft survival7 for cardiac transplantrecipients.

Because CAV is a chronic condition requiring long-termtreatment, effective therapies may require a combinatorialapproach, and additional therapeutic options targeted atVSMC hyperproliferation in CAV should be considered tosupplement common immunosuppressive therapies. Inter-estingly, activation of �-catenin in several cell types can beaccompanied by activation of mTOR44 via a GSK-3�–dependent mechanism different from the PI3 kinase/Aktsignaling known to regulate mTOR in the immune response.This suggests that therapeutic strategies targeting �-cateninactivation in allografts may also attenuate mTOR activation;however, further studies will be required to assess whethera similar GSK-dependent activation of mTOR occurs inVSMCs. Regardless, our work has highlighted one path-way, the TG2-mediated activation of �-catenin signaling,that is significantly up-regulated during cardiac allograftrejection, responds to the inflammation-induced cytokinePDGF in cardiac tissue, and induces VSMC hyperprolifera-tion in vitro, suggesting that this pathway may providenovel therapeutic targets for the prevention of CAV asso-ciated with cardiac allograft chronic rejection.

Disclosure statement

This work was supported by grants from the National Institutes ofHealth: R01HL093305 awarded to M.N., T32AR007592 fellow-ship to K.B., 5UO1-AI066719 awarded to R.N. P., and a Univer-sity of Maryland Greenebaum Cancer Center Award to A.A.

None of the authors has a financial relationship with a com-mercial entity that has an interest in the subject of the presentedmanuscript or other conflicts of interest to disclose.

Supplementary data

Supplementary Figures are available in the online ver-

sion of this article at JHLTonline.org.

References

1. Mitchell RN. Graft vascular disease: immune response meets thevessel wall. Annu Rev Pathol 2009;4:19-47.

2. Zhao XM, Yeoh TK, Frist WH, Porterfield DL, Miller GG. Inductionof acidic fibroblast growth factor and full-length platelet-derivedgrowth factor expression in human cardiac allografts. Analysis byPCR, in situ hybridization, and immunohistochemistry. Circulation1994;90:677-85.

3. Lemstrom K, Sihvola R, Koskinen P. Expression of platelet-derivedgrowth factor in the development of cardiac allograft vasculopathy inthe rat. Transplant Proc 1997;29:1045-6.

4. Abid MR, Yano K, Guo S, et al. Forkhead transcription factors inhibitvascular smooth muscle cell proliferation and neointimal hyperplasia.J Biol Chem 2005;280:29864-73.

5. Autieri MV. Antiproliferative effects of immunosuppressant drugs onvascular smooth muscle cells: an additional advantage for attenuatingtransplant vasculopathy. Drug News Perspect 2004;17:110-6.

6. Sanchez-Lazaro IJ, Almenar L, Martinez-Dolz L, et al. Proliferationsignal inhibitors in heart transplantation: a 5-year experience. Trans-plant Proc 2010;42:2992-3.

7. Taylor DO, Stehlik J, Edwards LB, et al. Registry of the InternationalSociety for Heart and Lung Transplantation: Twenty-sixth OfficialAdult Heart Transplant Report-2009. J Heart Lung Transplant 2009;28:1007-22.

8. Hendrickx M, Leyns L. Non-conventional Frizzled ligands and Wntreceptors. Dev Growth Differ 2008;50:229-43.

9. Logan CY, Nusse R. The Wnt signaling pathway in development anddisease. Annu Rev Cell Dev Biol 2004;20:781-810.

10. Johnson ML, Rajamannan N. Diseases of Wnt signaling. Rev EndocrMetab Disord 2006;7:41-9.

11. MacDonald BT, Tamai K, He X. Wnt/beta-catenin signaling: compo-nents, mechanisms, and diseases. Dev Cell 2009;17:9-26.

12. Jho EH, Zhang T, Domon C, Joo CK, Freund JN, Costantini F.Wnt/beta-catenin/Tcf signaling induces the transcription of Axin2, anegative regulator of the signaling pathway. Mol Cell Biol 2002;22:1172-83.

13. Quasnichka H, Slater SC, Beeching CA, Boehm M, Sala-Newby GB,George SJ. Regulation of smooth muscle cell proliferation by beta-catenin/T-cell factor signaling involves modulation of cyclin D1 andp21 expression. Circ Res 2006;99:1329-37.

14. Katoh M, Katoh M. NUMB is a break of WNT-Notch signaling cycle.Int J Mol Med 2006;18:517-21.

15. Perez VA, Ali Z, Alastalo TP, et al. BMP promotes motility andrepresses growth of smooth muscle cells by activation of tandem Wntpathways. J Cell Biol 2011;192:171-88.

16. Cohen ED, Ihida-Stansbury K, Lu MM, Panettieri RA, Jones PL,Morrisey EE. Wnt signaling regulates smooth muscle precursor de-velopment in the mouse lung via a tenascin C/PDGFR pathway. J ClinInvest 2009;119:2538-49.

17. Tsaousi A, Williams H, Lyon CA, et al. Wnt4/beta-catenin signalinginduces VSMC proliferation and is associated with intimal thickening.Circ Res 2011;108:427-36.

18. Faverman L, Mikhaylova L, Malmquist J, Nurminskaya M. Extracel-lular transglutaminase 2 activates beta-catenin signaling in calcifyingvascular smooth muscle cells. FEBS Lett 2008;582:1552-7.

19. Beazley KE, Deasey S, Lima F, Nurminskaya MV. Transglutaminase2-mediated activation of beta-catenin signaling has a critical role inwarfarin-induced vascular calcification. Arterioscler Thromb VascBiol 2012;32:123-30.

20. Lorand L, Graham RM. Transglutaminases: crosslinking enzymeswith pleiotropic functions. Nat Rev Mol Cell Biol 2003;4:140-56.

21. Zemskov EA, Mikhailenko I, Smith EP, Belkin AM. Tissue transglu-taminase promotes PDGF/PDGFR-mediated signaling and responsesin vascular smooth muscle cells. J Cell Physiol 2012;227:2089-96.

22. Lai TS, Liu Y, Li W, Greenberg CS. Identification of two GTP-independent alternatively spliced forms of tissue transglutaminase inhuman leukocytes, vascular smooth muscle, and endothelial cells.

FASEB J 2007;21:4131-43.

1017Beazley et al. �-Catenin Signaling and TG2 in CAV

23. Sane DC, Kontos JL, Greenberg CS. Roles of transglutaminases incardiac and vascular diseases. Front Biosci 2007;12:2530-45.

24. Cho BR, Kim MK, Suh DH, et al. Increased tissue transglutaminaseexpression in human atherosclerotic coronary arteries. Coron ArteryDis 2008;19:459-68.

25. Pistea A, Bakker EN, Spaan JA, Hardeman MR, van RN, VanBavel E.Small artery remodeling and erythrocyte deformability in L-NAME-induced hypertension: role of transglutaminases. J Vasc Res 2008;45:10-8.

26. Schenk S, Kish DD, He C, et al. Alloreactive T cell responses andacute rejection of single class II MHC-disparate heart allografts areunder strict regulation by CD4� CD25� T cells. J Immunol 2005;174:3741-8.

27. Isobe M, Haber E, Khaw BA. Early detection of rejection and assess-ment of cyclosporine therapy by 111In antimyosin imaging in mouseheart allografts. Circulation 1991;84:1246-55.

28. Sho M, Sandner SE, Najafian N, et al. New insights into the interac-tions between T-cell costimulatory blockade and conventional immu-nosuppressive drugs. Ann Surg 2002;236:667-75.

29. Habeler W, Pouillot S, Plancheron A, Puceat M, Peschanski M, Mon-ville C. An in vitro beating heart model for long-term assessment ofexperimental therapeutics. Cardiovasc Res 2009;81:253-9.

30. Nanda N, Iismaa SE, Owens WA, Husain A, Mackay F, Graham RM.Targeted inactivation of Gh/tissue transglutaminase II. J Biol Chem2001;276:20673-8.

31. Park CH, Chang JY, Hahm ER, Park S, Kim HK, Yang CH. Quercetin,a potent inhibitor against beta-catenin/Tcf signaling in SW480 coloncancer cells. Biochem Biophys Res Commun 2005;328:227-34.

32. Watts RE, Siegel M, Khosla C. Structure-activity relationship analysisof the selective inhibition of transglutaminase 2 by dihydroisoxazoles.J Med Chem 2006;49:7493-501.

33. Shao JS, Cheng SL, Pingsterhaus JM, Charlton-Kachigian N, LoewyAP, Towler DA. Msx2 promotes cardiovascular calcification by acti-

vating paracrine Wnt signals. J Clin Invest 2005;115:1210-20.

34. Mancini MC, Evans JT. Role of platelet-derived growth factor inallograft vasculopathy. Ann Surg 2000;231:682-8.

35. Goodwin AM, D’Amore PA. Wnt signaling in the vasculature. An-giogenesis 2002;5:1-9.

36. van Gijn ME, Daemen MJ, Smits JF, Blankesteijn WM. The wnt-frizzled cascade in cardiovascular disease. Cardiovasc Res 2002;55:16-24.

37. Wang X, Adhikari N, Li Q, Hall JL. LDL receptor-related proteinLRP6 regulates proliferation and survival through the Wnt cascade invascular smooth muscle cells. Am J Physiol Heart Circ Physiol 2004;287:H2376-83.

38. Caira FC, Stock SR, Gleason TG, et al. Human degenerative valvedisease is associated with up-regulation of low-density lipoproteinreceptor-related protein 5 receptor-mediated bone formation. J AmColl Cardiol 2006;47:1707-12.

39. Grzeszkiewicz TM, Lindner V, Chen N, Lam SC, Lau LF. The an-giogenic factor cysteine-rich 61 (CYR61, CCN1) supports vascularsmooth muscle cell adhesion and stimulates chemotaxis through in-tegrin alpha(6)beta(1) and cell surface heparan sulfate proteoglycans.Endocrinology 2002;143:1441-50.

40. Morrow D, Guha S, Sweeney C, et al. Notch and vascular smoothmuscle cell phenotype. Circ Res 2008;103:1370-82.

41. Yang L, Lin C, Zhao S, Wang H, Liu ZR. Phosphorylation of p68RNA helicase plays a role in platelet-derived growth factor-inducedcell proliferation by up-regulating cyclin D1 and c-Myc expression.J Biol Chem 2007;282:16811-9.

42. Zemskov EA, Loukinova E, Mikhailenko I, Coleman RA, StricklandDK, Belkin AM. Regulation of platelet-derived growth factor receptorfunction by integrin-associated cell surface transglutaminase. J BiolChem 2009;284:16693-703.

43. Siegel M, Khosla C. Transglutaminase 2 inhibitors and their therapeu-tic role in disease states. Pharmacol Ther 2007;115:232-45.

44. Inoki K, Ouyang H, Zhu T, et al. TSC2 integrates Wnt and energysignals via a coordinated phosphorylation by AMPK and GSK3 to

regulate cell growth. Cell 2006;126:955-68.