www.elsevier.com/locate/ygcen

General and Comparative Endocrinology 152 (2007) 295–303

Hormone receptors in gills of smolting Atlantic salmon, Salmo salar:Expression of growth hormone, prolactin, mineralocorticoid and

glucocorticoid receptors and 11b-hydroxysteroid dehydrogenase type 2

Pia Kiilerich a, Karsten Kristiansen b, Steffen S. Madsen a,*

a Institute of Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmarkb Department of Biochemistry and Molecular Biology, University of Southern Denmark, Campusvej 55, DK-5230 Odense M, Denmark

Received 15 September 2006; revised 29 November 2006; accepted 26 December 2006Available online 30 December 2006

Abstract

This is the first study to report concurrent dynamics in mRNA expression of growth hormone receptor (GHR), prolactin receptor(PRLR), gluco- and mineralocorticoid receptor (GR and MR) and the 11b-hydroxysteroid dehydrogenase type-2 enzyme (11b-HSD2) in Atlantic salmon (Salmo salar) gill during smoltification. Transcript levels were analysed by quantitative PCR in fresh water(FW) fish and after a 24-h salt water (SW) challenge. GHR transcript levels increased concurrent with gill Na+,K+-ATPase activity inFW fish consistent with the SW-adaptive role of GH. SW-transfer induced an increased GHR expression levels in the early stages ofsmoltification but a decrease in expression at the peak of smoltification. PRLR transcript levels decreased steadily during smoltificationin agreement with the recognized hyper-osmoregulatory role of PRL. Surprisingly, PRLR levels increased after SW transfer during thecourse of smoltification. GR mRNA levels were low early on during smoltification but increased at the peak of smoltification andremained high during de-smoltification, indicative of increased cortisol signalling at this point. Coherently, SW transfer increased GRlevels to smolt levels prior to the smoltification peak. 11b-HSD2 levels increased at the smoltification peak and MR levels increased dur-ing de-smoltification, suggesting a need for protection of MR from cortisol signalling during smoltification. This is supported by the factthat SW-transfer results in a profound up-regulation of 11b-HSD2, whereas SW transfer down-regulates MR levels. The study concludesthat GR and MR may have distinctive roles in developing hypo- and hyper-osmoregulatory mechanisms during smoltification and de-smoltification, respectively.� 2007 Elsevier Inc. All rights reserved.

Keywords: Glucocorticoid receptor; GR; Mineralocorticoid receptor; MR; 11b-Hydroxysteroid dehydrogenase type 2; 11b-HSD2; Growth hormonereceptor; GHR; Prolactin receptor; PRLR; Atlantic salmon; Gill; Smoltification

1. Introduction

Smoltification and the acquisition of sea water (SW) tol-erance in salmonids is a process which is regulated by inter-play of several hormones. Many morphological, metabolic,biochemical and physiological changes have been carefullycharacterised in different species and the literature on theendocrinology of these aspects is abundant (Hoar, 1988).Plasma levels of growth hormone (GH), insulin-like growthfactor-I (IGF-I) and cortisol surge during smoltification

0016-6480/$ - see front matter � 2007 Elsevier Inc. All rights reserved.

doi:10.1016/j.ygcen.2006.12.018

* Corresponding author. Fax: +45 6593 0457.E-mail address: steffen@biology.sdu.dk (S.S. Madsen).

and these hormones interact in the stimulation of hypo-os-moregulatory mechanisms (see Hoar, 1988; Bjornsson,1997 for review). Gill chloride cell development andNa+,K+-ATPase activity are two of the functions whichare stimulated by these hormones. Prolactin (PRL) onthe other hand is considered a hyper-osmoregulatory hor-mone in many teleosts (see Manzon, 2002 for review).PRL plasma levels decrease during smoltification (Younget al., 1989; Prunet et al., 1989) and after FW–SW transfer(Prunet et al., 1985; Young et al., 1989), and PRL antago-nizes the SW-adaptive effect of GH and cortisol (Madsenand Bern, 1992; Seidelin and Madsen, 1999). The receptorsfor GH and PRL (GHR and PRLR, respectively) have

296 P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

been detected in gills of teleosts (GHR: Sakamoto and Hir-ano, 1991; Yao et al., 1991; Very et al., 2005; PRLR: seeManzon, 2002 for review; Lee et al., 2006), supporting anosmoregulatory role of the hormones. The PRLR has beenlocalized in chloride cells but the expression pattern of thetwo receptors in the gill during smoltification has not beeninvestigated so far.

Corticosteroid signalling in fish is emerging as a complexphenomenon. Cortisol is the major corticosteroid in teleostfish and plays a fundamental role in regulating mineral bal-ance (see Wendelaar Bonga, 1997 for review). Cortisolfacilitates FW- as well as SW acclimation in euryhaline fish(Laurent and Perry, 1990; Madsen, 1990; Redding et al.,1991; Mancera et al., 2002), and stimulates differentiationand proliferation of gill chloride cells (Perry et al., 1992;Uchida et al., 1998; Dang et al., 2000). It is, however, notunderstood how cortisol may have opposite actionsdepending on the direction of salinity change. Differentialcortisol signalling may be defined by receptor type (gluco-corticoid (GR) or mineralocorticoid (MR)), subtype (GR1or GR2), tissue distribution and co-localization of recep-tors and composition of the receptor binding element inthe target gene promoter. The recent identification of twoGR subtypes with different cortisol binding affinity andtrans-activation activity from rainbow trout, Oncorhynchus

mykiss (Bury et al., 2003) and the unusual DNA-bindingability of teleost fish GR (Lethimonier et al., 2002) exem-plify the complexity of glucocorticoid signalling mecha-nisms. Interaction with other hormones such as PRL,GH and IGF-I may also be crucial for corticosteroid sig-nalling (see Sakamoto et al., 2001 for review).

Cortisol binds with high affinity to both GR and MR. Inmammals; however, significant cortisol signalling throughthe MR is limited by the co-localization of MR with the11b-hydroxysteroid dehydrogenase type 2 enzyme (11b-HSD2). This enzyme converts cortisol to receptor-inactivecortisone (Funder et al., 1988). The conventional MR ligandaldosterone is absent in teleosts due to the lack of synthesiz-ing capability (see Prunet et al., 2006 for review). Neverthe-less, there is experimental evidence that the MR is indeedfunctional and that alternative ligand(s) are involved inMR signalling in fish (Sloman et al., 2001; Scott et al.,2005). The MR has now been cloned and characterized infish (Colombe et al., 2000) but its role and function is largelyunknown. The MR antagonist, spironolactone, decreaseschloride cell density in FW rainbow trout gill (Slomanet al., 2001) and impairs chloride cell proliferation in FW-transferred killifish, Fundulus heteroclitus (Scott et al.,2005) which suggests cortisol signalling through MR inFW acclimation. In addition to binding cortisol andaldosterone, the O. mykiss MR has the ability to bind theintermediate product in mammalian mineralocorticoid syn-thesis 11-deoxycorticosterone, DOC, (Sturm et al., 2005).Teleosts are able to synthesize DOC and levels of DOCneeded to activate MR have been measured in O. mykiss

plasma. DOC may thus be a functional ligand to the MRin fish (see Prunet et al., 2006 for review). Furthermore,

11b-HSD2 was recently identified and cloned in fish (Jianget al., 2003; Kusakabe et al., 2003), which supports the pos-sibility that MR indeed has a specific ligand in fish and a dis-tinct signaling ability compared to GR. The absence ofaldosterone, the presence of MR and DOC and the two dif-ferent GR subtypes propose a sophisticated signaling inter-action between these components in control of salt andwater homeostasis in teleosts. Both receptor types are pres-ent in the gill, where GR is localized in chloride cells (Uchidaet al., 1998; Greenwood et al., 2003). Investigations of therole and dynamics of MR and GR expression during smol-ting and FW–SW transitions are lacking and may contributeimportant information about the physiological function ofthese corticosteroid receptors. Cortisol has an essential rolein the parr-smolt transformation, especially with regard tothe development of gill chloride cells and Na+,K+-ATPaseactivity (McCormick, 1990; Uchida et al., 1998; Sakamotoet al., 2001). In the present study, mRNA expression ofthe GHR, PRLR, GR and MR and 11b-HSD2 was investi-gated in the gill of Atlantic salmon (Salmo salar) duringsmoltification and after acute challenge with SW.

2. Methods

2.1. Fish and sampling

One-year old S. salar (Burishoole stock, average weight: 19.4 g) wereobtained in early March from Danmarks Center for Vildlaks (Randers,Denmark), hand sorted in lower mode and upper mode populationsjudged by size and incipient silvering of the scales, and placed in outdoor500 L fibreglass tanks supplied with flow through tap water on the OdenseCampus (University of Southern Denmark). They were held at ambientphotoperiod and temperature conditions. The fish were fed ad libitum oncedaily with pelleted trout feed. FW fish were sampled at 6 time points dur-ing and after smoltification from March to August. Upon each sampling,subgroups were transferred to 30 ppt artificial SW for 24 h (SW-test) at10 �C and then sampled. When sampled, fish were stunned with a blowto the head and blood collected with a heparinized syringe from the caudalvessels. Blood was held on ice until the plasma was separated by centrifu-gation at 8000g in 3 min, and frozen at �80 �C. Hereafter the fish waskilled by cutting the spinal cord and pithing of the brain. This is anapproved method of euthanasia according to the Animal Health and Ani-mal Welfare Panel of the European Food Safety Authority (EuropeanCommission). Length and weight were recorded for determination of con-dition factor (100 · weight · length�3). For isolation of total RNA, onefirst gill arch was dissected, trimmed away from the cartilage and immedi-ately frozen in liquid N2. For analysis of Na+,K+-ATPase enzymaticactivity, one second gill arch was dissected and frozen in SEI-buffer(300 mM sucrose, 20 mM Na2-EDTA, 50 mM imidazole, pH 7.3) in liquidN2. All tissues were stored at �80 �C until analysis. A piece of caudal mus-culature was carefully dissected from the skin and weighed immediately.This was used for determination of muscle water content.

2.2. Analyses

Plasma osmolality was measured in a 10 ll sample in duplicates on aWescor, 5500 vapor pressure osmometer. Muscle water content (MWC)was determined by drying for >24 h at 100 �C.

2.2.1. Na+,K+-ATPase enzyme activity assay

Approximately 5–7 gill filaments from each sample were homogenizedand assayed for Na+,K+-ATPase activity according to McCormick (1993)at 25 �C using a microplate reader (SPECTRAmax PLUS, Molecular

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 297

Devices, Sunnyvale, CA, USA). Protein content in the gill homogenateswas measured (Lowry et al., 1951) and enzymatic activity was normalizedto protein content and expressed as lmol ADP/mg protein/h.

2.2.2. RNA purification, cDNA synthesis and real time PCR

Total RNA was purified by the TRIzol procedure (Invitrogen, Carls-bad, CA, USA) using 1 ml TRIzol /100 mg gill tissue according to manufac-turer’s recommendation. RNA concentration and purity was determined bymeasuring A260/A280. One microgram RNA was treated with 1 unit RQ1DNase (Promega, Madison, WI, USA) for 30 min at 37 �C in a total volumeof 20 ll followed by 5 min at 75 �C to inactivate RQ1 DNase. Reverse tran-scription was carried out on 1 lg DNase treated RNA with 2 lg randomhexamers (GE Healthcare Bio-Sciences, Little Chalfont, UK) and 200 unitsMMLV reverse transcriptase (Invitrogen) for 1 h at 37 �C in the presence of40 units of RNAguard (GE Healthcare) in a total volume of 25 ll. At theend the cDNA was diluted with 50 ll milliQ H2O. Semi-quantitative realtime PCR analysis using SYBR Green detection was carried out on aMx3000p instrument (Stratagene, La Jolla, CA, USA) using standard soft-ware settings including adaptive baseline for background detection, movingaverage and amplification based threshold settings with the built-in FAM/SYBR filter (excitation wavelength: 492 nm and emission wavelength:516 nm). Reactions were carried out with 1 ll cDNA, 7.5 pmol (GR andMR) or 5 pmol (PRLR, GHR and 11b-HSD2) forward and reverse primer(DNA technology A/S, Denmark), 12.5 ll 2· Brilliant SYBR green mastermix (Stratagene) in a total volume of 25 ll. Cycling conditions: 95 �C for30 s, 60 �C for 60 s and 72 �C for 5 s in 50 cycles (GR and MR) or 40 cycles(PRL, GHR and 11b-HSD2). Melting curve analysis was carried out rou-tinely with 30 s for each 1 �C interval from 55 �C to 95 �C. GR, MR and11b-HSD2 were analyzed in duplicates, PRL and GHR in singles.

2.2.3. Amplification efficiency, normalization and calculations

For each primer set, cDNA was diluted 2, 4, 8 and 16 times in duplicatesand analyzed by real time PCR to determine amplification efficiency detect-ed as the slope of the resultant linear graph of threshold cycle (Ct) versuslog cDNA concentration. The amplification efficiency (Ea) for each primerset was used for calculation of relative copy numbers of the respective tar-get gene. EF1a was used as normalization gene according to Olsvik et al.(2005). To validate the normalization, 18S rRNA was used as a second nor-malization gene. No appreciable differences were observed between theresults obtained with the two normalization genes (not shown). Relativecopy number of the target genes was calculated as 2ð�Ct=EaÞ where Ct isthe threshold cycle number and Ea is the amplification efficiency. Normal-ized units were obtained by dividing the relative copy number of the targetgene with the relative copy number of the normalization gene.

2.2.4. Primers

Primer sequences are listed in Table 1. All primers were designed usingthe NetPrimer software (Premier Biosoft International, CA, USA) withstandard settings and double checked using the Primer3 software (Rozen

Table 1Primers used for real time RT-PCR

Primer name Primer sequence (3 0–5 0)

GHR-forward TGACTTTAAATGCCAGCACAAGGAGHR-reverse TGGTCACCAAATACTTCCCTCTTGAPRLR-forward CTCGAGTCCAAGAGCCAGTCPRLR-reverse CCACACTTCTCCATCAGCAAGR-forward ACGACGATGGAGCCGAACGR-reverse ATGGCTTTGAGCAGGGATAGMR-forward AGACTCGACCCCCACCAAGMR-reverse AACACGCTGCAGATGGA11b-HSD2-forward GCTGCCTATACTCTGCCA11b-HSD2-reverse GCCTGTGATGAAGACAGCEF1a-forward GAGAACCATTGAGAAGTTCGAGAAGEF1a-reverse GCACCCAGGCATACTTGAAAG18S rRNA-forward TATTGTGCCGCTAGAGGTGA18S rRNA-reverse CCTCCGACTTTCGTTCTTGA

and Skaletsky, 2000) and BLASTed. All primers were tested for non-spe-cific product amplification and primer-dimer formation using both meltingcurve analysis and agarose gel verification. In case of lack of S. salar

mRNA sequence information, PCR primers based on conserved regionsof O. mykiss mRNA sequences were used when necessary. As templatefor GHR primers the S. salar GHRI precursor (Accession NumberAY462105) was used. PRLR primers were designed with O. mykiss PRLRas template (Accession Number AF229197). GR primers were designedfrom the O. mykiss GR1 mRNA sequence (Accession Number Z54210).The primers show 67% (forward) and 80% (reverse) identity with the O.

mykiss GR2 sequence (Accession Number AY495372). However, noGR2 product was amplified as the annealing position for the forwardand the reverse primer are at overlapping positions in the GR2 sequence.MR primers were designed from the O. mykiss MR mRNA sequence(Accession Number AF209873) and the amplicon covers both the MRaand MRb sequences resulting in the same product length regardless MRsubtype. Primers for 11b-HSD2 were designed based on the SK1-0935S. salar kidney cDNA clone similar to hydroxysteroid dehydrogenasesequence (Accession Number BG934620). Normalization primers EF1aand 18S rRNA were designed using S. salar sequences (Accession Num-bers AF321836 and AJ427629, respectively). All primers were synthesizedby DNA Technology A/S (Arhus, Denmark).

2.3. Statistics

Since no samples for SW fish were obtained in late June and August,each dataset was evaluated by combining a two-way and a one-wayANOVA. Data from the sampling dates March, April, May and earlyJune for both FW and SW fish were evaluated by a two-way ANOVA,while data from all sampling dates for FW fish were evaluated by a one-way ANOVA. The ANOVAs were followed by a Bonferroni adjustedFisher’s Least Significant Difference (LSD) test where appropriate, takinginto account the total number of pairwise comparisons. When necessarydata were transformed to obtain normality and homogeneity of variances(Zar, 1999). In all cases a significance level of a = 0.05 was used. All testswere performed using SAS (Version 9.1 for Windows, by SAS InstituteInc., Cary, NC, USA).

3. Results

Smoltification of the fish was established by Na+,K+-ATPase activity (Fig. 1), SW tests, measurement of condi-tion factor and determination of silvering of the scales(data not shown). Hypo-osmoregulatory performancewas improved in May and early June and condition factordecreased steadily from March to early June. There was an

Amplicon length Template Accession Number

146 AY462105

79 AF229197

106 AF209873

170 AF209873

74 BG934620

71 AF321836

101 AJ427629

March April May August0

5

10

15

20

25FW

LateJune

EarlyJune

BC

C

AB

A

AB

BC

Na+

,K+-A

TP

ase

acti

vity

(m

ol

AD

P/m

g p

rote

in/h

ou

r)

Fig. 1. Changes in gill Na+,K+-ATPase activity during smoltification ofFW acclimated Atlantic salmon. Values are means ± SEM (n = 6–8).Values with no letters in common are significantly different as determinedby the Bonferroni adjusted Fisher’s LSD test. Overall effect of time wasdetected with a one-way ANOVA (P < 0.0001).

March April May August0

5

10

15

20

25

30

35FW

SW

LateJune

EarlyJune

a

b

bcc

A

C

BCBCBC

AB

PR

LR

no

rmal

ized

toE

F1 α

Fig. 3. Changes in gill PRLR mRNA expression in Atlantic salmonduring smoltification in FW and after 24-h SW challenge. Values aremeans ± SEM (n = 6–8) fish. Values with no letters in common aresignificantly different as determined by the Bonferroni adjusted Fisher’sLSD test (P < 0.05). Upper case letters (e.g. A) are used for FW fish andlower case letters (e.g. a) for SW fish. Stars (w) indicates a significantdifference between the treatments for a specific date. FW and SW datafrom March to early June were analyzed by two-way ANOVA whereasFW data from March to August were analyzed with one-way ANOVA asdescribed in Section 2.

298 P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

overall effect of time (P < 0.0001) on branchial Na+,K+-ATPase activity during smoltification. Na+,K+-ATPaseactivity increased from March to a peak in early June afterwhich the activity decreased to lower levels in late June andAugust (Fig. 1).

GHR mRNA levels of FW fish increased from March toa peak in early June (P < 0.05; Fig. 2). Subsequently, GHRexpression decreased to a level below the March level. SW-challenge increased GHR mRNA levels in April anddecreased levels in early June compared to FW controls(P < 0.05). In March and May no significant effect of SWtransfer was observed. Overall, an interaction between timeand SW transfer on GHR mRNA levels was detected

March April May August10

20

30

40

50

60

70

80FW

SW

LateJune

EarlyJune

ab

ab

a

b

ABB

AB

B

AB

AB

GH

R n

orm

aliz

edto

EF

1 α

Fig. 2. Changes in gill GHR mRNA expression in Atlantic salmon duringsmoltification in FW and after 24-h SW challenge. Values are means ±SEM (n = 6–8). Values with no letters in common are significantlydifferent as determined by the Bonferroni adjusted Fisher’s LSD test(P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower caseletters (e.g. a) for SW fish. Stars (w) indicates a significant differencebetween the treatments for a specific date. FW and SW data from Marchto early June were analyzed by two-way ANOVA whereas FW data fromMarch to August were analyzed with one-way ANOVA as described inSection 2.

(P < 0.0001). There was an overall effect of time on PRLRmRNA levels in FW fish (Fig. 3, P < 0.0001). PRLRmRNA levels decreased from March to May in FW fish(P < 0.05) and remained low until August. SW-challengeinduced an overall increase in PRLR expression at alltime-points (P < 0.0001). GR mRNA levels were stable inFW fish from March to May and then increased to higherlevels in June and August (P < 0.05, Fig. 4). SW transfer

March April May August10

20

30

40

50

60

70FW

SW

LateJune

EarlyJune

a a

bb

C

A

B

AB

CC

GR

no

rmal

ized

toE

F1 α

Fig. 4. Changes in gill GR mRNA expression in Atlantic salmon duringsmoltification in FW and after 24-h SW challenge. Values are means ±SEM (n = 6–8). Values with no letters in common are significantlydifferent (P < 0.05) as determined by the Bonferroni adjusted Fisher’sLSD test. Upper case letters (e.g. A) are used for FW fish and lower caseletters (e.g. a) for SW fish. Stars (w) indicates a significant differencebetween the treatments for a specific date. FW and SW data from Marchto early June were analyzed by two-way ANOVA whereas FW data fromMarch to August were analyzed with one-way ANOVA as described inSection 2.

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 299

did not affect GR expression except for the transfer in May(P < 0.05), where a significant increase in mRNA levels wasobserved compared to FW-controls. There was interactionbetween time and SW transfer on GR mRNA levels duringsmoltification (P < 0.01). MR mRNA levels were stable inFW fish from March to early June after which there was amarked increase in late June and August (P < 0.05, Fig. 5).There was interaction between time and SW-transfer

March April May August20

30

40

50

60

70

80FW

SW

LateJune

EarlyJune

b

a

ab

b

B

A

B

BB

A

MR

no

rmal

ized

toE

F1

α

Fig. 5. Changes in gill MR mRNA expression in Atlantic salmon duringsmoltification in FW and after 24-h SW challenge. Values are means ±SEM (n = 6–8). Values with no letters in common are significantlydifferent as determined by the Bonferroni adjusted Fisher’s LSD test(P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower caseletters (e.g. a) for SW fish. Stars (w) indicates a significant differencebetween the treatments for a specific date. FW and SW data from Marchto early June were analyzed by two-way ANOVA whereas FW data fromMarch to August were analyzed with one-way ANOVA as described inSection 2.

March April May August0

50

100

150

200

250FW

SW

LateJune

EarlyJune

a

a

aa

CD

B

A

A

A

11β-

HS

D2

no

rmal

ized

toE

F1 α

Fig. 6. Changes in gill 11b-HSD2 mRNA expression in Atlantic salmonduring smoltification in FW and after 24-h SW challenge. Values aremeans ± SEM (n = 6–8). Values with no letters in common are signifi-cantly different as determined by the Bonferroni adjusted Fisher’s LSD test(P < 0.05). Upper case letters (e.g. A) are used for FW fish and lower caseletters (e.g. a) for SW fish. Stars (w) indicates a significant differencebetween the treatments for a specific date. FW and SW data from Marchto early June were analyzed by two-way ANOVA whereas FW data fromMarch to August were analyzed with one-way ANOVA as described inSection 2.

(P < 0.01) as SW-transfer induced a significant decreasein MR mRNA levels from March to May (P < 0.05) butdid not affect the level in early June. SW MR expressiongenerally increased from May to early June (P < 0.05).11b-HSD2 mRNA levels increased approximately 10-foldin FW fish from March to a peak in early June (P < 0.05,Fig. 6). There was a significant interaction between timeand treatment on 11b-HSD2 mRNA levels during smoltif-ication (P < 0.0001). SW-transfer induced a markedincrease in 11b-HSD2 expression compared to FW fishfrom March to May (P < 0.05) but there was no effect inearly June.

4. Discussion

A frequently used index of smoltification is the springsurge in gill Na+,K+-ATPase activity, which is also seenin the present experiment. The dynamics of the activity ofthis enzyme reflect SW-type chloride cell developmentand correlate with increased SW-tolerance (see McCor-mick, 1995 for review). The marked drop in enzyme activ-ity following the peak in early June indicates the onset ofde-smoltification and thus loss of SW-tolerance. Theincreased gill enzyme activity has been causally related toincreased plasma cortisol (S. salar: Langhorne and Simp-son, 1986; Sundell et al., 2003) and GH levels (coho salmon(O. kisutch): Young et al., 1989; S. salar: McCormick et al.,1995) and decreased PRL levels (S. salar: Prunet et al.,1989; O. kisutch: Young et al., 1989). Whereas the dynam-ics of these three major osmoregulatory hormones havebeen analysed in several salmonids during smolting andSW-acclimation, studies of the expression of their respec-tive receptor proteins in osmoregulatory target organs arelacking. The present study is the first to characterize chang-es in the gill mRNA levels of these receptors during smol-ting in FW and in response to a 24-h SW-challenge.However, changes in mRNA levels are only indicative ofchanges in protein levels and not necessarily matched bysimilar changes in protein levels in a given tissue. RNA sta-bility and translation rate, post-translational modifications,cellular localization, and protein turnover are some of theadditional determinants of functional protein availability.

4.1. GHR expression

The variation in gill GHR mRNA levels coincided withthe changes in branchial Na+,K+-ATPase activity duringsmolting. A peak in receptor expression in early June wasfollowed by an abrupt decrease coincident with de-smoltif-ication. GH stimulates growth and SW-tolerance duringsmolting (see Bjornsson, 1997 for review), and previousstudies have demonstrated a positive correlation betweenplasma GH levels and gill Na+,K+-ATPase activity(McCormick et al., 1995). The present data suggest that gillGHR levels may also be up-regulated at this point. Nostudies have thus far reported gill GHR expression duringsmolting. Increased GHR mRNA expression was, however,

300 P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

reported in vertebrae of S. salar post-smolts in parallel withincreased GH levels during their first spring in SW (Warge-lius et al., 2005). SW-transfer had a variable effect on gillGHR expression depending on the developmental stageof the fish. During the early parts of smoltification, GHRmRNA levels increased in response to SW-transfer suggest-ing an increased requirement for GH signalling under thesecircumstances. This is consistent with the SW-adaptive roleestablished for GH. On the contrary 24-h SW-transferinduced a decrease in GHR mRNA levels at the smoltifica-tion peak in June. In O. mykiss, SW-transfer induced aninitial decrease in specific GH-binding to liver membraneswhereas binding in gill membranes was unaffected by salin-ity (Sakamoto and Hirano, 1991). This may be due to neg-ative autoregulation by GH on its own receptor, sinceSchmitz et al. (1994) showed that plasma GH increasesafter SW-transfer at the smolt peak but not earlier duringsmolting. Both positive and negative autoregulation ofthe GHR gene by GH have been reported depending onvertebrate species, tissue type and pulsatility of plasmaGH variation (Maiter et al., 1988; Mori et al., 1992; Ben-nett et al., 1995; Hull and Harvey, 1998; Iida et al., 2004).

4.2. PRLR expression

Prolactin receptors are heavily expressed in osmoregu-latory tissues in many teleosts. In the gill, chloride cellsare the primary site for PRLR expression (see Manzon,2002 for review; Lee et al., 2006) in accordance withPRL being an osmoregulatory hormone in teleosts.PRL is a FW hormone in several teleosts including sal-monids (see Manzon, 2002 for review) and high circulat-ing PRL levels are incompatible with the good SWadaptability developed during smolting (Prunet et al.,1985; Madsen and Bern, 1992). The decrease in gillPRLR mRNA levels from March to early June in thecurrent study in concert with a decrease in plasma PRLlevels during smoltification (S. salar: Prunet et al., 1989;O. kisutch: Young et al., 1989) suggests a diminishing rolefor PRL signalling through this period with loss of FW-adaptability. PRLR expression in the gill during smoltif-ication has not previously been reported. Curiously,PRLR expression increased consistently after 24-h SW-transfer throughout the course of smoltification. Thisobservation contrasts the decrease or lack of effect on gillPRLR mRNA levels in BW-transferred Oreochromis nil-

oticus (Sandra et al., 2001) and O. mykiss and the lowergill PRLR mRNA levels in SW than in FW rearedO. mossambicus (see Manzon, 2002 for review). It isunknown whether the present increase in PRLR mRNAlevel lead into an increased de novo synthesis of PRLreceptors or—more likely, is due to a decreased turnoverof PRLR transcripts due to reduced translational activity.Additional information on the dynamics of gill PRLreceptors has come from studies of binding capacity inmembrane preparations. Specific gill PRL binding capac-ity decreased during SW-acclimation in O. mossambicus

(Dauder et al., 1990) but increased in O. niloticus (Auper-in et al., 1995). Thus species differences in response tosalinity shifts seem to occur. Estimation of hormonereceptor population by binding assays may be biased bylack of/or variable stripping efficiency of endogenous hor-mone from its receptor prior to analysis; especially inthose situations where endogenous hormone levels varysignificantly (e.g. salinity shifts).

4.3. GR expression

Several lines of evidence point to an important role forcortisol as a stimulator of metabolic and hypo-osmoregu-latory aspects of smolting. Our current knowledge of thesignaling pathway for cortisol in the gill has mostly comefrom many studies of corticosteroid receptor (CR) bind-ing characteristics in cytosolic and nuclear fractions of gilltissue (see Mommsen et al., 1999 for review). These allpoint to the presence of a single class of receptors withthe typical characteristics of a glucocorticoid receptortype. However, more detailed molecular analyses arerequired subsequent to the recent discovery of two differ-ent corticosteroid receptor types in the gill: a glucocorti-coid and a mineralocorticoid receptor (Ducouret et al.,1995; Colombe et al., 2000; Bury et al., 2003; Sturmet al., 2005). Our data are the first to report the simulta-neous expression of these two receptors in the gill duringsmolting in a salmonid species. The present 2-foldincrease in GR transcript levels during smolting is consis-tent with the increased GR expression during smolting inS. salar (Mazurais et al., 1998) and masu salmon,O. masou (Mizuno et al., 2001), and may explain theincrease in gill CR Bmax observed in smolting O. kisutch

and S. salar (Shrimpton, 1996; Shrimpton and McCormick,2003). Elevated GR expression suggests a need forincreased cortisol signaling during smolting when SW-tol-erance develops, and seems to occur prior to/or concur-rent with elevated plasma cortisol levels (Shrimpton andMcCormick, 2003). A convincing direct relationship hasbeen demonstrated between gill CR Bmax and in vitro

responsiveness of gill Na+,K+-ATPase activity to cortisolin O. mykiss (Shrimpton and McCormick, 1999). Ourdata support that increased GR signaling may be partlyresponsible for this mechanism. The sustained elevationof GR mRNA levels during de-smoltification may contra-dict other reports of a negative feedback regulation of CRby cortisol during the climax stage of smolting when plas-ma cortisol is elevated (Shrimpton, 1996). Still, it isimportant to keep in mind that a direct correlationbetween mRNA and protein levels not necessarily isensured. However, circulating cortisol levels are usuallylow during de-smoltification and the sustained increasein GR expression observed in the present study may bedue to lack of feed-back inhibition at this point. Alterna-tively, the high expression level suggests a dual osmoreg-ulatory function of cortisol during loss of SW-tolerance(Dang et al., 2000; Sakamoto et al., 2001).

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 301

During FW–SW acclimation increased cortisol signal-ling occurs in several euryhaline teleosts as indicated byincreased cortisol levels (see Mommsen et al., 1999 forreview), increased GR mRNA levels, CR numbers and cor-tisol binding capacity in brook trout, Salvelinus fontinalis

(Weisbart et al., 1987); O. mykiss (McLeese et al., 1994);chum salmon, O. keta (Uchida et al., 1998); F. heteroclitus

(Scott et al., 2004). Our data show that the immediateresponse of GR expression to SW-transfer depends onthe stage of smoltification. In March and April there wasno effect, whereas in May there was a significant increasein GR mRNA levels after SW-transfer. This developmentalchange in GR responsiveness to a hyper-osmotic challengesuggests a developing functionality of the GR expressionand signaling pathway which characterizes successful SW-acclimation. The ability to rapidly increase GR signalingin response to SW along with the progressed developmentof gill Na+,K+-ATPase activity are two possible mecha-nisms for increased SW tolerance as the fish approach thesmolt climax. At the peak of smolting, GR mRNA levelsare elevated compared to March and April, and SW-trans-fer does not further affect GR levels. This suggests that GRlevels are sufficient for successful SW-acclimation at thispoint.

4.4. MR and 11b-HSD2 expression

Cortisol signaling is not restricted to the GR; it alsobinds the recently identified MR with high affinity andstimulates trans-activation in vitro (Sturm et al., 2005). Lit-tle is known about general MR expression and function infish. The present data are the first on MR expression dur-ing smolting and suggest that functionality of this receptoris coupled to hyper- rather than hypo-osmoregulation. Theunchanged MR mRNA levels in FW gills during smolting,the abrupt increase at the onset of de-smoltification and thegeneral decrease in transcript levels after SW-transfer sup-port this theory. A role for MR in FW osmoregulation hasbeen suggested in O. mykiss (Sloman et al., 2001) andF. heteroclitus (Scott et al., 2005). The O. mykiss MR notonly binds cortisol but also the intermediate steroid in cor-tisol synthesis, DOC (Sturm et al., 2005), which is presentin fish plasma (Prunet et al., 2006). Since the classicalMR ligand, aldosterone, is absent in teleost fish, DOCseems a likely MR ligand in fish. Mutational analysis ofMR suggests that DOC was in fact the ancient MR agonistprior to evolution of tetrapods (Adami, 2006). In highervertebrates, co-localization of the 11b-HSD2 enzyme withMR governs specific aldosterone signaling through theMR by inactivating and thus reducing cortisol signalingthrough the MR. Recently, the 11b-HSD2 enzyme was alsoidentified in teleost gills, O. mykiss (Kusakabe et al., 2003);Japanese eel (Anguilla japonica) and O. niloticus (Jianget al., 2003), however, there are no reports on expressionlevels in the gill during smolting. The present 10-foldincrease in 11b-HSD2 mRNA levels from March to earlyJune not only coincided with increased GR mRNA levels

but also with elevated Na+,K+-ATPase activity at thesmoltification peak. This potential protection of the MRsuggests that cortisol signalling during smoltification isnot mediated through the MR. This is furthermore sup-ported by the dramatic increase in 11b-HSD2 levels afterSW-transfer. During de-smoltification, high 11b-HSD2 lev-els are sustained at the same time as MR expression isincreased, supporting the presence of a specific ligand forMR signalling. Recent reports of circulating levels ofDOC high enough to activate the MR in O. mykiss andS. salar (see Prunet et al., 2006 for review) strongly suggeststhat DOC is the functional MR ligand in these fish. How-ever, no in vivo effect of DOC or circulating levels duringsmoltification or salinity shifts have yet been established.

In conclusion, the present data suggest that GR andGHR are involved in development of SW-tolerance duringsmoltification and that MR and PRLR signalling areinvolved in establishing hyper-osmoregulation. The distinctregulation of 11b-HSD2 during smolting and SW-chal-lenge suggests the presence of a specific ligand to accountfor MR signalling in fish. The corticosteroid signalingpathway may well be affected by interaction with otherendocrine determinants of osmoregulatory modus: GHand IGF-I in SW-acclimation and PRL in FW-acclimation(Sakamoto et al., 2001).

Acknowledgments

P.K. was supported by a grant from the School ofAquatic Sciences (SOAS, Denmark). S.M. was supportedby a grant from The Danish Natural Research Council(21-02-0520).

References

Adami, C., 2006. Evolution. Reducible complexity. Science 312 (5770),61–63.

Auperin, B., Rentier-Delrue, F., Martial, J.A., Prunet, P., 1995. Regula-tion of gill prolactin receptors in tilapia (Oreochromis niloticus) after achange in salinity or hypophysectomy. J. Endocrinol. 145 (2), 213–220.

Bennett, P.A., Levy, A., Sophokleous, S., Robinson, I.C., Lightman, S.L.,1995. Hypothalamic GH receptor gene expression in the rat: effects ofaltered GH status. J. Endocrinol. 147 (2), 225–234.

Bjornsson, B.Th., 1997. The biology of salmon growth hormone: fromdaylight to dominance. Fish Physiol. Biochem. 17, 9–24.

Bury, N.R., Sturm, A., Le Rouzic, P., Lethimonier, C., Ducouret, B.,Guiguen, Y., Robinson-Rechavi, M., Laudet, V., Rafestin-Oblin,M.E., Prunet, P., 2003. Evidence for two distinct functional glucocor-ticoid receptors in teleost fish. J. Mol. Endocrinol. 31 (1), 141–156.

Colombe, L., Fostier, A., Bury, N., Pakdel, F., Guiguen, Y., 2000. Amineralocorticoid-like receptor in the rainbow trout, Oncorhynchus

mykiss: cloning and characterization of its steroid binding domain.Steroids 65 (6), 319–328.

Dang, Z., Balm, P.H., Flik, G., Wendelaar Bonga, S.E., Lock, R.A., 2000.Cortisol increases Na(+)/K(+)-ATPase density in plasma membranesof gill chloride cells in the freshwater tilapia Oreochromis mossambicus.J. Exp. Biol. 203 (Pt. 15), 2349–2355.

Dauder, S., Young, G., Hass, L., Bern, H.A., 1990. Prolactin receptors inliver, kidney, and gill of the tilapia (Oreochromis mossambicus):characterization and effect of salinity on specific binding of iodinatedovine prolactin. Gen. Comp. Endocrinol. 77 (3), 368–377.

302 P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303

Ducouret, B., Tujague, M., Ashraf, J., Mouchel, N., Servel, N., Valotaire,Y., Thompson, E.B., 1995. Cloning of a teleost fish glucocorticoidreceptor shows that it contains a deoxyribonucleic acid-bindingdomain different from that of mammals. Endocrinology 136 (9),3774–3783.

Funder, J.W., Pearce, P.T., Smith, R., Smith, A.I., 1988. Mineralocorti-coid action: target tissue specificity is enzyme, not receptor, mediated.Science 242 (4878), 583–585.

Greenwood, A.K., Butler, P.C., White, R.B., DeMarco, U., Pearce, D.,Fernald, R.D., 2003. Multiple corticosteroid receptors in a teleost fish:distinct sequences, expression patterns, and transcriptional activities.Endocrinology 144 (10), 4226–4236.

Hoar, W.S., 1988. The physiology of smolting salmonids. In: Hoar, W.S.,Randall, D.J. (Eds.), Fish Physiology, vol. XIB. Academic Press, SanDiego, pp. 275–343.

Hull, K.L., Harvey, S., 1998. Autoregulation of central and peripheralgrowth hormone receptor mRNA in domestic fowl. J. Endocrinol. 156(2), 323–329.

Iida, K., del Rincon, J.P., Kim, D.S., Itoh, E., Coschigano, K.T.,Kopchick, J.J., Thorner, M.O., 2004. Regulation of full-length andtruncated growth hormone (GH) receptor by GH in tissues of lit/lit orbovine GH transgenic mice. Am. J. Physiol. Endocrinol. Metab. 287(3), E566–E573.

Jiang, J.Q., Wang, D.S., Senthilkumaran, B., Kobayashi, T., Kobayashi,H.K., Yamaguchi, A., Ge, W., Young, G., Nagahama, Y., 2003.Isolation, characterization and expression of 11beta-hydroxysteroiddehydrogenase type 2 cDNAs from the testes of Japanese eel (Anguilla

japonica) and Nile tilapia (Oreochromis niloticus). J. Mol. Endocrinol.31 (2), 305–315.

Kusakabe, M., Nakamura, I., Young, G., 2003. 11beta-hydroxysteroiddehydrogenase complementary deoxyribonucleic acid in rainbowtrout: cloning, sites of expression, and seasonal changes in gonads.Endocrinology 144 (6), 2534–2545.

Langhorne, P., Simpson, T.H., 1986. The interrelationship of cortisol, gill(Na + K) ATPase, and homeostasis during the Parr-Smolt transfor-mation of Atlantic salmon (Salmo salar L). Gen. Comp. Endocrinol.61 (2), 203–213.

Laurent, P., Perry, S.F., 1990. Effects of cortisol on gill chloride cellmorphology and ionic uptake in the freshwater trout, Salmo gairdneri.Cell Tissue Res. 259 (3), 429–442.

Lee, K.M., Kaneko, T., Aida, K., 2006. Prolactin and prolactin receptorexpressions in a marine teleost, pufferfish Takifugu rubripes. Gen.Comp. Endocrinol. 146 (3), 318–328.

Lowry, O.H., Roseborough, N.J., Farr, A.L., Randall, R.J., 1951. Proteinmeasurement with the Folin reagent. J. Biol. Chem. 193, 266–275.

Lethimonier, C., Tujague, M., Kern, L., Ducouret, B., 2002. Peptideinsertion in the DNA-binding domain of fish glucocorticoid receptor isencoded by an additional exon and confers particular functionalproperties. Mol. Cell. Endocrinol. 194 (1-2), 107–116.

Madsen, S.S., 1990. The role of cortisol and growth hormone in seawateradaptation and development of hypoosmoregulatory mechanisms insea trout parr (Salmo trutta trutta). Gen. Comp. Endocrinol. 79 (1), 1–11.

Madsen, S.S., Bern, H.A., 1992. Antagonism of prolactin and growth-hormone – impact on seawater adaptation in 2 salmonids, Salmo-trutta

and Oncorhynchus-mykiss. Zool. Sci. 9 (4), 775–784.Maiter, D., Underwood, L.E., Maes, M., Ketelslegers, J.M., 1988. Acute

down-regulation of the somatogenic receptors in rat liver by a singleinjection of growth hormone. Endocrinology 122, 1291–1296.

Mancera, J.M., Laiz Carrion, R., del Pilar Martin del Rio, M., 2002.Osmoregulatory action of PRL, GH, and cortisol in the giltheadseabream (Sparus aurata L). Gen. Comp. Endocrinol. 129 (2), 95–103.

Manzon, L.A., 2002. The role of prolactin in fish osmoregulation: Areview. Gen. Comp. Endocrinol. 125, 291–310.

Mazurais, D., Ducouret, B., Tujague, M., Valotaire, Y., D’Cotta, H.,Gallais, C., Prunet, P., 1998. Regulation of the glucocorticoid receptormRNA levels in the gills of Atlantic salmon (Salmo salar) duringsmoltification. Bull. Fr. Peche Piscicult. (350–351), 499–510.

McCormick, S.D., 1990. Cortisol directly stimulates differentiation ofchloride cells in tilapia opercular membrane. Am. J. Physiol. 259 (4 Pt2), R857–R863.

McCormick, S.D., 1993. Methods for nonlethal gill biopsy and measure-ment of Na+,K+-ATPase activity. Can. J. Fish. Aquat. Sci. 50, 656–658.

McCormick, S.D., 1995. Hormonal control of gill Na+,K+-ATPase andchloride cell function. In: Wood, C.M., Shuttleworth, T.J. (Eds.), FishPhysiology, Ionoregulation: Cellular and Molecular Approaches, vol.XIV. Academic Press, New York, pp. 285–315.

McCormick, S.D., Bjornsson, B.Th., Sheridan, M., Eilertson, C., Carey,J.B., Odea, M., 1995. Increased daylength stimulates plasma growth-hormone and gill Na+,K+-ATPase in Atlantic salmon (Salmo salar). J.Comp. Physiol. B 165 (4), 245–254.

McLeese, J.M., Johnsson, J., Huntley, F.M., Clarke, W.C., Weisbart, M.,1994. Seasonal changes in osmoregulation, cortisol, and cortisolreceptor activity in the gills of parr/smolt of steelhead trout andsteelhead-rainbow trout hybrids, Oncorhynchus mykiss. Gen. Comp.Endocrinol. 93 (1), 103–113.

Mizuno, S., Ura, K., Onodera, Y., Fukada, H., Misaka, N., Hara, A.,Adachi, S., Yamauchi, K., 2001. Changes in transcript levels of gillcortisol receptor during smoltification in wild Masu salmon, Oncorhyn-

chus masou. Zool. Sci. 18 (6), 853–860.Mommsen, T.P., Vijayan, M.M., Moon, T.W., 1999. Cortisol in teleosts:

dynamics mechanisms of action, and metabolic regulation. Rev. FishBiol. Fish. 9 (3), 211–268.

Mori, I., Sakamoto, T., Hirano, T., 1992. Growth hormone (GH)-dependent hepatic GH receptors in the Japanese eel, Anguilla japonica:effects of hypophysectomy and GH injection. Gen. Comp. Endocrinol.85 (3), 385–391.

Olsvik, P.A., Lie, K.K., Jordal, A.E., Nilsen, T.O., Hordvik, I., 2005.Evaluation of potential reference genes in real-time RT-PCR studies ofAtlantic salmon. BMC Mol. Biol. (6), 21.

Perry, S.F., Goss, G.G., Laurent, P., 1992. The interrelationships betweengill chloride cell morphology and ionic uptake in 4 fresh-water teleosts.Can. J. Zool. 70 (9), 1775–1786.

Prunet, P., Boeuf, G., Houdebine, L.M., 1985. Plasma and pituitaryprolactin levels in rainbow trout during adaptation to differentsalinities. J. Exp. Zool. 235 (2), 187–196.

Prunet, P., Boeuf, G., Bolton, J.P., Young, G., 1989. Smoltification andseawater adaptation in Atlantic salmon (Salmo salar): plasma prolac-tin, growth hormone, and thyroid hormones. Gen. Comp. Endocrinol.74 (3), 355–364.

Prunet, P., Sturm, A., Milla, S., 2006. Multiple corticosteroid receptors infish: from old ideas to new concepts. Gen. Comp. Endocrinol. 147 (1),17–23.

Redding, J.M., Patino, R., Schreck, C.B., 1991. Cortisol effects on plasmaelectrolytes and thyroid hormones during smoltification in cohosalmon Oncorhynchus kisutch. Gen. Comp. Endocrinol. 81 (3), 373–382.

Rozen, S., Skaletsky, H.J., 2000. Primer3 on the WWW for general usersand for biologist programmers. In: Krawetz, S., Misener, S. (Eds.),Bioinformatics Methods and Protocols: Methods in Molecular Biol-ogy. Humana Press, Totowa, NJ, pp. 365–386.

Sakamoto, T., Hirano, T., 1991. Growth hormone receptors in the liverand osmoregulatory organs of rainbow trout: characterization anddynamics during adaptation to seawater. J. Endocrinol. 130 (3), 425–433.

Sakamoto, T., Uchida, K., Yokota, S., 2001. Regulation of the ion-transporting mitochondrion-rich cell during adaptation of teleostfishes to different salinities. Zool. Sci. 18 (9), 1163–1174.

Sandra, O., Le Rouzic, P., Rentier-Delrue, F., Prunet, P., 2001.Transfer of tilapia (Oreochromis niloticus) to a hyperosmoticenvironment is associated with sustained expression of prolactinreceptor in intestine, gill, and kidney. Gen. Comp. Endocrinol. 123(3), 295–307.

Schmitz, M., Berglund, I., Lundqvist, H., Bjornsson, B.Th., 1994. Growthhormone response to seawater challenge in Atlantic salmon, Salmo

P. Kiilerich et al. / General and Comparative Endocrinology 152 (2007) 295–303 303

salar, during parr-smolt transformation. Aquaculture 121 (1-3), 209–221.

Scott, G.R., Richards, J.G., Forbush, B., Isenring, P., Schulte, P.M., 2004.Changes in gene expression in gills of the euryhaline killifish Fundulus

heteroclitus after abrupt salinity transfer. Am. J. Physiol. Cell Physiol.287 (2), C300–C309.

Scott, G.R., Keir, K.R., Schulte, P.M., 2005. Effects of spironolactone andRU486 on gene expression and cell proliferation after freshwatertransfer in the euryhaline killifish. J. Comp. Physiol. [B] 175 (7), 499–510.

Seidelin, M., Madsen, S.S., 1999. Endocrine control of Na+,K+-ATPaseand chloride cell development in brown trout (Salmo trutta): interac-tion of insulin-like growth factor-I with prolactin and growthhormone. J. Endocrinol. 162 (1), 127–135.

Shrimpton, J.M., 1996. Relationship between size, gill corticosteroidreceptors, Na+-K+ ATPase activity and smolting in juvenile cohosalmon (Oncorhynchus kisutch) in autumn and spring. Aquaculture 147(1–2), 127–140.

Shrimpton, J.M., McCormick, S.D., 1999. Responsiveness of gill Na+/K+-ATPase to cortisol is related to gill corticosteroid receptorconcentration in juvenile rainbow trout. J. Exp. Biol. 202 (Pt 8),987–995.

Shrimpton, J.M., McCormick, S.D., 2003. Environmental and endocrinecontrol of gill corticosteroid receptor number and affinity in Atlanticsalmon (Salmo salar) during smolting. Aquaculture 222 (1-4), 83–99.

Sloman, K.A., Desforges, P.R., Gilmour, KM., 2001. Evidence for amineralocorticoid-like receptor linked to branchial chloride cellproliferation in freshwater rainbow trout. J. Exp. Biol. 204 (Pt 22),3953–3961.

Sturm, A., Bury, N., Dengreville, L., Fagart, J., Flouriot, G., Rafestin-Oblin, M.E., Prunet, P., 2005. 11-deoxycorticosterone is a potentagonist of the rainbow trout (Oncorhynchus mykiss) mineralocorticoidreceptor. Endocrinology 146 (1), 47–55.

Sundell, K., Jutfelt, F., Agustsson, T., Olsen, R.E., Sandblom, E., Hansen,T., Bjornsson, B.Th., 2003. Intestinal transport mechanisms andplasma cortisol levels during normal and out-of-season parr-smolttransformation of Atlantic salmon, Salmo salar. Aquaculture 222 (1–4), 265–285.

Uchida, K., Kaneko, T., Tagawa, M., Hirano, T., 1998. Localization ofcortisol receptor in branchial chloride cells in chum salmon fry. Gen.Comp. Endocrinol. 109 (2), 175–185.

Very, N.M., Kittilson, J.D., Norbeck, L.A., Sheridan, M.A., 2005.Isolation, characterization, and distribution of two cDNAs encodingfor growth hormone receptor in rainbow trout (Oncorhynchus mykiss).Comp. Biochem. Physiol. B Biochem. Mol. Biol. 140 (4), 615–628.

Wargelius, A., Fjelldal, P.G., Benedet, S., Hansen, T., Bjornsson, B.T.,Nordgarden, U., 2005. A peak in gh-receptor expression is associatedwith growth activation in Atlantic salmon vertebrae, while upregula-tion of igf-I receptor expression is related to increased bone density.Gen. Comp. Endocrinol. 142 (1-2), 163–168.

Weisbart, M., Chakraborti, P.K., Gallivan, G., Eales, J.G., 1987.Dynamics of cortisol receptor activity in the gills of the brook trout,Salvelinus fontinalis, during seawater adaptation. Gen. Comp. Endo-crinol. 68 (3), 440–448.

Wendelaar Bonga, S.E., 1997. The stress response in fish. Physiol. Rev. 77(3), 591–625 (Review).

Yao, K., Niu, P.D., Le Gac, F., Le Bail, P.Y., 1991. Presence of specificgrowth hormone binding sites in rainbow trout (Oncorhynchus mykiss)tissues: characterization of the hepatic receptor. Gen. Comp. Endo-crinol. 81 (1), 72–82.

Young, G., Bjornsson, B.T., Prunet, P., Lin, R.J., Bern, H.A., 1989.Smoltification and seawater adaptation in coho salmon (Oncorhynchus

kisutch): plasma prolactin, growth hormone, thyroid hormones, andcortisol. Gen. Comp. Endocrinol. 74 (3), 335–345.

Zar, J.H., 1999. Biostatistical Analysis, fourth ed. Prentice-Hall, UpperSaddle River, NJ, USA.