1 3

Arch Microbiol (2014) 196:25–33DOI 10.1007/s00203-013-0935-1

ORIGINAL PAPER

Extracellular expression of glucose inhibition‑resistant Cellulomonas flavigena PN‑120 β‑glucosidase by a diploid strain of Saccharomyces cerevisiae

David J. Mendoza‑Aguayo · Héctor M. Poggi‑Varaldo · Jaime García‑Mena · Ana C. Ramos‑Valdivia · Luis M. Salgado · Mayra de la Torre‑Martínez · Teresa Ponce‑Noyola

Received: 26 August 2013 / Revised: 16 October 2013 / Accepted: 23 October 2013 / Published online: 12 November 2013 © Springer-Verlag Berlin Heidelberg 2013

and even at 500 mM glucose concentration, more than 30 % of its activity was preserved. Due to these charac-teristics of BGLA15 activity, recombinant S. cerevisiae is able to utilize cellulosic materials (cello-oligosaccharides) to produce bioethanol.

Keywords Cellulomonas flavigena · β-Glucosidase · Inhibition resistant · Saccharomyces cerevisiae

Introduction

Plant biomass may be used as feedstock to produce liquid fuels such as bioethanol, a promising alternative source of energy (Bayer et al. 2007; van Zyl et al. 2007; Yamada et al. 2011). Cellulose is hydrolyzed by endoglucanases and exo-glucanases to cellobiose and cello-oligosaccharides, which are converted to glucose by the action of β-glucosidase. This enzyme is a limiting step in the degradation of cel-lulose because it restricts hydrolysis efficiency of exoglu-canase and endoglucanase, which are inhibited by cellobi-ose or cello-oligosaccharides (Yan et al. 1998; Shen et al. 2008).

β-Glucosidases constitute a major group among the glycoside-hydrolyzing enzymes. They belong to fami-lies 1(GH1) and 3 (GH3) and catalyze selective cleavage of the glycosidic bond (Henrrissat et al. 1989; Lynd et al. 2002; Hong et al. 2007). β-Glucosidase is present in all taxonomic kingdoms, from bacteria to highly developed mammals (Bhatia et al. 2002). The most extensively stud-ied β-glucosidases are those found in fungi, such as Tricho-derma reesei, Aspergillus aculeatus and Saccharomycopsis fibuligera, and bacteria, such as Cellulomonas flavigena, Clostridium, Ruminococcus and Acetivibrio (Schuster and Chinn 2012).

Abstract The catalytic fraction of the Cellulomonas flavigena PN-120 oligomeric β-glucosidase (BGLA) was expressed both intra- and extracellularly in a recombi-nant diploid of Saccharomyces cerevisiae, under limited nutrient conditions. The recombinant enzyme (BGLA15) expressed in the supernatant of a rich medium showed 582 IU/L and 99.4 IU/g dry cell, with p-nitrophenyl-β-d-glucopyranoside as substrate. BGLA15 displayed activity against cello-oligosaccharides with 2–5 glucose mono-mers, demonstrating that the protein is not specific for cel-lobiose and that the oligomeric structure is not essential for β-d-1,4-bond hydrolysis. Native β-glucosidase is inhib-ited almost completely at 160 mM glucose, thus limiting cellobiose hydrolysis. At 200 mM glucose concentration, BGLA15 retained more than 50 % of its maximal activity,

Communicated by Erko Stackebrandt.

D. J. Mendoza-Aguayo · H. M. Poggi-Varaldo · A. C. Ramos-Valdivia · T. Ponce-Noyola (*) Departamento de Biotecnología y Bioingeniería, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, AV. IPN 2508, 07300 Zacatenco, DF, Méxicoe-mail: tponce@cinvestav.mx

J. García-Mena Departamento de Genética y Biología Molecular, Centro de Investigación y de Estudios Avanzados del Instituto Politécnico Nacional, AV. IPN 2508, 07300 Zacatenco, DF, México

L. M. Salgado CICATA, Unidad Querétaro, Instituto Politécnico Nacional, Cerro blanco 141, 76090 Querétaro, México

M. de la Torre-Martínez Departamento de Análisis de los Alimentos, Centro de Investigación en Alimentación y Desarrollo, Carretera a la Victoria Km 6, 83304 Hermosillo, Sonora, México

26 Arch Microbiol (2014) 196:25–33

1 3

Cellulomonas flavigena is a facultative anaerobe bac-terium, which grows better aerobically and is capable of hydrolyzing cellulose and hemicellulose. C. flavigena PN-120 is a derepressed mutant that produces cellulases resistant to inhibition by high cellobiose concentrations. This mutant hyperproduces an oligomeric β-glucosidase (BGLA) of family 3 (Ponce-Noyola and de la Torre 2001), with three times greater affinity for cellobiose than its parental strain (Barrera-Islas et al. 2007). However, in bac-teria, this enzyme remains intracellular and is thus incapa-ble of hydrolyzing extracellular cellobiose.

The aim of the current work was to express the C. fla-vigena PN-120 β-glucosidase catalytic fraction extracellu-larly in a recombinant diploid of S. cerevisiae, under lim-ited nutrient conditions. The capacity of the recombinant enzyme to hydrolyze cello-oligosaccharides with different degrees of polymerization was evaluated as well as the inhibition of the recombinant enzyme at high glucose con-centrations, with the aim of using this yeast for bioethanol production.

Materials and methods

Strains and growth conditions

Cellulomonas flavigena PN-120 was grown on mineral medium, 0.2 % yeast extract and 1 % pretreated sugar-cane bagasse (Ponce-Noyola and de la Torre 1995), for 48 h at 37 °C. E. coli DH5α was used to replicate the vec-tors developed in this work. Cells were grown on Luria–Bertani broth (Difco laboratories, Detroit, MI, USA) for 24 h at 37 °C. The S. cerevisiae haploids 2D (MATα, leu2d, ura3) and 24D (MATa, leu2d, ura3) were donated by Dr. Samuel Zincker Ruzal (CINVESTAV, Mexico City). S. cerevisiae strain 2-24D was used to express recombinant β-glucosidase. Haploid and diploid yeasts were grown on YPD medium (1 % yeast extract, 2 % bacto-peptone, 2 % glucose). Confirmation of diploid cells was assessed on sporulation medium (1 % potassium acetate, 0.1 % yeast extract, 0.05 % glucose, 2 % bacto-agar). Transformant yeast was aerobically cultured in both SC medium (1.7 g/L yeast nitrogen base without amino acids, 5 g/L (NH4)2SO4, 20 g/L glucose, 1 mL/L Dropout mix Ura−) and SC-cello-biose medium (1.7 g/L yeast nitrogen base without amino acids, 5 g/L (NH4)2SO4, 20 g/L cellobiose, 1 mL/L Drop-out mix Ura−). In all cases, S. cerevisiae cultures were incubated at 30 °C for 36 h.

bglA amplification and vector construction

Genomic DNA was extracted from C. flavigena PN-120 and E. coli vectors by standard techniques (Sambrook

et al. 1989). A fragment containing the C. flavigena PN-120 bglA ORF was amplified with Eco-bgl (forward) and Bam-bgl (reverse) primers. The amplicon was purified with the Wizard® SV gel and PCR clean-up system (Promega, Madison, WI, USA) and cloned into pBluescript KSII by standard ligation techniques. The ligation mixture was used to transform competent E. coli DH5α cells, which were selected using Luria–Bertani plates supplemented with 100 μg/mL ampicillin. The resulting plasmid pKSII-bglA was used as template to amplify the bglA ORF using the forward D-KKS01 and reverse D-ESA01 primers. The amplified fragment containing the bglA ORF and flanking sequences was cloned into the pYEX-S1 plasmid, and the construction was named pS1-bglA (Fig. 1). Details of the strains, plasmids and primers used in this study are shown in Table 1.

Diploid strain construction

The diploid strain 2-24D was constructed by mating the haploid Saccharomyces 2D and 24D strains. The haploid cells were grown separately in liquid YPD medium with LEU and URA as selection markers for 24 h at 30 °C. Cells were harvested, spread together in YPD plates supple-mented with the same selection markers and incubated for 96 h at 30 °C. Diploidy was confirmed by spore formation on sporulation medium, after incubation for 72 h at 30 °C.

Yeast transformation

Saccharomyces cerevisiae 2-24D strain was transformed with the pS1-bglA plasmid construction using the lith-ium acetate method (Gietz and Woods 2006). Yeast was grown at 30 °C overnight on YPD liquid medium; 1 mL of this suspension was added to 50 mL of fresh YPD liquid medium and incubated for 3 h at 30 °C. Cells from 25 mL of medium were recovered by centrifugation at 3,000×g for 5 min. Thereafter, the pellet was washed twice with sterile distilled water at same conditions and resuspended in 1 mL of sterile distilled water. One mL containing 1 × 108 cells was placed in a 1.5-mL sterile Eppendorf tube and centrifuged. The supernatant was discarded, and the pellet was resuspended in 360 μL of TMix [66.7 % PEG 4,000 (50 % w/v), 10 % LiAc 1 M, 2 mg/mL SS DNA carrier, 100 ng plasmid, 1 % DMSO and adjusted to 360 μL with sterile distilled water]. The suspension was incubated at 30 °C for 30 min and 300 rpm and then for 15 min at 42 °C in a Multi-Block Heater (Lab-Line instru-ments, Inc., Melrose Park, ILL.). Finally, cells were cen-trifuged, the pellet was resuspended in 1 mL of sterile dis-tilled water and 100–200 μL was spread on SC medium with the appropriate selection marker and incubated for 2–5 days at 30 °C.

27Arch Microbiol (2014) 196:25–33

1 3

β-glucosidase production

Transformant cells were grown in Erlenmeyer flasks con-taining YPD medium at 30 °C, 250 rpm for 36 h. Shake flasks were inoculated to a final concentration of 5 × 105 cells/mL from an overnight SC culture. Samples were har-vested and assayed for β-glucosidase activity.

Protein purification

Recombinant yeast was grown on YPD for 36 h. Cells were harvested by centrifugation, and the supernatant was used for protein purification. The supernatant was ultrafiltered through a 30 kDa cutoff size membrane to obtain 10 % of original volume (called “crude extract”). A 3 mL ali-quot of the crude extract was applied onto a Q-Sepharose anion exchange column (1.5 × 5.0 cm) (Amersham Bio-science) pre-equilibrated with 25 mM of Tris–HCl pH 7.2. β-Glucosidase was eluted using 0.6 M KCl, and fractions with pNPGase activity were collected and pooled. One mL of sample was chromatographed in a Sephacryl S-200HR column (1.5 × 25.0 cm), pre-equilibrated with 25 mM of

Tris–HCl pH 7.2. Fractions were pooled, and the procedure was repeated once. Fractions with enzyme activity were used for further characterization.

Electrophoretic methods

Enzyme purity at various steps of purification was moni-tored by 10 % SDS-PAGE. Native gel electrophore-sis was performed using the same protocol but without β-mercaptoethanol. Protein bands were visualized with Sypro Ruby (Molecular probes, S12000). Zymograms were performed spreading over the gel 1 mM MUG in 50 mM sodium phosphate buffer pH 6.2 and were incubated at 40 °C for 40 min or until fluorescent bands appeared under UV light (360 nm).

Enzymatic assays

β-Glucosidase was evaluated using p-nitrophenyl β-d-glucopyranoside (pNPG). One mL of diluted enzyme and 1 mL 50 mM sodium phosphate buffer (pH 6.2) were equil-ibrated at 40 °C for 5 min. The reaction was initiated by

Fig. 1 pS1-bglA construct procedure. The initial fragment was amplified with Eco-bgl and Bam-bgl primers from genomic C. flavi-gena PN-120 DNA. It was composed of a 319-bp sequence upstream of the start codon (f1), the bglA ORF region and a137-bp sequence downstream from the stop codon (f2). pBluescript KSII was digested with EcoRI and BamHI for insertion of the bglA PCR fragment digested with the same restriction enzymes, and the fragment was then used to transform E. coli DH5α. pKSII-bglA was used as tem-plate for the amplification of bglA ORF (2,220 pb) with the D-KKS01

and D-ESA01 primers, resulting in flanking sequences containing EcoRI sites. The amplified fragment from pKSII-bglA contained the kex2 sequence and the serine protease recognition sequence kozak both located upstream of the blgA start codon. pYEX-S1 was digested with EcoRI restriction enzyme and used for insertion of the kex2-kozak-bglA ORF fragment. The pS1-bglA construct was used to transform a diploid S. cerevisiae strain 2-24D, and the resulting recombinant yeast was assayed with MUG and pNPG for extracellu-lar β-glucosidase activity

28 Arch Microbiol (2014) 196:25–33

1 3

the addition of 1 mL of 1 mM pNPG (preheated for 5 min at 40 °C) and stopped by addition of 1 mL 1 M sodium carbonate after 40 min incubation. p-nitrophenol release was measured at 400 nm, and enzyme activity was cal-culated with the extinction coefficient for p-nitrophenol (18.5 mM−1) (Spiridonov and Wilson 2001). One pNPGase unit was defined as the amount of p-nitrophenol (μmol) released per min−1 mL−1 under standard assay conditions.

BGLA15 specificity

BGLA15 activity on cello-oligosaccharides was examined by TLC. The reaction mixture containing 6 μg of cello-oligosaccharides in a total volume of 100 μL was incu-bated at 40 °C for 12 h. The quantity of enzyme added to the assay mixture and the time of reaction were standard-ized using cellopentaose. The products were concentrated by vacuum centrifugation (Concentrator 5301, Eppendorf, Germany), and 10 μL was spotted onto TLC plates (Silica gel 60; Merck). The plate was developed with acetic acid: N-butane: H2O (1:2:1), and sugars were visualized by

heating the plate after briefly soaking in orcinol/H2SO4 rea-gent (Chirico and Brown 1985).

Statistical analyses

All experiments were performed in triplicate. Analyses of variance (ANOVA) were done with NCSS, 2007 for Win-dows. Reported values were considered significantly differ-ent at α = 0.05.

Results and discussion

Expression of bglA in the diploid yeast S. cerevisiae

β-Glucosidase plays a critical role in the cellulose degra-dation process, since cellobiose and cello-oligosaccharides are potent inhibitors of endoglucanases and cellobiohydro-lases. However, β-glucosidase remains intracellular, and this prevents interaction of the enzyme with the extracel-lular substrate. Likewise, β-glucosidase synthesis is usually

Table 1 Microbial strains, plasmids and primers used in this work

a Dr. Zamuel Zincker Ruzalb Dr. Margaret Dah-Tsyr Chang; restriction sites employed during plasmid construction are underlined; bold and dashed lines nucleotides repre-sent KEX2 and KOZAK sequence, respectively

Strain or plasmid Genotype Source/reference

Strains:

C. flavigena PN-120 Xylanase and β-glucosidase hyperproducer Ponce-Noyola and de la Torre (1995)

E. coli DH5α supE44 ΔlacU69 (Ø80lacZ ΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1 lacZ53

Sambrook et al. 1989

E. coli DH5α pKSII-bglA AMPR LACZp-bglA-LACZT This study

E. coli DH5α pS1-bglA AMPR PGK1p-KEX2-KOZAK-BGLA-PGK1T This study

S. cerevisiae 2D MATα leu2d ura3 Donateda

S. cerevisiae 24D MATa leu2d ura3 Donateda

S. cerevisiae 2-24D MATα MATa leu2d ura3 This study

S. cerevisiae PM-4 URA3 PGK1p-KEX2-KOZAK-BGLA-PGK1T This study

S. cerevisiae PM-7 URA3 PGK1p-KEX2-KOZAK-BGLA-PGK1T This study

S. cerevisiae PM-15 URA3 PGK1p-KEX2-KOZAK-BGLA-PGK1T This study

Plasmids:

pBluescript KSII AMPR LACZp-LACZT This study

pYEX-S1 URA3 PGKp-PGKT Donatedb

pKSII-bglA AMPR LACZp-BGLA-LACZT This study

pS1-bglA URA3 PGK1p-KEX2-KOZAK-BGLA-PGK1T This study

Primers Sequence

Eco-bgl CCGGAATTCCAAGCCACACCCCAGCCG

Bam-bgl GCGGATCCCCGATGACCCGAACCTGC

D-KKS01 CGCGTGGAATTCAAAAGG ATGACGCTCGCCGA-GAAGG

D-ESA01 CCGGAATTCCAAGCCACACCCCAGCCG

29Arch Microbiol (2014) 196:25–33

1 3

inhibited by glucose produced during cellobiose hydroly-sis. A glucose-tolerant β-glucosidase with high affinity for cellobiose would be a potent candidate for industrial applications. C. flavigena PN-120 produces cellulases with twice the level of cellobiose inhibition resistance (Ponce-Noyola and de la Torre 1995) and an oligomeric intracel-lular BGLA with high cellobiose affinity (Barrera-Islas et al. 2007). Therefore, in this work, the catalytic fraction of BGLA was expressed in S. cerevisiae.

A diploid S. cerevisiae strain was chosen to express the BGLA catalytic fraction, since haploid cells show lower thermostability and tolerance to acids, ethanol and other fer-mentation compounds (Yamada et al. 2010). Moreover, S. cerevisiae is a GRAS microorganism and has been the focus of several research groups for bioethanol production. How-ever, S. cerevisiae can only use a limited range of polysac-charides and does not ferment cellobiose or pentoses; there-fore, this yeast has been used as a platform to produce a wide range of recombinant cellulases (Njokweni et al. 2012).

To obtain S. cerevisiae transformants able to secrete the β-glucosidase catalytic fraction (BGLA15) of an inhibition-resistant enzyme from mutant C. flavigena PN-120, the catalytic fraction sequence was fused to the full-length leader sequence of the alpha subunit secretory signal of the Kluyveromyces lactis killer toxin (SS) under the con-trol of the constitutive phosphoglycerate kinase promoter.

Fifteen pS1-bglA transformants were selected. The colo-nies showed a fluorescent halo under UV light when over-laid with MUG (Fig. 2a). Strains 4, 7 and 15 showed the largest fluorescent hydrolysis halos on MUG and were isolated.

Moreover, the pYEX-S1 transformants and wild-type strain were unable to release 4-methylumbelliferone (Fig. 2b). This result indicates that the catalytic fraction of β-glucosidase was successfully expressed in S. cerevisiae.

β-glucosidase location and partial purification

The selected recombinant strains were cultured in both YPD and SC media. In YPD medium, β-glucosidase showed activity in the supernatant and cells, and the vol-umetric activity was sevenfold higher in the superna-tant of YPD than in SC medium. In SC, more than 80 % of the enzymatic activity remained within the whole cells (Table 2). This may be due to amino acid limitation in the SC medium, which results in up-regulation of amino acid transport and protein synthesis, in addition to induction of the general stress response and repression of ribosomal and glycolytic gene expression (Hahn-Hägerdal et al. 2005).

Choi et al. (1994) demonstrated that amino acid sup-plementation enhances cell growth and heterologous pro-tein production in two isogenic strains of S. cerevisiae

Fig. 2 Extracellular β-glucosidase activity of recom-binant strains of S. cerevisiae. a Cells transformed with pS1-bglA. b Cells transformed with pYEX-S1. Arrows show 2-24D strain. Cells were grown on SC plates and then overlaid with MUG

Table 2 Effect of the culture medium in the production and location of β-glucosidase by S. cerevisiae recombinants

Strain YPD medium SC medium

Supernatant Cell pellet Total activity Supernatant Cell pellet Total activity

IU/mL % IU/mL % IU/mL IU/mL % IU/mL % IU/mL

4 0.63 ± 0.13 48.1 0.68 ± 0.06 51.9 1.31 ± 0.15 0.10 ± 0.13 16.4 0.51 ± 0.08 83.6 0.61 ± 0.08

7 0.62 ± 0.06 45.3 0.75 ± 0.16 54.7 1.37 ± 0.12 0.09 ± 0.01 14.5 0.53 ± 0.05 85.5 0.62 ± 0.07

15 0.58 ± 0.03 42.6 0.78 ± 0.11 57.4 1.36 ± 0.09 0.08 ± 0.004 13.0 0.54 ± 0.06 87.0 0.62 ± 0.06

30 Arch Microbiol (2014) 196:25–33

1 3

harboring a multicopy plasmid with the T. reesei XYN2 gene under control of the PGK1 promoter. Also, the stress response has previously been evaluated under oxygen limitation. The expression of the heterologous endo-β-1,4-xylanase in Pichia stipitis under control of the hypoxia-inducible PsADH2 promoter was further increased with amino acid supplementation (Görgens et al. 2005). These results show significant influence of the presence of amino acids on heterologous protein expression.

Moreover, the three recombinant strains showed total volumetric activity twice as high in YPD. Thus, the YPD medium was used for the assays to produce, in the superna-tant, BGLA15. Although β-glucosidase activity was similar in the three recombinant strains, strain 15 was chosen for further experiments because it showed the brightest hydrol-ysis halo in MUG plates. This strain was named S. cerevi-siae PM-15.

In YPD medium, the recombinant S. cerevisiae PM-15 produced BGLA15 volumetric activity of 582 IU/L and

specific activity of 99.4 IU/g dry cell. These values were 1.3 and 1.5 times higher than those obtained for Bacil-lus circulans (Cho et al. 1999) (Table 3). The difference is higher when compared with the S. cerevisiae recombi-nant harboring pVBG-A with the β-glucosidase gene from Candida wickherhamii: The value for volumetric activity is approximately 2,000 times higher for BGLA15 versus pVBG-A (Skory et al. 1996). Also, the recombinant S. cer-evisiae produced herein showed 12 times more volumetric activity than the β-glucosidase from Candida molishiana and 4.6 times more specific activity than that from Asper-gillus aculeatus (Sánchez-Torres et al. 1998; Fujita et al. 2002).

A protein profile from S. cerevisiae PM-15 and S. cerevi-siae strain 2-24D supernatants was run on native-PAGE and showed the presence of a band that is absent in the 2-24D strain (Fig. 3a). The enzyme was partially purified from the supernatant of S. cerevisiae PM-15 grown in YPD culture. A fraction with high β-glucosidase activity collected from

Table 3 β-glucosidases expressed in S. cerevisiae

NR not reporteda The enzymes were not purified

Source Volumetric activity (IU/L)

Specific activity (U/g dry cell)

Observationsa Reference

Cellulomonas flavigena PN-120 582 99.4 Catalytic domainSecreted

This work

Candida wickerhamii pVBG-A = 0.298pVBG-B = 0.051pVBG-C = 0.259

NR Secreted Skory et al. (1996)

Candida molishiana 48 NR Secreted Sánchez-Torres et al. (1998)

Bacillus circulans 450 50 Secreted Cho et al. (1999)

Aspergillus aculeatus NR 21.3 Membrane Fujita et al. (2002)

Bacillus circulans NR 64 Secreted Pack et al. (2002)

Fig. 3 Electrophoresis and zymogram of extracellular β-glucosidase expressed by S. cerevisiae PM-15. a Supernatants from recombinant and wild-type yeast run on a Coomassie brilliant blue-stained 8 % PAGE gel; b Sypro ruby-stained 10 % native-PAGE gel and zymo-gram using MUG as substrate; c Sypro ruby-stained 10 % SDS-

PAGE gel and zymogram using MUG as substrate. (M) Molecular mass standard; (PN-120) C. flavigena PN-120 BGLA; (PM-15) S. cerevisiae PM-15 BGLA15; (2-24D) S. cerevisiae wild-type strain. Arrow shows the recombinant protein band

31Arch Microbiol (2014) 196:25–33

1 3

the Sephacryl S-200HR (Amersham Pharmacia Biotech) column was run in native-PAGE and SDS-PAGE. In both cases, the cell-free crude extract from C. flavigena PN-120 was used as positive control. The zymogram showed only one protein band with the fluorescent halo, but the migra-tion pattern of the two extracts was different in native-PAGE (Fig. 3b). When both samples were run in SDS-PAGE, BGLA15 showed the same migration pattern as the catalytic fraction of the BGLA protein (Fig. 3c). Under SDS-PAGE conditions, the BGLA enzyme is separated into subunits of different sizes (Barrera-Islas et al. 2007). The above results indicate that the catalytic fraction of the BGLA protein was successfully cloned and expressed in S. cerevisiae.

Specific activity detected by pNPG of partially purified BGLA15 was slightly higher than that of BGLA. This result suggests that the enzymatic activity of BGLA15 would not be negatively affected by hyperglycosylation, were it to be present in the protein. It is well known that S. cerevisiae is a high-mannose type hyperglycosylator, which produces N-glycan structures of up to 100 mannose residues, and compromises the efficacy of the most heterologous proteins expressed by the yeast (Wildt and Gerngross 2005).

In this context, specific activity of the recombinant CBHII enzyme from T. reesei decreased by 35 % when expressed in a multicopy plasmid under the PGK1 promoter in S. cerevi-siae, presumably as the result of protein hyperglycosylation (Penttilä et al. 1988). In contrast, Den Haan et al. (2007a, b) showed that specific activity of the CBHI expressed in S. cerevisiae did not differ significantly from the native T. ree-sei CBHI enzyme, as happened with BGLA15.

Cello-oligosaccharide hydrolysis and enzyme inhibition

Results of cello-oligosaccharide hydrolysis by BGLA15 were examined by TLC (Fig. 4). Glucose was released from cello-oligosaccharides by the recombinant protein. Nevertheless,

the added enzyme amount and hydrolysis reaction time var-ied according with the length of the oligosaccharide chain, increasing 3- and 18-fold, respectively, for cellotetraose and cellopentaose hydrolysis. These results indicate that the recombinant yeast would be able to grow in substrates con-taining at least 2–5 units of glucose as carbon source.

This work shows that the sole β-glucosidase catalytic frac-tion of β-glucosidase from C. flavigena PN-120 (Barrera-Islas et al. 2007) can hydrolyze β-d-1,4-bonds, demonstrating that, for catalysis to occur, it is not essential that β-glucosidase should have an oligomeric organization. Yoshida et al. (2010) observed a similar behavior in the tetrameric β-glucosidase from Kluyveromyces marxianus (KMBGLI).

This remarkable affinity of β-glucosidase for smaller molecules may depend on a loop that covers the catalytic site extending from the C-terminal domain and results in the formation of either a deep or a shallow catalytic pocket. The latter represents a steric hindrance that could limit the chain length of the substrate, as observed with the amino acid residues 503–512 from KMBGLI (Yoshida et al. 2010). BGLA15 is capable of hydrolyzing oligosaccharides of 2–5 glucose units, because it probably has a deeper catalytic site covered by a smaller loop at the C-terminal domain.

On the other hand, glucose has been reported to inhibit β-glucosidase activity. To assess the resistance of BGLA15 to glucose inhibition, concentrations of up to 500 mM glucose were added to the reaction mixture of the β-glucosidase assay, using the partially purified enzyme from the recombinant S. cerevisiae. At 10 mM glucose, BGLA15 activity was inhibited less than 5 %, and at 500 mM glucose, it retained more than 30 % of its original activity (Fig. 5). In contrast, C. flavigena PN-120

Fig. 4 Thin-layer chromatography of cello-oligosaccharide degrada-tion products generated by BGLA15. G1, glucose; G2, cellobiose; G3, cellotriose; G4, cellotetraose; G5, cellopentaose

Fig. 5 Effect of glucose on activity of partially purified β-glucosidases. (Black square) BGLA15 (Black up-pointing triangle) BGLA. The solid line represents the ideal behavior using a second degree polynomial fitting

32 Arch Microbiol (2014) 196:25–33

1 3

oligomeric β-glucosidase (BGLA) activity was inhibited by 60 % at 10 mM glucose and was completely inactive at 160 mM glucose.

A similar recombinant glucose-tolerant β-glucosidase from Humicola grisea expressed in S. cerevisiae showed no inhibition at 5 mM glucose, while the native enzyme was inhibited by nearly 50 % under the same conditions (Beno-liel et al. 2010). The Candida molishiana β-glucosidase expressed in S. cerevisiae retained less than 20 % of its activity in 100 mM glucose (Sánchez-Torres et al. 1998), being 2.4 times more susceptible to inhibition than BGLA15.

Enzyme inhibition resistance could also be related to an amino acid loop present in the well-studied KMBGLI, BGL3B and EXO1 β-glucosidases from Kluyveromyces marxianus (Yoshida et al. 2010), Thermotoga neapoli-tana (Pozzo et al. 2010) and Hordeum vulgare (Hrmova et al. 2005; Hrmova and Fichner 2007), respectively. This helixlike loop acts as a hinge that allows the active site formed by the N-terminal [(β/α)6] and C-terminal [(α/β)8-sandwich] domains to move relative to each other during successive catalytic events.

Resistance to glucose inhibition in BGLA15 may be related to the loss of oligomeric subunits, present in native protein BGLA, which are involved in loop movement. Yoshida et al. (2010) found that the oligomeric KMBGLI showed limited hinge movement between the N-terminal and C-terminal domains of the catalytic fraction, because the remaining subunits forming the oligomer limit such movement. At high glucose concentration, glucose subunit binding compressed the catalytic fraction even more, exac-erbating the movement of the domain that facilitates sub-strate capture.

Conclusion

Saccharomyces cerevisiae PM-15 produces an extracel-lular functional catalytic fraction of β-glucosidase under both limiting and not limiting amino acid growth condi-tions, allowing the strain to grow on cellobiose as sole car-bon source. BGLA15 maintains its activity even under high glucose concentrations. Due to these characteristics, this diploid recombinant yeast may be advantageous to degrade and assimilate cello-oligosaccharides from lignocellulosic biomass for bioethanol production.

Acknowledgments This work was supported by Consejo Nacional de Ciencia y Tecnología México (CONACYT) (Grant 104333). D. J. Mendoza-Aguayo received a scholarship number 204305 from CON-ACYT México. María Isabel Pérez- Montfort corrected the English version of the manuscript.

References

Barrera-Islas GA, Ramos-Valdivia AC, Salgado LM, Ponce-Noyola T (2007) Characterization of a β-glucosidase produced by a high-specific growth-rate mutant of Cellulomonas flavigena. Curr Microbiol 54:266–270

Bayer EA, Raphael LR, Himmel ME (2007) The potential of cellu-lases and cellulosomes for cellulosic waste management. Curr Opin Biotech 18:237–245

Benoliel B, Poças-Fonseca MJ, Gonçalves Torres FA, Pepe de Moraes LM (2010) Expression of a glucose-tolerant β-glucosidase from Humicola grisea var. thermoidea in Saccharomyces cerevisiae. Appl Biochem Biotechnol 160:2036–2044

Bhatia Y, Mishra S, Bisaria VS (2002) Microbial β-glucosidases: clon-ing, properties and applications. Crit Rev Biotechnol 22:375–407

Chirico WI, Brown RD Jr (1985) Separation of [1-3H] cellooligo-saccharides by thin-layer chromatography assay for cellulolytic enzymes. Anal Biochem 150:264–272

Cho KM, Yoo YJ, Kanq HS (1999) δ-integration of endo/exo-glu-canase and β-glucosidase genes into the yeast chromosomes for direct conversion of cellulose to ethanol. Enzyme Microb Tech-nol 25:23–30

Choi ES, Sohn JH, Rhee SK (1994) Optimization of the expression system using galactose-inducible promoter for the production of anticoagulant hirudin in Saccharomyces cerevisiae. Appl Micro-biol Biotechnol 42:587–594

Den Haan R, McBride JE, La Grange DC, Lynd LR, Van Zyl W (2007a) Functional expression of cellobiohydrolases in Saccha-romyces cerevisiae towards one-step conversion of cellulose to ethanol. Enzyme Microb Technol 40:1291–1299

Den Haan R, Rose SH, Lynd LR, van Zyl WH (2007b) Hydrolysis and fermentation of amorphous cellulose by recombinant S. cer-evisiae. Metab Eng 9:87–94

Fujita Y, Takahashi S, Ueda M, Tanaka A, Okada H, Morikawa Y, Kawaguchi T, Arai M, Fukuda H, Kondo A (2002) Direct and efficient production of ethanol from cellulosic material with a yeast strain displaying cellulolytic enzymes. Appl Environ Microbiol 68:5136–5141

Gietz D, Woods RA (2006) Methods in molecular biology. In: Xiao Wei (ed) Yeast protocols, 2nd edn. Human Press Inc, Totowa, New Jersey, pp 107–120

Görgens JF, Passoth V, van Zyl WH, Knoetze JH, Hahn-Hägendal B (2005) Amino acids supplementation controlled oxygen limita-tion and sequential double induction improves heterologous xyla-nase production by P. stipites. FEMS Yeast Res 5:677–683

Hahn-Hägerdal B, Karhumaa K, Larsson CU, Gorwa-Grauslund M, Görgens J, van Zyl W (2005) Role of cultivation media in the development of yeast strain for large scale industrial use. Microb Cell Fact 4:1–16

Henrrissat B, Claeyssens M, Tomme P, Lemesle L, Mornon JP (1989) Cellulase families revealed by hydrophobic cluster-analysis. Gene 81:83–95

Hong J, Tamaki H, Kumagai H (2007) Cloning and functional expres-sion of thermostable β-glucosidase gene from Thermoascus aurantiacus. Appl Microbiol Biotechnol 73:1331–1339

Hrmova M, Fichner BG (2007) Dissecting the catalytic mechanism of a plant β-D-glucan glucohydrolase through structural biol-ogy using inhibitors and substrate analogues. Carbohydr Res 342:1613–1623

Hrmova M, Streltson AV, Smith JB, Vasella A, Varghese NJ, Fincher BG (2005) Structural rationale for low-nanomolar binding of transition state mimics to a family GH3 β-D-glucan glucohydro-lase from barley. Biochemistry 44:16529–16539

33Arch Microbiol (2014) 196:25–33

1 3

Lynd LR, Weimer PJ, van Zyl WH, Protorius IS (2002) Microbial cellulase utilization: fundamentals and biotechnology. Microbiol Mol Biol 66:506–577

Njokweni AP, Rose SH, van Zyl WH (2012) Fungal β-glucosidase expression in Saccharomyces cerevisiae. J Ind Microbiol Bio-technol 39:1445–1452

Pack SP, Park K, Yoo YJ (2002) Enhancement of β-glucosidase sta-bility and cellobiose-usage using surface engineered recombinant Saccharomyces cerevisiae in ethanol production. Biotechnol Lett 24:1919–1925

Penttilä ME, Andre L, Lehtovaara P, Bailey M, Teeri TT, Knowles JK (1988) Efficient secretion of two fungal cellobiohydrolases by Saccharomyces cerevisiae. Gene 63:103–112

Ponce-Noyola T, de la Torre M (1995) Isolation of a high-specific-growth-rate mutant of Cellulomonas flavigena on sugar cane bagasse. Appl Microbiol Biotechnol 42:709–712

Ponce-Noyola T, de la Torre M (2001) Regulation of cellulases and xylanases from a derepressed mutant of Cellulomonas flavigena growing on sugar-cane bagasse in continuous culture. Bioresour Technol 78:285–291

Pozzo T, Pasten LJ, Karlsson NE, Logan DT (2010) Structural and functional analyses of β-glucosidase 3B Thermotoga neapoli-tana: a thermostable three-domain representative of glycoside hydrolase 3. J Mol Biol 397:724–739

Sambrook JE, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold Spring Harbor, New York

Sánchez-Torres P, González-Candelas L, Ramón D (1998) Heter-ologous expression of a Candida molischiana anthocyanin-β-glucosidase in a wine yeast strain. J Agric Food Chem 46:354–360

Schuster BG, Chinn MS (2012) Consolidated bioprocessing of lig-nocellulose feedstocks for ethanol fuel production. Bioenerg Res 6:416–435

Shen Y, Zhang Y, Ma T, Bao X, Du F, Zhuang G, Qu Y (2008) Simul-taneous saccharification and fermentation of acid-pretreated corncobs with a recombinant Saccharomyces cerevisiae express-ing β-glucosidase. Bioresour Technol 99:5099–5103

Skory CD, Freer SN, Bothast RJ (1996) Expression and secretion of the Candida wickerhamii extracellular β-glucosidase gene, bglB, in Saccharomyces cerevisiae. Curr Genet 30:417–422

Spiridonov NA, Wilson DB (2001) Cloning and biochemical charac-terization of BGLC, a β-glucosidase from the cellulolytic actino-mycete Thermobifida fusca. Curr Microbiol 42:295–301

Van Zyl WH, Lynd LR, Den Haan R, Mc Bride JE (2007) Consolidate bioprocessing for bioethanol production using Saccharomyces cerevisiae. Adv Biochem Engin Biotechnol 108:205–235

Wildt S, Gerngross TU (2005) The humanization of N-glycosylation pathways in yeast. Nat Rev Microbiol 3:119–127

Yamada R, Tanaka T, Ogino C (2010) Gene copy number and poly-ploid on products formation in yeast. Appl Microbiol Biotechnol 88:849–857

Yamada R, Taniguchi N, Tanaka T, Ogino C, Fukuda H, Kondo A (2011) Direct ethanol production from cellulosic materials using a diploid strain of Saccharomyces cerevisiae with optimized cel-lulase expression. Biotechnol Biofuels 4:1–8

Yan T, Lin Y, Lin C (1998) Purification and characterization of an extracellular β-glucosidase II with high hydrolysis and transglu-cosylation activities from Asperillus niger. J Agric Food Chem 46:431–437

Yoshida E, Hidaka M, Foshinobu S, Koyanagi T, Minami H, Tamakis H, Kitaoka M, Katayama T, Kumagi H (2010) Role of a PA14 domain in determining substrate specificity of a glucoside hydro-lase family 3 β-glucosidase from Kluyveromyces marxianus. Bio-chem J 431:39–49