1

Glycosphingolipids on human myeloid cells stabilize E-selectin dependent rolling in the multistep leukocyte adhesion cascade

Nandini Mondal1, Gino Stolfa1, Aristotelis Antonopoulos4, Yuqi Zhu1, Shuen-Shiuan Wang1, Alexander Buffone, Jr.1, G. Ekin Atilla-Gokcumen2, Stuart M. Haslam4, Anne Dell4 and Sriram

Neelamegham1,3

1 Department of Chemical and Biological Engineering, 2Chemistry and 3The NY State Center for Excellence in Bioinformatics and Life Sciences, State University of New York, Buffalo, NY 14260, USA

4 Department of Life Sciences, Imperial College London, London, SW7 2AZ, UK

CONTENTS

Methods and References

2

METHODS Materials: HEK293T cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) containing 10% FBS. Human umbilical vein endothelial cells (HUVEC) purchased from Lonza (Walkersville, MD) were grown in EBM-2 medium. HL-60 cells (ATCC, Manassas, VA) were maintained in Iscove’s Modified Dulbecco’s Medium (IMDM) with 10% FBS. In some cases, the HL-60s were differentiated to granulocytes by addition of 1.3% DMSO for 5 days 1. The resulting cells are abbreviated ‘diff-HL-60’.

Unless mentioned otherwise, all reagents were mouse anti-human monoclonal antibodies (mAbs) purchased from BD Biosciences (San Jose, CA). These include phycoerythrin (PE)-conjugated mAbs against PSGL-1/CD162 (clone KPL1), CD11b/Mac-1 (D12) and CD45 (2D1, eBiosciences, San Diego, CA), FITC-conjugated mAbs against CD44 (G44-26), Lewis-X (LeX)/CD15 (HI98), CD65s (VIM-2, Serotec, Oxford, UK) and cutaneous lymphocyte antigen/CLA (rat mAb HECA-452), and unconjugated anti-sialyl Lewis-X/sLeX mAb CSLEX-1. Unconjugated mAbs used for function blocking studies include rat anti-mouse PSGL-1 clone 2PH1, anti-P-selectin mAb G1, anti-human E-selectin mAbs HAE-1f (Ancell, Bayport, MN) and P2H3 (eBiosciences), and anti-CD18 mAb IB4 (ATCC). All lectins were purchased from Vector laboratories (Burlingame, CA).

Flow cytometry: All directly conjugated mAbs and lectins were incubated with cells at ~0.5-10μg/mL for 20min. at 4ºC prior to washing and flow cytometry analysis. Unlabeled mAbs had a second incubation step with 1:250 diluted Alexa-488 conjugated anti-mouse secondary antibody (Invitrogen, Carlsbad, CA) for an additional 20min. prior to analysis. Biotinylated lectins were detected using 10µg/ml fluorescein conjugated goat anti-biotin antibody (Vector Labs). Primary neutrophil isolation: All human subject protocols were approved by the SUNY-Buffalo Health Science Institutional Review Board (Buffalo, NY). Human neutrophils were isolated from normal adult volunteers as described previously 2. Mouse neutrophils were isolated from the bone marrow of either male or female 8-12 week old C57BL/6 mice 3. Here, the femur and tibia were collected. Bone marrow was aspirated, washed and re-suspended in 1ml PBS. This was layered on a gradient composed of 3ml histopaque-1077 (Sigma Chemical Co, St. Louis, MO) on top of 3ml histopaque-1119. Following centrifugation at 700×g for 30min at room temperature, the granulocytes were collected from the band at the junction of the two histopaque layers. All studies with primary cells were completed within 3h of isolation. Hematopoietic stem cell isolation, differentiation and transduction: Human placental and umbilical cord blood was kindly collected by Dr. Dennis Weppner (Millard Fillmore Suburban Hospital, Williamsville, NY). CD34+ human hematopoietic stem cells (hHSCs) were purified from this blood using the EasySep human CD34+ cell separation kit (StemCell Technologies, Vancouver, Canada) 3. These cells were cultured in complete IMDM growth medium with 50ng/ml recombinant human Stem Cell Factor (SCF) and 50ng/ml Interleukin-3 (IL-3) for 2 days. The concentration of SCF and IL-3 was reduced 2-fold every 48h thereafter until day-7 when additional 25ng/ml recombinant human Granulocyte Colony Stimulating Factor (GCSF) was added. In some cases, lentivirus encoding for DsRed reporter along with either UGCG shRNA or no shRNA (‘DsRed’) control was added on day-5. On Day-10, SCF and IL-3 were removed and cells were cultured with 25ng/ml GCSF alone till day 12-14 when functional experiments were performed. Gene silencing in HL-60 and hHSCs using lentivirus: Lentivirus carrying shRNA (Supplemental Table II) targeting human UGCG were prepared using vectors obtained from the MISSION® shRNA library. Here, the U6 promoter drives shRNA expression. To this end,

3

Lentiviral particles were produced by co-transfecting HEK293T cells with: 1) 20μg of the shRNA plasmid (transfer construct), 2) 15μg of the packaging vector psPAX2, and 3) 10μg of the VSVG envelope vector pMD2.G using calcium phosphate precipitation method in 150mm tissue culture dishes 4. 8-14h post-transfection, the HEK293T cell culture media was changed to DMEM with 10% FBS containing 10mM sodium butyrate. Forty eight hours thereafter, the supernatant medium containing viral particles was collected and filtered through a 0.45μm pore size syringe filter. This was then centrifuged at 50,000×g for 2h to pellet the virus. 100× concentrated viral suspension was then prepared by dissolving the resulting pellet in serum free DMEM. This was either used immediately or flash-frozen in liquid nitrogen before being stored at -80˚C.

For transduction of leukocytes, 30,000 cells were plated per well in a 24 well plate containing 500μl normal growth medium (IMDM with 10% FBS and antibiotics). 8μg/ml (final concentration) polybrene was added to cells for 5 min at 37ºC. Following this, 50-100μl 100× lentivirus concentrate was added to individual wells. Sixteen hours post-transduction, the cells were diluted with 2mL growth medium and transferred to normal tissue culture treated 6 well plates for expansion. 0.5μg/ml puromycin was added for selection in some cases. Quantitative RT-PCR was then applied in order to determine shRNA that reduced UGCG mRNA expression by >90% (Supplemental Table II, III).

The puromycin selection cassette in the original vector containing the most efficient shRNA was replaced with a red fluorescent reporter, DsRed. Corresponding lentivirus were applied to generate the ‘UGCG¯HL-60’ cells that have reduced UGCG activity. During the transduction step, viral titers were optimized for ~100% transduction, and thus cell sorting was not performed to select for any particular sub-population. Two weeks after transduction, the reduction in UGCG enzymatic activity was confirmed using enzymology assays that utilized a fluorescent ceramide acceptor (described in ‘UGCG enzyme activity’ section below).

CD34+ hHSCs were isolated from umbilical cord blood, and differentiated towards neutrophils as described above 5. These cells were transduced with lentivirus encoding either UGCG shRNA to obtain ‘UGCG¯-Neu’ cells or control vector lacking shRNA to obtain ‘DsRed-Neu’ cells. All differentiated cells at day 12-14 robustly expressed CD11b and lacked CD34 expression 5. 40% of these cells were polymorphonuclear with a number of the remaining cells at the band stage. Genome editing with CRISPR-Cas9: The target sequence on UGCG (5’- GCTGTGGCTGATGCATTTCATGG) was determined using the CRISPR Design tool6 by minimizing exonic off-target sites. This sequence was cloned into the pX330-U6-Chimeric_BB-CBh-hSpCas9 vector (Addgene #42230), and electroporated into HL-60s 5. After 2 weeks, editing was verified by amplifying the genomic DNA that surrounded the CRISPR target site using primer set-3 (Supplemental Table III) and applying the SURVEYOR nuclease assay (Transgenomic, Omaha, NE). After verification, isogenic clones of edited cells were obtained by flow sorting single HL-60 cells and scaling them up in HL-60 cell culture conditioned media. Genome editing in the individual clones was confirmed by Sanger sequencing. The cell line obtained using this method is termed ‘UGCG-KO HL-60’. Quantitative Real-Time PCR: This method follows from previous work 1. Briefly, total RNA was isolated using the Trizol Reagent (Life Technologies, Grand Island, NY) from both wild-type and UGCG knockdown HL-60s. Real time PCR reactions, using the qScript one-step SYBR green qRT-PCR kit (Quanta Biosciences, Gaithersburg, MD) were performed on the My iQ Single-Color Real-Time PCR Detection System (Bio-Rad). Primer pairs for each mRNA including the housekeeping gene (RPL32) are listed in Supplemental Table III. Relative mRNA levels are derived from ΔCt, the difference of the threshold cycle (Ct) value of the target mRNA and the Ct value for the housekeeping gene. PCR product correctness was confirmed using agarose gel

4

electrophoresis to monitor product molecular weight and by performing DNA sequencing of excised bands. UGCG enzyme activity: WT, UGCG¯-HL-60 and UGCG-KO HL-60 cells at 150×106 cells/mL in PBS were lysed by four rapid freeze-thaw (-80˚C/37˚C) cycles. The suspension was then centrifuged at 14,000×g for 25min at 4˚C. Protein concentration in the collected supernatant was measured using the Coomassie/Bradford method (Thermo-Pierce, Rockford, IL). UGCG enzymatic activity was then assayed using a fluorescent ceramide substrate 7. Briefly, 12.5µg C6-NBD Ceramide (Avanti Polar Lipids, Alabaster, Alabama) and 125µg lecithin were dissolved in 25µL ethanol and solvent evaporated. 250μl water was then added and the sample was sonicated for 4h to form liposomes. 20μL liposome was then added to a 100µL reaction mixture that contained 20mM Tris-HCl (pH 7.5), 50µg enzyme source and 500µM UDP-Glucose. Following overnight reaction at 30˚C, the reaction was stopped using 100µL Chloroform-Methanol (2:1), mixed gently and centrifuged at 14,000×g for 10min. The bottom organic layer was collected, solvent evaporated and applied to a silica gel 60 plate (EMD Chemicals, Gibbstown, NJ). The mobile phase was Chloroform:Methanol:12mM MgCl2 in water::65:25:4. TLC plates were imaged using a UVP ChemiDoc imaging system (Upland, CA) with UV excitation at 302nm and 570-640nm emission filters. Negative controls included runs without cell lysates, and runs with 500µM GDP-Fuc replacing UDP-Glc in the reaction mixture. Targeted sphingolipid profiling by LC-MS: ~40×106 WT and UGCG-KO HL-60 cells were pelleted and resuspended in 1mL PBS and Dounce-homogenized in PBS:MeOH:CHCl3 (1:1:2) 8. The resulting suspension was centrifuged at 500×g for 10min followed by the separation of the chloroform layer from the aqueous layer. Samples were evaporated and re-dissolved in 120μL chloroform. LC-MS analysis was performed with 30μL lipid extract being injected into an Agilent 6530 Series Accurate-Mass Quadrupole Time-of-Flight LC-MS in positive mode (n=3) 9,

10. A Luna C5 reversed phase column (5 μm, 4.6 mm x 50 mm, Phenomenex) was used for separation with mobile phases buffer A=H2O:MeOH (95:5) and buffer B=2-propanol:MeOH:H2O (60:35:5) containing 0.1% formic acid and 5 mM ammonium formate. Flow rate started at 0.1 mL/min with buffer A for 5 min followed by a flow rate of 0.5 mL/min for the duration of the 60-miniute gradient to buffer B. Capillary and fragmentor voltages were 3500 V and 175 V, drying gas temperature was 350°C and nebulizer pressure was 30 psi. During MS/MS experiments different collision energies were tested with optimal ionization and fragmentation being observed at 15V, 35V, 55V, 75V and 95V. Glycomics studies: HL-60 cells (WT, UGCG¯ and UGCG-KO) were treated as described previously 5. Endo-β-galactosidase digestion (Escherichia freundii; E.C. 3.2.1.103; Seikagaku Corp, AMS Biotechnology Ltd, 100455) was carried out in 200μL of sodium acetate (50 mM, pH 5.8, 37 °C). 40mU of the enzyme were added to the sample for 48h with a fresh aliquot added after 24h. Microfluidic cell adhesion and transmigration analysis: Cell adhesion assays were performed with primary human/mouse neutrophils, neutrophils derived from hHSCs (DsRed/UGCG¯-Neu), HL-60s (WT/UGCG¯/UGCG-KO-HL60), and also HL60s differentiated towards neutrophils using 1.3% DMSO for 5-days (‘diff-HL-60’). In all cases, the leukocytes were washed and re-suspended in HEPES buffer (30mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid, 110mM NaCl, 10mM KCl, 1mM MgCl2, 10mM Glucose, pH7.4) containing 1.5mM CaCl2 and 0.1% human serum albumin (HSA) prior to the cell adhesion assays. 2×106 leukocytes/ml were then perfused at 1-2 dyne/cm2 over selectin bearing substrates composed of either E-selectin bearing stimulated HUVECs (Human Umbilical Vein Endothelial Cells), or recombinant P-selectin-IgG under conditions identical to our recent work 5.

5

In some cases, the leukocytes were incubated with 1mg/ml pronase at 37ºC for 1h and washed thrice before experimentation. Selectin binding function was blocked in other instances by addition of 20μg/ml blocking mAbs for 10-15min at room temperature.

Cell adhesion movies were captured at 2 frames/sec. Here, interacting cells were defined to be cells that moved at speeds less than the estimated free stream velocity of 10μm spheres at that shear rate 2. Among these, cells moving less than one cell diameter in a 10s period are defined to be adherent, whereas the rest were classified as rolling 2, 11. Cell rolling velocity was calculated by tracking individual cells for 10s.

During ‘tether analysis’, detailed frame-by-frame analysis was performed over a 4-min experimental window. Here, ‘total tethers’ quantifies the number of cells that displayed velocities less than the free stream velocity for at least 1s, i.e. two consecutive frames. The individual tethered cells were then classified into 3-groups: a) ‘Rolling’ if the cells either rolled out of the field of view (FOV) or continued to roll at the end of the 4-min experiment, b) ‘Detached’ if they separated from the substrate and left the FOV with the free stream, c) ‘Adherent’ if they firmly bound to the substrate. Here, ‘instantaneous velocity’ quantifies the distance traversed by an individual cell in a 1s interval.

During ‘transmigration analysis’, the diff-HL60s were allowed to bind stimulated HUVECs under static or 1 dyn/cm2 shear conditions. In the static assays, 200,000 diff-HL60s were added to stimulated HUVEC monolayers plated on glass bottom 24-well plates. The flow studies were identical to above. In both cases, the transmigrated cells appear phase-dark with clear extended lamellipodia, while the non-transmigrated cells are phase-bright and round in appearance. Here, % Transmigration = 100 × number of phase-dark/(phase-bright + phase-dark cells). Statistics: Data are presented as mean ± SEM for ≥3 experiments. Student’s t-test (two-tailed) was performed for dual comparisons. ANOVA followed by the Tukey post-test was applied for multiple comparisons. P<0.05 was considered significant.

6

REFERENCES

1. Marathe DD, Chandrasekaran EV, Lau JT, Matta KL, Neelamegham S. Systems-level studies of glycosyltransferase gene expression and enzyme activity that are associated with the selectin binding function of human leukocytes. FASEB J. 2008;22:4154-4167.

2. Zhang Y, Neelamegham S. Estimating the efficiency of cell capture and arrest in flow chambers: study of neutrophil binding via E-selectin and ICAM-1. Biophys J. 2002;83:1934-1952.

3. Mondal N, Buffone A, Jr., Stolfa G, Antonopoulos A, Lau JT, Haslam SM, Dell A, Neelamegham S. ST3Gal-4 is the primary sialyltransferase regulating the synthesis of E-, P-, and L-selectin ligands on human myeloid leukocytes. Blood. 2015;125:687-696.

4. Buffone A, Mondal N, Gupta R, McHugh KP, Lau JT, Neelamegham S. Silencing α1, 3-fucosyltransferases in human leukocytes reveals a role for FUT9 enzyme during E-selectin-mediated cell adhesion. Journal of Biological Chemistry. 2013;288:1620-1633.

5. Mondal N, Buffone A, Jr., Stolfa G, Antonopoulos A, Lau JT, Haslam SM, Dell A, Neelamegham S. ST3Gal-4 is the primary sialyltransferase regulating the synthesis of E-, P- and L-selectin ligands on human myeloid leukocytes. Blood. 2015;125:687-696.

6. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Multiplex genome engineering using CRISPR/Cas systems. Science. 2013;339:819-823.

7. Ichikawa S, Hirabayashi Y. [33] Genetic approaches for studies of glycolipid synthetic enzymes. In: Alfred H. Merrill JYAH, ed. Methods in Enzymology. Academic Press; 2000;311:303-318.

8. Saghatelian A, Trauger SA, Want EJ, Hawkins EG, Siuzdak G, Cravatt BF. Assignment of endogenous substrates to enzymes by global metabolite profiling. Biochemistry. 2004;43:14332-14339.

9. Atilla-Gokcumen GE, Bedigian AV, Sasse S, Eggert US. Inhibition of glycosphingolipid biosynthesis induces cytokinesis failure. J Am Chem Soc. 2011;133:10010-10013.

10. Atilla-Gokcumen GE, Muro E, Relat-Goberna J, Sasse S, Bedigian A, Coughlin ML, Garcia-Manyes S, Eggert US. Dividing cells regulate their lipid composition and localization. Cell. 2014;156:428-439.

11. Marathe DD, Buffone A, Jr., Chandrasekaran EV, Xue J, Locke RD, Nasirikenari M, Lau JT, Matta KL, Neelamegham S. Fluorinated per-acetylated GalNAc metabolically alters glycan structures on leukocyte PSGL-1 and reduces cell binding to selectins. Blood. 2010;115:1303-1312.