Acta Biomaterialia 11 (2015) 435–448

Contents lists available at ScienceDirect

Acta Biomaterialia

journal homepage: www.elsevier .com/locate /actabiomat

Enhanced effect of b-tricalcium phosphate phase on neovascularizationof porous calcium phosphate ceramics: In vitro and in vivo evidence

http://dx.doi.org/10.1016/j.actbio.2014.09.0281742-7061/� 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

⇑ Corresponding authors. Tel.: +86 28 85415123; fax: +86 28 85410246.E-mail addresses: zxd7303@163.com (X.D. Zhu), zhangxd@scu.edu.cn (X.D.

Zhang).

Y. Chen, J. Wang, X.D. Zhu ⇑, Z.R. Tang, X. Yang, Y.F. Tan, Y.J. Fan, X.D. Zhang ⇑National Engineering Research Center for Biomaterials, Sichuan University, Chengdu 610064, China

a r t i c l e i n f o

Article history:Received 6 July 2014Received in revised form 11 September2014Accepted 15 September 2014Available online 22 September 2014

Keywords:NeovascularizationCalcium phosphate ceramicsPhase compositionFibroblastsEndothelial cells

a b s t r a c t

Neovascularization plays a key role in bone repair and regeneration. In the present study, four types ofporous calcium phosphate (CaP) ceramics, namely hydroxyapatite (HA), biphasic calcium phosphates(BCP-1 and BCP-2) and b-tricalcium phosphate (b-TCP), with HA to b-TCP ratios of 100/0, 70/30, 30/70and 2/98, respectively, were investigated in terms of their angiogenic induction. The in vitro cell culturerevealed that the ceramics could promote proliferation and angiogenesis of human umbilical veinendothelial cells (HUVECs). This result could be achieved by stimulating CCD-18Co human fibroblaststo secrete angiogenic factors (vascular endothelial growth factor, basic fibroblast growth factor and trans-forming growth factor-b) as a paracrine effect, as well as by up-regulating HUVECs to express theseangiogenic factors and their receptors (KDR, FGFR1 and ACVRL1) and the downstream eNOS as an auto-crine effect. These effects were more significant in b-TCP and BCP-2, which had a higher content of b-TCPphase. In the in vivo implantation into the thigh muscles of mice, the process of neovascularization of theceramics was initiated at 2 weeks and the mature vascular networks were formed at 4 weeks as visual-ized by hematoxylin and eosin staining and scanning electron microscopy. Microvessel density countconfirmed that b-TCP and BCP-2 induced more microvessels to form than HA or BCP-1. This phenomenonwas further confirmed by the significantly up-regulated expressions of angiogenesis-related genes in theingrowth of cells into the inner pores of the two ceramics. All the results confirmed the angiogenicinduction of porous CaP ceramics, and a higher content of b-TCP phase had an enhanced effect on theneovascularization of the ceramics.

� 2014 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

1. Introduction

Bone defect is one of the major diseases threatening humanhealth, and the treatment for large bone defects is still a clinicalchallenge. At present, autologous and allogenic bone grafts arethe two main choices, but they have a number of drawbacks thatare difficult to overcome, such as limited resources, donor sitemorbidity and immunological rejection [1–3]. In the past few dec-ades, a large number of artificially synthesized biomaterials for therepair of bone defects have been developed. Among them, calciumphosphate (CaP)-based bioceramics are some of the most promis-ing biomaterials for clinical application, not only because of theirexcellent biocompatibility and osteoconduction, but also due totheir osteoinduction, which has been widely confirmed andaccepted by researchers [4–14]. A number of recent studies have

confirmed that osteoinductive porous CaP ceramics without theaddition of any growth factors or cells could be used to treat largebone defects of animals with an efficacy comparable to autologousbone grafts, which confirms their great clinical potential [15–17].

In normal bone, the vasculature transports oxygen, nutrientsand soluble factors to various cells, and takes metabolic wasteand carbon dioxide away [18]. Generally, angiogenesis is consid-ered to be an essential process in fracture healing, and bone heal-ing is highly dependent on adequate vascularization [18–20].Hausman et al. [21] tested the effect of angiogenesis inhibitor onthe healing of a closed femoral fracture in an established rat modeland found that the treatment with angiogenesis inhibitor com-pletely prevented the fracture from healing. Essentially, the repairof bone defects with bone grafts experiences similar molecular andcellular events as fracture healing, including hematoma, inflamma-tion, new bone formation and remodeling. Therefore, the efficientvascularization of bone grafts after implantation could possiblybe a crucial factor for the repair of large bone defects. To date,several methods have been developed to promote the process of

436 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

neovascularization in various bone grafts. Various importantangiogenic factors, including vascular endothelial growth factor(VEGF), basic fibroblast growth factor (bFGF) and transforminggrowth factor (TGF)-b, have been involved in the promotion ofangiogenesis [20,22–24]. Loading of these exogenous angiogenicfactors onto a tissue engineering scaffold has been confirmed tobe an effective method [25–27]. Wernike et al. [27] implantedVEGF-incorporated CaP ceramics into critical-sized cranial defectsin BALB/c mice over 28 days, and the enhanced vascularizationand bone formation in the ceramics were observed. Co-culture ofendothelial cells and other types of cell on biocompatible tissueengineering scaffolds for construction of vascularized bonegrafts could be another effective way [28–31]. Santos et al. [28]co-cultured human dermal microvascular endothelial cells(HDMECs) and human osteoblasts on a 3-D starch-based scaffoldand found that the HDMECs aligned and organized into microcap-illary-like structures after 21 days of culture. Neovascularization ofbone grafts could also be accelerated by optimizing pore size andinterconnectivity of the porous scaffolds [32–35]. Klenke et al.[32] investigated the impact of pore size on vascularization ofbiphasic calcium phosphate (BCP) ceramic particles by in vivoexperiments. They found that the functional capillary density inBCP particles with a pore size greater than 140 lm was signifi-cantly higher compared with that in particles with a smaller poresize or dense particles.

In recent years, a simple strategy for promoting neovasculariza-tion of the scaffolds – stimulation by the biomaterial itself – hasbeen proposed. Several studies have reported that silicate bioce-ramics have a strong ability to stimulate angiogenesis, in whichthe silicon ions played an important role [36–38]. Gorustovichet al. [39] made a detailed review on the effect of bioactive glasseson angiogenesis. As for porous CaP ceramics, new blood vessels andeven Haversian canals in the inner pores were often observed afterin vivo implantation [40–43], indicating their potential to promoteangiogenesis. However, to our knowledge, no systematic study onthe process of neovascularization of porous CaP ceramics and theinfluencing factor involved has yet been reported.

It is known that angiogenesis requires a dynamic and tempo-rally and spatially regulated interaction between endothelial cells,angiogenic factors and surrounding extracellular matrix proteins[44]. After implantation of a biomaterial, inflammatory cells, fibro-blasts and stem cells would be recruited to the defective site andmigrate into the inner pores of the implant. Among these cells,fibroblasts construct new extracellular matrix, which is necessaryto support the growth of cells, and their importance to angiogene-sis has been reported [44,45]. The co-culture of fibroblasts andendothelial cells was confirmed to promote angiogenesis in poroustissue engineering scaffolds [31,46]. Bioactive glass and calciumsilicate ceramic were found to stimulate the secretion of VEGFand bFGF in fibroblasts and thus enhanced the proliferation andorganization into the tube-like structure of endothelial cells[38,47]. In the present study, we chose CCD-18Co human fibro-blasts (HFs) and human umbilical vein endothelial cells (HUVECs)as cell models, and investigated the effect of various porous CaPceramics with similar porous structure but different phase compo-sition on proliferation and angiogenic factors secretion of the twotypes of cells by in vitro cell culture. Also, the role of the condi-tioned media collected from these cells in enhancing HUVECs pro-liferation and tubule formation was evaluated. In addition, weselected an intramuscular implantation mouse model, which wasused to evaluate ectopic bone formation induced by porous CaPceramics in our previous study [10], to investigate the neovascular-ization of the ceramics. Meanwhile, temporal gene expressions ofthe key angiogenic factors of the cells ingrowth into the innerpores of the ceramics were analyzed.

2. Materials and methods

2.1. Materials

In this work, four types of porous CaP ceramics, namelyhydroxyapatite (HA), biphasic calcium phosphates (BCP-1 andBCP-2) and b-tricalcium phosphate (b-TCP), with HA to b-TCPratios of 100/0, 70/30, 30/70 and 2/98, respectively, were usedfor the subsequent in vitro and in vivo experiments. All the ceram-ics were fabricated by the same processing method as used in ourprevious work [10] and the same batch of ceramics was used.Briefly, the various CaP precursor powders synthesized by wet pre-cipitations were foamed by H2O2, sintered at 1100 �C and cut intodiscs (U14 � 2 mm) or cylinders (U2 � 3 mm). According to thecharacterization of the ceramics presented in our previous work[10], all four ceramics had similar porosity (�70%), macroporousand microporous structure, but different phase composition. Theirmacropores were all within 30–400 lm, and the micropores werewithin 0.1–2 lm. Prior to use, all the samples were sterilized byc-ray irradiation at a dose of 25 kGy.

2.2. In vitro experiments

2.2.1. Cell cultureThe ceramic discs were placed into 24-well tissue culture

plates. The CCD-18Co HFs (American Type Culture Collection,Manassas, USA) and HUVECs (China Center for Type Culture Collec-tion, Wuhan, China) were seeded onto the discs at 8 � 103 cells perwell. The cells on the samples were cultured in Dulbecco’s modi-fied Eagle’s medium (DMEM; Gibco, USA) supplemented with10% fetal bovine serum (FBS; Beijing Minhai Biotechnology, China)and 1% penicillin/streptomycin at 37 �C in an atmosphere with100% humidity and 5% CO2. The media were replaced at 1, 4 and7 days, and all the supernatants were collected. In addition, theleach liquors of the ceramics, incubated in the same media butwithout cells, were also collected at the above-mentioned timepoints. The conditioned media or the leach liquors were then usedto culture HUVECs, which were seeded in 96-well plates at4 � 103 cells per well and cultured for 3 days under the conditionsdescribed above.

2.2.2. Cell morphologyThe morphology of HFs and HUVECs grown on the ceramics was

observed by a confocal laser scanning microscopy (CLSM; TCS SP 5,Leica, Germany). At each time point, the cells attached to theceramics were stained with fluorescein diacetate (FDA; Topbio Sci-ence, China) and propidium iodide (PI; Topbio Science, China)according to the manufacturer’s instructions, and visualized asgreen or red fluorescence. In FDA/PI staining, live cells can reactwith FDA and are dyed green, while dead cells cannot react withFDA and are dyed red by PI.

2.2.3. Cell proliferation assayMTT assay was used to measure the proliferation and viability

of HFs and HUVECs seeded on the ceramics or in 96-well platesand cultured according to the above description. At each timepoint, the cells were incubated with 0.5 mg ml�1 MTT for 4 h at37 �C. The solution in each well was removed and dimethyl sulph-oxide was added to dissolve the purple formazan salts. The opticaldensities were detected at the wavelength of 490 nm using amultifunctional full wavelength microplate reader (VarioskanFlash, Thermo Scientific, USA). All experiments were performedin triplicate.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 437

2.2.4. In vitro angiogenesisTo evaluate the role of the conditioned media after HF culture

on the ceramics or the leaching liquors after immersion of theceramics in the media as described above in promoting angiogen-esis, an in vitro angiogenesis assay was performed usingECMatrix™ (Cat. No. ECM625, Millipore, USA). A 96-well platewas coated with diluted ECMatrix™ according to the manufac-turer’s instructions and then incubated at 37 �C for 2 h to allowsolidification of the matrix solution. HUVECs (1 � 104 cells perwell) were inoculated with 50 ll of the conditioned media or theleach liquors in 150 ll of DMEM with 1% FBS. The cells were cul-tured on ECMatrix™ for 16 h at 37 �C. The cells were photographedfrom five random microscopic fields using an inverted fluorescencemicroscope (CTR4000, Leica, Germany). The capillary tube branchpoints were counted to quantify the angiogenesis process.

2.2.5. Polymerase chain reaction (PCR) assay for in vitro samplesTotal RNA of HFs or HUVECs grown on the ceramics was

extracted using RNeasy Mini Kit (Qiagen, Germany). Briefly, thesamples were washed with phosphate-buffered saline (PBS) anddried with filter paper. A 700 ll Buffer RLT volume was added toeach sample to lyse the cells, and the total RNA was extractedand purified following the manufacturer’s protocol. The RNA wasthen reverse transcribed into complementary DNA (cDNA) usingan iScriptTM cDNA Synthesis Kit (Bio-RAD, USA). The sequencesof primers for the VEGF, bFGF, TGF-b, KDR, FGFR1, ACVRL1, eNOSand GAPDH genes (genus: human) are given in Table 1. A real-timequantitative PCR reaction was performed using the CFX96™ real-time PCR detection system (CFX960, Bio-Rad, USA) with SsoFast™EvaGreen� Supermix (Bio-Rad, USA). GAPDH was used as thehousekeeping gene to normalize the results. The DDCt-valuemethod was used to calculate the relative expression values. Allsamples were analyzed in triplicate.

2.3. In vivo experiments

2.3.1. Animals and surgical procedureNinety male BALB/c mice weighing �20 g were obtained from

the Laboratory Animal Center of Sichuan University (Chengdu,China). Surgical procedures were conducted on these mice accord-ing to our previous method [10]. Briefly, all the mice were anesthe-tized by abdominal injection of 0.1% pentobarbital sodium solution(Sigma, USA, 0.1 ml per 25 g body weight) under aseptic condi-tions. The thigh was shaved of hair and the naked skin was steril-ized by iodine. A longitudinal incision was made with a scalpel atthe muscle bundle of the left and right thighs, and the cylindrical

Table 1Primer sequences for target genes.

Symbol Primers 50 ? 30 (in vitro, human)

GAPDH F: GAAGGTGAAGGTCGGAGTR: GAAGATGGTGATGGGATTTC

VEGF F: TACCTCCACCATGCCAAGTGR: ATGATTCTGCCCTCCTCCTTC

bFGF F: GTGTGTGCTAACCGTTACCTR: GCTCTTAGCACAGACATTGGAAG

TGF-b F: GCCTGCAGCATCTCTGCACCCGCCR: GTCTAATAGTGGAAACTTTCGAAGTT

eNOS F: CGGCATCACCAGGAAGAAGAR: GCCATCACCGTGCCCAT

KDR F: GGAAATCATTATTCTAGTAGGCACGAR: CCTGTGGATACACTTTCGCGATG

FGFR1 F: GGAGGATCGAGCTCACTGTGGR: CGGAGAAGTAGGTGGTGTCAC

ACVRL1 F: GCAACCAAGAACGCCTCAATCR: TTTCCCGACACACTCCAACAG

ceramic samples were implanted into the bilateral muscle pouchesof each animal. The wound was closed in layers. The dietary intakeand incision recovery of the mice were observed until the woundhad healed. The implants were retrieved postoperatively at 1, 2,3, 4 and 8 weeks.

The experiments were approved by the Animal Care and UseCommittee of Sichuan University, and the surgeries were carriedout according to the Guide for the Care and Use of LaboratoryAnimals published by National Academy of Sciences.

2.3.2. Scanning electron microscopy (SEM) observationAt 4 weeks after surgery, some of the ceramic implants were

retrieved. The samples were fixed with 2.5% glutaraldehyde for1 day and dehydrated by immersion in an alcohol series (10, 20,30, 40, 50, 65, 80, 95 and 100%, 10 min each time) and xylene(100%, 30 min). After critical point drying, each sample was cutin half along the long axis. The internal morphology of the sampleswas observed using a field-emission scanning electron microscope(S-4800, Hitachi, Japan).

2.3.3. Histological examinationAt 1, 2, 3, 4 and 8 weeks after surgery, the retrieved implants

were cleaned of any surrounding soft tissue and fixed in 4%paraformaldehyde solution for 72 h. The samples were then decal-cified in 10% EDTA for 7–12 days, dehydrated in serial dilutions ofethanol and embedded in paraffin. After hardening, the sampleswere sectioned along the long axis into 3–5 mm thickness, trans-ferred onto 3-aminopropyltriethoxysilane-coated glass slides, andstained with hematoxylin and eosin (H&E) for histological analysis.

Blood vessels in the sections were observed by a light micro-scope (Bx60, Olympus, Japan), and the histological overviews ofall the slides were captured by a digital CCD camera attached tothe microscope. Blood vessels were identified as circular structuresor well-defined long tubule structures, in which red blood cellscould be seen clearly.

2.3.4. Immunohistochemical (IHC) stainingIHC staining was performed on the sections using the streptavi-

din–biotin–peroxidase complex (SABC) method (SABC Kit, Boster,China). Briefly, paraffin sections were dewaxed in xylene and rehy-drated in decreasing concentrations of ethanol. The sections werethen pretreated by mixture of 30% H2O2 and distilled water atthe ratio of 1:10 for 10 min at room temperature to inactivateendogenous enzymes, immersed into 0.01 M citrate buffer (pH6.0), heated to boiling by microwave and washed by 0.01 M PBS(pH 7.4) after cooling. Next, 5% BSA blocking solution was added,

Primers 50?30 (in vivo, mouse)

F: CTCAACTACATGGTCTACATGTTCCAR: CCCATTCTCGGCCTTGACTF: ATGGACGTCTACCAGCGCAR: CTGCTATGCTGCAGGAAGCTCF: AGCGACCCACACGTCAAACTR: CGTCCATCTTCCTTCATAGCAAGF: GCCCTGGATACCAACTATTGCTT

TC R: AGTTGGCATGGTAGCCCTTGF: GACCCTCACCGCTACAACATR: GCTCATTTTCCAGGTGCTTC

CG F: GATGTTGAAAGAGGGAGCAACR: ACATAGTCTTTCCCAGAGCGGF: CTGGGCCAATTATCACCAGR: GCCATCTTCAAAAGCTCGTCF: CATCGCTTCAGACATGACCTCR: CTAACCGTATCCAGAGTAGTG

438 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

and the excessive liquid was abandoned after incubation for10 min at room temperature. The sections were successivelyexposed to the diluted primary antibody against VEGF (ZS-72690,ZSGB-BIO, China), bFGF (ZS-790, ZSGB-BIO, China), TGF-b(ZS-1460, ZSGB-BIO, China), eNOS (ZS-6510, ZSGB-BIO, China),CD105 (ZM-0297, ZSGB-BIO, China) or CD34 (ZM-0046, ZSGB-BIO, China) at 4 �C overnight, the corresponding biotinylated sec-ondary antibody (BOSTER, China) at 37 �C for 30 min and thenSABC for 30 min. The sections were then stained with DAB Kit(AR1022, Boster, China) at room temperature and slightly counter-stained with hematoxylin. The positive expressions of these pro-teins in the cells were observed with a light microscope (Bx60,Olympus, Japan) and analyzed quantitatively using IPP 6.0 soft-ware. The value of mean optical density was measured and usedas the evaluation index.

2.3.5. Microvessel density (MVD) countMVD has been commonly used to assess angiogenesis in patho-

logical specimens and tumor models using endothelial cell mark-ers, including CD34 and CD105 [48]. In this work, quantificationof MVD was performed on the sections, which were immunohisto-chemically stained for CD34 and CD105. The highly vascularizedareas were initially selected in each section under 100� fields, thenfive 200� fields were used to count the microvessels in each ofthese areas. The brown-stained single cells and clusters of cells,with or without a lumen vessel structure, were calculated as indi-vidual vessels. The mean value of the five counts was recorded asthe MVD level of the section.

2.3.6. PCR assay for in vivo samplesAt 1, 2, 3, 4 and 8 weeks after implantation, the ceramic

implants were retrieved and cleaned of any surrounding soft tis-sue. The samples were then frozen quickly by liquid nitrogen andground into power using RNase-free crucibles. The cells were lysedby Buffer RLT, and the total RNA was extracted from the samplesusing RNeasy Fibrous Tissue Mini Kit (Qiagen, Germany) accordingto the manufacturer’s instructions. The RNA was then transcribedinto cDNA. The sequences of primers for the VEGF, bFGF, TGF-b,KDR, FGFR1, ACVRL1, eNOS and GAPDH genes (genus: mouse) aregiven in Table 1. A real-time quantitative PCR reaction was per-formed as described above. All samples were analyzed in triplicate.

2.4. Statistics analysis

All data are presented as mean ± standard deviation. At leastthree samples were used for each data point. The statistical analy-sis was carried out using Student’s t-test. A one-way analysis ofvariance with Tukey’s post hoc test for multiple comparisons wasused for statistical analysis of the data. A confidence level of 95%(p < 0.05) was considered statistically significant.

3. Results

3.1. In vitro evaluation

3.1.1. Cell morphologyTo evaluate effect of phase composition of porous CaP ceramics

on cell morphology, HFs or HUVECs were seeded onto the fourtypes of ceramic and cultured for 1, 4 and 7 days. Tissue cultureplates served as controls. The CLSM observation of the cells’ growthon the ceramics is shown in Fig. 1. For both HFs and HUVECs, theamount of live cells increased significantly with time, while fewdead cells could be found, indicating that all the ceramics supportthe growth of cells well.

3.1.2. Cell proliferationFig. 2 shows the MTT cell proliferation assay of HFs and HUVECs

cultured on the four types of porous CaP ceramics for 1, 4 and7 days. It can be seen that the number of HFs or HUVECs in eachgroup increased gradually with time, which is in good accordancewith the above CLSM observation. Although no significant differ-ence in cell proliferation was observed at each time point betweenthe experimental groups and the control group, it could beobserved at 7 days that cell proliferation increased slightly withincreasing b-TCP phase content in the four ceramics.

To investigate whether the secreta of HFs or HUVECs with thestimulation of porous CaP ceramics could further promote the pro-liferation of HUVECs, the conditioned media after the HFs orHUVECs had been cultured on the ceramics for 7 days were usedfor further HUVEC culture. The leach liquors after the ceramicshad been immersed in the media without cells for 7 days wereused for comparison. The results of the proliferation of HUVECsafter 3 days are shown in Fig. 3. Both of the conditioned media pro-moted the proliferation of HUVECs significantly compared with theleach liquors and the control, and this effect was robust on BCP-2and b-TCP, which had higher contents of b-TCP phase. This indi-cates that porous CaP ceramics could promote the proliferationof HUVECs by stimulating HFs as a paracrine effect as well asstimulating HUVECs as an autocrine effect.

3.1.3. AngiogenesisTo evaluate the angiogenic ability of HUVECs cultured with the

conditioned media after 7 days of HF culture on the ceramics, orthe leaching liquors after 7 days of ceramics immersion in themedia, an in vitro angiogenesis assay kit was used. According tothe manufacturer’s information, the self-assembled capillary-likenetworks of HUVECs should be observable once the cells have beenactivated and start to form capillary tubes. Fig. 4 shows the mor-phology of HUVECs cultured on ECMatrix™ for 16 h. It can be seenthat, for each ceramic, HUVECs in the presence of the conditionedmedia aligned to more capillary-like networks and presented moremorphological characteristics of angiogenesis than those in thepresence of the leaching liquors. Fig. 5 gives the quantitativeresults for the in vitro angiogenesis. For each ceramic, the numberof the branch points formed by HUVECs was significantly higher inthe conditioned media than in the leach liquors and the control.This indicated the promoting effect of the secreta of HFs with thestimulation of porous CaP ceramics on angiogenesis. Similarly, thiseffect was more robust in the ceramics with a higher content ofb-TCP phase.

3.1.4. Expressions of angiogenesis-related genesFig. 6 shows the quantitative angiogenesis-related gene expres-

sions of HFs cultured on porous CaP ceramics for 7 days. It could beseen that, compared with the control, the ceramics with a highercontent of b-TCP phase, i.e. BCP-2 and b-TCP, had significantlyup-regulated gene expressions of VEGF, bFGF and TGF-b.

Fig. 7 shows the quantitative angiogenesis-related gene expres-sions of HUVECs cultured on porous CaP ceramics for 7 days. Theup-regulation of VEGF gene expression was significant in all fourceramics compared with the control. Especially in b-TCP, the valueof the gene expression was almost four times higher than that ofthe control. Also, the gene expression of KDR, a receptor of VEGF,was significantly up-regulated by all of the ceramics except HA.However, the gene expression of bFGF was not up-regulated bythe ceramics, though that of its receptor FGFR1 was clearly up-reg-ulated. Furthermore, the gene expression of TGF-b was signifi-cantly up-regulated by all of the ceramics except HA, though thatof its receptor ACVRL1 was not up-regulated. The gene expressionof eNOS was also significantly up-regulated by all of the ceramicsexcept HA.

Fig. 1. CLSM observation for HFs (a) and HUVECs (b) grown on porous CaP ceramics.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 439

Fig. 2. MTT assay for the proliferation of HFs (a) and HUVECs (b) on porous CaP ceramics.

Fig. 3. MTT assay for the proliferation of HUVECs cultured with the leach liquorsafter immersion of the ceramics in the media without cells for 7 days and theconditioned media after HF or HUVEC culture on the ceramics for 7 days. ⁄p < 0.05vs. the control and the leach liquors.

Fig. 5. Quantitative evaluation for the formed branch points after HUVECs had beencultured on ECMatrix™ for 16 h in the presence of the conditioned media, after HFshad been cultured on porous CaP ceramics for 7 days, and the leach liquors afterporous CaP ceramics had been immersed in the media for 7 days. ⁄p < 0.05 vs. thecontrol and the leach liquors.

440 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

3.2. In vivo evaluation

3.2.1. Neovascularization of porous CaP ceramicsThe potential of neovascularization of porous CaP ceramics

implanted into the thigh muscles of mice was evaluated using

Fig. 4. Photomicrographs of HUVECs cultured on ECMatrix™ for 16 h in the presence of vfor 7 days; (B) the leach liquors after immersion of porous CaP ceramics in the media fo

histological analysis. The results of the histological analysis forthe retrieved samples after implantation into the thigh musclesof mice for 1, 2 and 4 weeks are shown in Fig. 8. At 1 week after

arious media. (A) The conditioned media after HFs cultured on porous CaP ceramicsr 7 days.

Fig. 6. Expressions of VEGF, bFGF and TGF-b genes in HFs cultured on porous CaPceramics for 7 days. ⁄p < 0.05 vs. control.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 441

implantation, no blood vessels were observed in any of the fourceramics, though some loose fibrous connective tissue was foundto have penetrated into the inner pores of the ceramics. At 2 weeks,some new blood capillaries penetrating into the inner pores of the

Fig. 7. Expressions of the angiogenesis-related genes in HUVECs cultured on porous CaP(c) TGF-b and its receptor ACVRL1; (d) eNOS. ⁄p < 0.05 vs. control.

ceramics could be clearly observed. At 4 weeks, a large number ofnew blood vessels, which were characterized by the presence ofred blood cells contained in a layer of endothelial cells, were foundin the pore space of the ceramics. In particular, there were somelarger sized new blood vessels bridging the gaps between two ormore adjacent macropores, indicating the formation of mature vas-cular networks. SEM images were also used to assess the presenceof new blood vessels within the ceramics. Fig. 9 shows the typicalSEM images of the retrieved ceramic samples after implantationfor 4 weeks. It can be seen that the pore space of the ceramics isfully filled with newly formed tissue, and new blood vessels thathave grown into the inner pores can be seen. This was confirmedby the large amounts of red blood cells present in the inner wallsof the tubes. The size of some of the newly formed blood vesselsis as large as 60 lm. These results demonstrated the good neovas-cularization of porous CaP ceramics after implantation into themuscles of mice.

MVD within the ceramics was quantified by using histologicalsections at 4 weeks after implantation and immunohistologicalstaining for CD34 and CD105, and the results are summarized inTable 2. The data acquired demonstrate that the phase compositionof the porous CaP ceramics certainly influenced the number ofmicrovessels formed, with a higher content of b-TCP phase in theceramics being more favorable for the formation of new blood ves-sels. However, no significant difference in MVD between BCP-2 andb-TCP was found.

ceramics for 7 days: (a) VEGF and its receptor KDR; (b) bFGF and its receptor FGFR1;

Fig. 8. Photomicrographs of H&E staining for the decalcified sections of porous CaP ceramics implanted into the thigh muscles of mice for 1, 2 and 4 weeks. Black arrows, newblood vessels.

Fig. 9. SEM images of new blood vessels formed in the pore space of porous CaP ceramics at 4 weeks after implantation. Red arrow, new blood vessels. Yellow arrow, redblood cells.

442 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

3.2.2. Expressions of angiogenesis-related genesTo investigate the temporal expressions of angiogenesis-related

genes in the cells that had grown into the inner pores of porous CaPceramics after implantation into the thigh muscles of mice, PCRassay was performed on the retrieved samples at 1, 2, 3, 4 and

8 weeks after implantation. The results are shown in Fig. 10. VEGFand its receptor KDR showed the highest expressions at 1 weekafter implantation in all four ceramics, and their expressions sub-sequently remained relatively stable. However, the other angio-genesis-related gene expressions, including bFGF and its receptor

Table 2MVD counts determined by the sections stained for CD34 or CD105 at 4 weeks afterimplantation.

Porous CaP ceramics MVD counts

CD34 CD105

HA 7.58 ± 2.87 5.67 ± 3.58BCP-1 11.67 ± 3.89 8.91 ± 3.77BCP-2 19.58 ± 4.10* 14.75 ± 5.37*

b-TCP 15.17 ± 4.17* 13.83 ± 4.59*

* P < 0.05 versus HA and BCP-1.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 443

FGFR1, TGF-b and its receptor ACVRL1, and eNOS, exhibited adifferent tendency: their expressions increased with time until3 weeks, then decreased gradually. Similarly, a higher content ofb-TCP phase in the ceramics played an active role in promotingthe expression of angiogenesis-related genes. At the peak time ofthese gene expressions, the most elevated expressions were oftenobserved in BCP-2 and b-TCP.

3.2.3. Presence of angiogenic factorsTo detect the presence of angiogenic factors in the microenvi-

ronment around the ceramics after implantation into the thighmuscles of mice, IHC staining of sections of the samples implantedfor 1, 2, 3, 4 and 8 weeks was carried out. The results are shown inFig. 11. The positive expressions of VEGF, bFGF and TGF-b wereidentified in the cells grown into the inner pores of all four ceram-ics. Further quantitative analysis of the stained sections is shown inFig. 12. It can be seen that, for all four ceramics, the presented VEGFincreased rapidly with increasing implantation time, reached amaximum value at 4 weeks and subsequently decreased. The othertwo angiogenic factors presented, bFGF and TGF-b, showed a sus-tained increase at each successive time point. However, they bothshowed lower values than VEGF. Similarly, the presence of thethree angiogenic factors was related to phase composition of theporous CaP ceramics, which usually exhibited a higher level inBCP-2 and b-TCP.

4. Discussion

Osteoinduction of porous CaP ceramics has been confirmed bymany experimental studies, and is often dependent on the micro-structure and phase composition of the ceramics [10–12,43,49,50].It is generally accepted that neovascularization is critical for bonerepair and regeneration [18–20]; thus it might be correlated withthe osteoinduction of biomaterials. Our previous study confirmedthat porous CaP ceramics could induce ectopic bone formation inthe thigh muscles of mice, but it was dependent on the phase com-position of the ceramics [10]. In the present study, in vitro andin vivo studies were carried out to investigate the neovasculariza-tion of various porous CaP ceramics and the influence of phasecomposition. After being implanted into the thigh muscles of mice,a rapid neovascularization in porous CaP ceramics was observed bythe H&E staining from the harvested samples (Fig. 8). At 2 weeksafter implantation, some blood capillaries were visualized in theinner pores of the ceramics. At 4 weeks, the mature vascular net-works had formed, which was characterized by the occurrence ofseveral larger new blood vessels connecting the gaps betweentwo or more adjacent macropores. Also, the presence of new bloodvessels with larger size in the ceramics was further confirmed bySEM observation (Fig. 9), in which biconcave-shaped red bloodcells were seen clearly passing through the macropores. Red bloodcells are known to be responsible for delivering oxygen. This find-ing confirmed not only the maturation of the vascular tissue but,more importantly, the functionalization and connectivity of the

blood vessels within the ceramics. These data indicate that angio-genesis could be induced by porous CaP ceramics. In addition,according to the quantitative data shown in Table 2, the MVDcounts were higher in BCP-2 and b-TCP than in HA and BCP-1, sug-gesting that the phase composition of the porous CaP ceramics hasan effect on the neovascularization: a higher content of b-TCPphase induced the enhanced neovascularization of the ceramics.

Angiogenesis involves endothelial cell proliferation, migrationand tube formation, and it is regulated by multiple growth factorsand cytokines. Among them, VEGF, bFGF and TGF-b are the mainfactors involved [19,20,44,51]. During fracture healing, these fac-tors are produced by several cell types present at the fracture siteand play a significant role in the process of neovascularization andrepair [51]. Many studies have reported that enhanced vasculariza-tion can be achieved by the incorporation of exogenous angiogenicfactors into a biomaterial scaffold [25–27]. However, a number ofrecent studies have found that some biomaterials, such as bioac-tive calcium silicate ceramic and bioactive glass, have the potentialto induce angiogenesis by promoting the production of endoge-nous angiogenic factors [36–39,47]. These studies suggested thatthe silicon ion could stimulate angiogenesis by up-regulating thegene expression of VEGF, bFGF and eNOS, which were also ana-lyzed in our current study. However, most of the studies publishedon angiogenesis used endothelial cells as a single cell type modelfor in vitro experiments [36,37], while in this study we exploredmolecular stimuli between HUVECs and HFs using multiple condi-tioned media to mimic the complex cell interactions that takeplace in vivo. In response to biomaterial implantation, varioustypes of cells are recruited and migrate to the local environmentaround the implant [52]. After interacting with the implant, thesecells can synthesize and secrete various types of growth factorsand cytokines. Besides inflammatory cells, fibroblasts are the maincells that migrate into the pore space of porous CaP ceramics, ascould be identified by the histological sections at 1 week afterimplantation, in which only loose fibrous connective tissue wasseen (Fig. 8). Endothelial cells contribute directly to the formationof blood vessels. Commonly, fibroblasts and endothelial cells havebeen used in the construction of tissue engineering scaffolds so asto achieve rapid vascularization [31,38,46]. We therefore evaluatedthe interaction between porous CaP ceramics and HFs or HUVECsby in vitro cell culture in the present study. Our results show thatall of the ceramics supported the growth and proliferation of HFsand HUVECs well (Figs. 1 and 2). An interesting finding was that,compared with the leach liquors of the ceramics, the conditionedmedia of both HFs and HUVECs cultured on the ceramics could sig-nificantly promote the proliferation of HUVECs (Fig. 3).

It was revealed that the secreta of HFs or HUVECs stimulated bythe ceramics played an important role in the HUVECs’ proliferation.Further experiments on in vitro angiogenesis confirmed that theconditioned media of HFs cultured on the ceramics could promotethe formation of capillary-like networks of HUVECs (Fig. 4), andthat this effect was more significant in BCP-2 and b-TCP (Fig. 5).The results of the PCR assay gave a rational explanation for thisphenomenon. After 7 days of culture, the gene expressions of VEGF,bFGF and TGF-b in HFs were up-regulated significantly by BCP-2and b-TCP (Fig. 6), which could lead to greater release of these fac-tors into the conditioned media. Similarly, the significantly ele-vated gene expressions of VEGF and TGF-b in HUVECs werefound in most of the ceramics (Fig. 7a and c). It is known thatangiogenic factors take effect on HUVECs by binding theirreceptors, which play an essential role in angiogenesis [53–55].We also measured the gene expressions of the receptors of theabove three angiogenic factors, i.e. KDR, FGFR1 and ACVRL1, inHUVECs with the stimulation of porous CaP ceramics. It was foundthat, unlike ACVRL1, both KDR and FGFR1 were up-regulatedsignificantly by most of the ceramics (Fig. 7a–c). Thus, the

Fig. 10. Expressions of the angiogenesis-related genes in the cells grown into the inner pores of porous CaP ceramics after implantation into the thigh muscles of mice for 1, 2,3, 4 and 8 weeks: (a) VEGF; (b) KDR; (c) bFGF; (d) FGFR1; (e) TGF-b; (f) ACVRL1; (g) eNOS.

444 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

Fig. 11. IHC staining of VEGF, bFGF and TGF-b in the decalcified sections of porous CaP ceramics implanted into the thigh muscles of mice for 4 weeks. The brown signalsshow the presence of VEGF, bFGF or TGF-b in the inner pores.

Fig. 12. Quantitative analysis for angiogenic factors present in the inner pores of porous CaP ceramics implanted into the thigh muscles of mice for 1, 2, 3, 4 and 8 weeks: (a)VEGF; (b) bFGF; (c) TGF-b.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 445

446 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

simultaneous up-regulation of VEGF and its receptor KDR inHUVECs indicates that they could play a crucial role in ceramic-induced angiogenesis.

It has been confirmed that eNOS and NO are two importantdownstream components in angiogenic signal transduction [56].Our results show that eNOS gene expression in HUVECs was signif-icantly up-regulated by all of the ceramics except HA (Fig. 7d).Increased NO signals thus cause endothelial cells to proliferate,migrate and form tubes, initiating the process of angiogenesis. Allof these results indicate that porous CaP ceramics can initiate angio-genic induction by two different mechanisms. One is a paracrineeffect, stimulating the secretion of angiogenic factors of fibroblaststo promote the proliferation of endothelial cells. The other way is anautocrine effect, stimulating the secretion of angiogenic factors ofendothelial cells to further promote their proliferation.

To verify the above in vitro results, we also analyzed the angio-genesis-related gene expressions of the cells grown into the porespace of porous CaP ceramics after in vivo implantation. Accordingto the results of the PCR assay, VEGF and its receptor KDR showedthe highest expression at 1 week after implantation, while bFGFand its receptor FGFR1, TGF-b and its receptor ACVRL1, and eNOSreached their highest expressions at about 3 weeks after implanta-tion (Fig. 10a–g). As visualized by H&E staining (Fig. 8), many bloodcapillaries had emerged in the inner pores of porous CaP ceramicsat 2 weeks after implantation. Therefore, the early angiogenesiscould be mainly ascribed to the role of VEGF and its receptor withregard to the gene expression result (Fig. 10a and b). Certainly,bFGF, TGF-b and their receptors played an active role in the forma-tion of mature vascular networks (Fig. 10c–f). It should also benoted that the elevated expressions of these genes were oftenobserved in BCP-2 and b-TCP, indicating the important role of ahigher content of b-TCP phase in the ceramics in promoting theexpressions of the angiogenesis-related genes. Furthermore, weinvestigated the presence of these three angiogenic factors in thelocal environment around porous CaP ceramics after in vivoimplantation by using the IHC staining technique. Our results con-firmed the presence of these factors in the pore space of the ceram-ics (Fig. 11). With the prolongation of the implantation time from1 week to 4 weeks, they all showed a sustained increase, with moreVEGF being present than bFGF and TGF-b (Fig. 12a–c), demonstrat-ing the main role of VEGF in the neovascularization of porous CaPceramics. The strong adsorption affinity of porous CaP ceramics forvarious growth factors, such as BMP-2, TGF-b and VEGF, has beenwidely reported in previous studies [10,57–62]. Thus, it is possiblethat the angiogenic factors produced by the various cells could beconcentrated in the local environment around the ceramicimplants. At 8 weeks after implantation, the amount of VEGF pres-ent decreased, but the amounts of bFGF and TGF-b increasedslightly (Fig. 12a–c). According to the above SEM observation andhistological analysis, the mature vascular networks had mostly

Fig. 13. SEM images of the surface microstructures of porous CaP ceram

formed at 4 weeks after implantation, so could be the main reasonwhy the three angiogenic factors showed a decreased or moder-ately increased level at 8 weeks. In addition, the presence of thesefactors was different in each of the four types of porous CaP cera-mic. Their expression was consistently higher in BCP-2 and b-TCPthan in HA and BCP-1 (Fig. 12a–c). This meant that a higher contentof b-TCP phase in porous CaP ceramics could be more favorable forthe aggregation of angiogenic factors in the microenvironmentaround the implant, leading to the formation of more new bloodvessels, which accords well with the above results of the MVDcounts (Table 2).

All the in vitro and in vivo experimental results confirmed theoccurrence of angiogenic induction by porous CaP ceramics. How-ever, the four types of ceramic used demonstrated different levelsof ability to induce angiogenesis. For a biomaterial scaffold, thecomponents of its porous structure, including pore shape, pore sizedistribution and porosity, are all important factors influencing theprocess of neovascularization [32–35,63]. To exclude these vari-ances in the experiment, all four of the ceramics in the currentstudy were prepared by the same method and had a similar porousstructure, as described before. Thus the difference in phase compo-sition could be the sole reason why different abilities to induceangiogenesis were observed in the different groups. According toour results, an interesting finding is that a higher content ofb-TCP phase in the ceramics is more favorable for the process ofneovascularization, which was achieved by stimulating the expres-sion and secretion of more angiogenic factors. According to theH&E staining (Fig. 8) and SEM observation (Fig. 9), newly formedblood vessels were often located in the interior space of the poresof the ceramic implants and surrounded by other fibrous tissue.Therefore, the local ionic environment in the inner pores of theceramics could play an important role in their neovascularization.Several studies have confirmed that ionic products generated bybioactive glass and calcium silicate ceramic play a vital role in pro-moting angiogenesis [35–38,47]. It is well accepted that b-TCP hashigher solubility than HA [8,64], thus a higher content of b-TCPphase in porous CaP ceramics releases more ions, leading to ahigher local ionic concentration, which could be favorable for cellmigration and proliferation. This could be one of the main reasonswhy b-TCP and BCP-2 exhibited excellent neovascularization in themice in our study.

In our previous study, BCP-2 showed the strongest osteoinduc-tion in mice of four types of porous CaP ceramics. In the b-TCPgroup, even at 90 days after implantation, no ectopic bone forma-tion was observed [10]. Combining these findings with our presentstudy, the correlation and balance between neovascularization andosteoinduction of porous CaP ceramics should be emphasized. b-TCP showed excellent angiogenic induction but poor osteoinduc-tion in mice. However, BCP-2 exhibited good angiogenic inductionas well as excellent osteoinduction. Generally, the induced new

ics after implantation into the thigh muscles of mice for 4 weeks.

Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448 447

bone grows along the wall of the inner macropores of the ceramics.Therefore, osteoinduction of porous CaP ceramics could not only beinfluenced by the local ionic concentration, but also affected by thesurface microstructure. It is generally accepted that the formationof bone-like apatite on the surface is necessary for the osteoinduc-tion of biomaterials, as it could be a physicochemical trigger for theosteoblastic differentiation of mesenchymal stem cells [50,65]. Wetherefore compared the surface microstructure of BCP-2 and b-TCPafter implantation into the thigh muscles of mice for 4 weeks, andfound that more bone-like apatite formed on BCP-2 than on b-TCP(Fig. 13). This could be one of the reasons why BCP-2 showed bet-ter osteoinduction than b-TCP. The results also indicate that angio-genic induction and osteoinduction could be determined bydifferent material factors from porous CaP ceramics. Thus, in theselection of porous CaP ceramics and other biomaterials for therepair of bone defects, while much attention has been paid to opti-mizing the osteoinduction, the balance between osteoinductionand angiogenic induction should not be ignored. This possibledivergent mechanism involved in the processes of bone and vascu-lature generation within porous CaP ceramics will be the scope ofour future work.

5. Conclusions

The current study investigated the neovascularization of porousCaP ceramics and assessed the effect of the phase composition ofthe ceramics and the action mechanism involved by usingin vitro and in vivo evaluation. The results of the in vitro cell exper-iments confirmed that the ceramics could promote proliferationand angiogenesis of HUVECs by stimulating HFs to secrete angio-genic factors as a paracrine effect, and up-regulating HUVECs toexpress these angiogenic factors and their receptors as an auto-crine effect. In addition, these effects were more significant in b-TCP and BCP-2. Their implantation in vivo into the thigh musclesof mice showed that numerous new blood capillaries in the innerpores of the ceramics could be observed at 2 weeks. Mature vascu-lar networks had formed in the pore space of the ceramics at4 weeks. Quantitatively, b-TCP and BCP-2 showed stronger angio-genic induction compared with HA and BCP-1, indicating the roleof the b-TCP content of the ceramics in the process of neovascular-ization. In line with the in vitro results, the in vivo expressions ofangiogenesis-related genes were significantly up-regulated in b-TCP and BCP-2, leading to the presence of more angiogenic factorsin the local environment around the ceramics. Among these angio-genic factors, VEGF exhibited faster and stronger expression thanbFGF and TGF-b, proving its crucial role in the neovascularizationof porous CaP ceramics. Taken together, our results demonstratethe angiogenic induction ability of porous CaP ceramics and revealthat a higher content of b-TCP phase in the ceramics could be morefavorable for the process of neovascularization.

Acknowledgements

The authors wish to acknowledge the financial support from theNational Natural Science Foundation of China (81190131,31370973) and the National Basic Research Program of China(2011CB606201).

Appendix A. Figures with essential color discrimination

Certain figures in this article, particularly Figs. 1, 4 and 8–12 aredifficult to interpret in black and white. The full color images canbe found in the on-line version, at http://dx.doi.org/10.1016/j.actbio.2014.09.028.

References

[1] Calori GM, Mazza E, Colombo M, Ripamonti C. The use of bone-graftsubstitutes in large bone defects: any specific needs? Injury 2011;42(Suppl2):S56–63.

[2] Giannoudis PV, Dinopoulos H, Tsiridis E. Bone substitutes: an update. Injury2005;36:S20–7.

[3] Reichert JC, Saifzadeh S, Wullschleger ME, Epari DR, Schütz MA, Duda GN, et al.The challenge of establishing preclinical models for segmental bone defectresearch. Biomaterials 2009;30:2149–63.

[4] Cheng L, Ye F, Yang R, Lu X, Shi Y, Li L, et al. Osteoinduction of hydroxyapatite/b-tricalcium phosphate bioceramics in mice with a fractured fibula. ActaBiomater 2010;6:1569–74.

[5] Hench LL. Bioceramics: from concept to clinic. J Am Ceram Soc1991;74:1487–510.

[6] Kondo N, Ogose A, Tokunaga K, Umezu H, Arai K, Kudo N, et al. Osteoinductionwith highly purified b-tricalcium phosphate in dog dorsal muscles and theproliferation of osteoclasts before heterotopic bone formation. Biomaterials2006;27:4419–27.

[7] Le Nihouannen D, Daculsi G, Saffarzadeh A, Gauthier O, Delplace S, Pilet P, et al.Ectopic bone formation by microporous calcium phosphate ceramic particlesin sheep muscles. Bone 2005;36:1086–93.

[8] LeGeros RZ. Calcium phosphate-based osteoinductive materials. Chem Rev2008;108:4742–53.

[9] Ripamonti U. Osteoinduction in porous hydroxyapatite implanted inheterotopic sites of different animal models. Biomaterials 1996;17:31–5.

[10] Wang J, Chen Y, Zhu X, Yuan T, Tan Y, Fan Y, et al. Effect of phase compositionon protein adsorption and osteoinduction of porous calcium phosphateceramics in mice. J Biomed Mater Res A 2014. available at <http://onlinelibrary.wiley.com/doi/10.1002/jbm.a.35102/full/>.

[11] Yuan H, Kurashina K, de Bruijn JD, Li Y, de Groot K, Zhang X. A preliminarystudy on osteoinduction of two kinds of calcium phosphate ceramics.Biomaterials 1999;20:1799–806.

[12] Yuan H, Van Blitterswijk CA, De Groot K, De Bruijn JD. Cross-speciescomparison of ectopic bone formation in biphasic calcium phosphate (BCP)and hydroxyapatite (HA) scaffolds. Tissue Eng 2006;12:1607–15.

[13] Yuan H, Yang Z, Li Y, Zhang X, De Bruijn J, De Groot K. Osteoinduction bycalcium phosphate biomaterials. J Mater Sci - Mater Med 1998;9:723–6.

[14] Hong Y, Fan H, Li B, Guo B, Liu M, Zhang X. Fabrication, biological effects, andmedical applications of calcium phosphate nanoceramics. Mater Sci Eng R Rep2010;70:225–42.

[15] Fellah BH, Gauthier O, Weiss P, Chappard D, Layrolle P. Osteogenicity ofbiphasic calcium phosphate ceramics and bone autograft in a goat model.Biomaterials 2008;29:1177–88.

[16] Yuan H, Fernandes H, Habibovic P, de Boer J, Barradas AM, de Ruiter A, et al.Osteoinductive ceramics as a synthetic alternative to autologous bone grafting.Proc Natl Acad Sci USA 2010;107:13614–9.

[17] Bloemers FW, Blokhuis TJ, Patka P, Bakker FC, Wippermann BW, HaarmanHJTM. Autologous bone vs. calcium-phosphate ceramics in treatment ofexperimental bone defects. J Biomed Mater Res B 2003;66:526–31.

[18] Kanczler J, Oreffo R. Osteogenesis and angiogenesis: the potential forengineering bone. Eur Cell Mater 2008;15:100–14.

[19] Glowacki J. Angiogenesis in fracture repair. Clin Orthop Relat Res1998;355:S82–9.

[20] Carano RA, Filvaroff EH. Angiogenesis and bone repair. Drug Discov Today2003;8:980–9.

[21] Hausman MR, Schaffler MB, Majeska RJ. Prevention of fracture healing in ratsby an inhibitor of angiogenesis. Bone 2001;29:560–4.

[22] Keramaris N, Calori G, Nikolaou V, Schemitsch E, Giannoudis P. Fracturevascularity and bone healing: a systematic review of the role of VEGF. Injury2008;39:S45–57.

[23] Presta M, Dell’Era P, Mitola S, Moroni E, Ronca R, Rusnati M. Fibroblast growthfactor/fibroblast growth factor receptor system in angiogenesis. CytokineGrowth Factor Rev 2005;16:159–78.

[24] Murakami M, Simons M. Fibroblast growth factor regulation ofneovascularization. Curr Opin Hematol 2008;15:215.

[25] Kent Leach J, Kaigler D, Wang Z, Krebsbach PH, Mooney DJ. Coating of VEGF-releasing scaffolds with bioactive glass for angiogenesis and boneregeneration. Biomaterials 2006;27:3249–55.

[26] Nillesen S, Geutjes PJ, Wismans R, Schalkwijk J, Daamen WF, van Kuppevelt TH.Increased angiogenesis and blood vessel maturation in acellular collagen–heparin scaffolds containing both FGF2 and VEGF. Biomaterials2007;28:1123–31.

[27] Wernike E, Montjovent M, Liu Y, Wismeijer D, Hunziker E, Siebenrock K, et al.VEGF incorporated into calcium phosphate ceramics promotes vascularisationand bone formation in vivo. Eur Cell Mater 2010;19:30–40.

[28] Santos MI, Unger RE, Sousa RA, Reis RL, Kirkpatrick CJ. Crosstalk betweenosteoblasts and endothelial cells co-cultured on a polycaprolactone-starchscaffold and the in vitro development of vascularization. Biomaterials2009;30:4407–15.

[29] Hofmann A, Ritz U, Verrier S, Eglin D, Alini M, Fuchs S, et al. The effect ofhuman osteoblasts on proliferation and neo-vessel formation of humanumbilical vein endothelial cells in a long-term 3D co-culture onpolyurethane scaffolds. Biomaterials 2008;29:4217–26.

448 Y. Chen et al. / Acta Biomaterialia 11 (2015) 435–448

[30] Kirkpatrick CJ, Fuchs S, Unger RE. Co-culture systems for vascularization –learning from nature. Adv Drug Deliv Rev 2011;63:291–9.

[31] Sorrell JM, Baber MA, Caplan AI. A self-assembled fibroblast–endothelial cellco-culture system that supports in vitro vasculogenesis by both humanumbilical vein endothelial cells and human dermal microvascular endothelialcells. Cells Tissues Organs 2007;186:157–68.

[32] Klenke FM, Liu Y, Yuan H, Hunziker EB, Siebenrock KA, Hofstetter W. Impact ofpore size on the vascularization and osseointegration of ceramic bonesubstitutes in vivo. J Biomed Mater Res A 2008;85:777–86.

[33] Karageorgiou V, Kaplan D. Porosity of 3D biomaterial scaffolds andosteogenesis. Biomaterials 2005;26:5474–91.

[34] Chiu Y-C, Cheng M-H, Engel H, Kao S-W, Larson JC, Gupta S, et al. The role ofpore size on vascularization and tissue remodeling in PEG hydrogels.Biomaterials 2011;32:6045–51.

[35] Feng B, Jinkang Z, Zhen W, Jianxi L, Jiang C, Jian L, et al. The effect of pore sizeon tissue ingrowth and neovascularization in porous bioceramics of controlledarchitecture in vivo. Biomed Mater 2011;6:015007.

[36] Li H, Chang J. Stimulation of proangiogenesis by calcium silicate bioactiveceramic. Acta Biomater 2013;9:5379–89.

[37] Zhai W, Lu H, Chen L, Lin X, Huang Y, Dai K, et al. Silicate bioceramics induceangiogenesis during bone regeneration. Acta Biomater 2012;8:341–9.

[38] Li H, Chang J. Bioactive silicate materials stimulate angiogenesis in fibroblastand endothelial cell co-culture system through paracrine effect. Acta Biomater2013;9:6981–91.

[39] Gorustovich AA, Roether JA, Boccaccini AR. Effect of bioactive glasses onangiogenesis: a review of in vitro and in vivo evidences. Tissue Eng B Rev2009;16:199–207.

[40] Rücker M, Laschke MW, Junker D, Carvalho C, Tavassol F, Mülhaupt R, et al.Vascularization and biocompatibility of scaffolds consisting of differentcalcium phosphate compounds. J Biomed Mater Res A 2008;86:1002–11.

[41] Zhang C, Huang P, Weng J, Zhi W, Hu Y, Feng H, et al. Histomorphologicalresearches on large porous hydroxyapatite cylinder tubes with polylactic acidsurface coating in different nonskeletal sites in vivo. J Biomed Mater Res A2012;100:1203–8.

[42] Chang CS, Su CY, Lin TC. Scanning electron microscopy observation ofvascularization around hydroxyapatite using vascular corrosion casts. JBiomed Mater Res 1999;48:411–6.

[43] Yuan H, Van Blitterswijk C, De Groot K, De Bruijn J. A comparison of boneformation in biphasic calcium phosphate (BCP) and hydroxyapatite (HA)implanted in muscle and bone of dogs at different time periods. J BiomedMater Res A 2006;78:139–47.

[44] Tonnesen MG, Feng X, Clark RAF. Angiogenesis in wound healing. J InvestigDermatol Symp Proc 2000;5:40–6.

[45] Newman AC, Nakatsu MN, Chou W, Gershon PD, Hughes CC. The requirementfor fibroblasts in angiogenesis: fibroblast-derived matrix proteins are essentialfor endothelial cell lumen formation. Mol Biol Cell 2011;22:3791–800.

[46] Choong CS, Hutmacher DW, Triffitt JT. Co-culture of bone marrow fibroblastsand endothelial cells on modified polycaprolactone substrates for enhancedpotentials in bone tissue engineering. Tissue Eng 2006;12:2521–31.

[47] Day RM. Bioactive glass stimulates the secretion of angiogenic growth factorsand angiogenesis in vitro. Tissue Eng 2005;11:768–77.

[48] Ding S, Li C, Lin S, Yang Y, Liu D, Han Y, et al. Comparative evaluation ofmicrovessel density determined by CD34 or CD105 in benign and malignantgastric lesions. Hum Pathol 2006;37:861–6.

[49] Habibovic P, Sees TM, van den Doel MA, van Blitterswijk CA, de Groot K.Osteoinduction by biomaterials – physicochemical and structural influences. JBiomed Mater Res A 2006;77:747–62.

[50] Habibovic P, Yuan H, van der Valk CM, Meijer G, van Blitterswijk CA, de GrootK. 3D microenvironment as essential element for osteoinduction bybiomaterials. Biomaterials 2005;26:3565–75.

[51] Dimitriou R, Tsiridis E, Giannoudis PV. Current concepts of molecular aspectsof bone healing. Injury 2005;36:1392–404.

[52] Anderson JM. Biological responses to materials. Annu Rev Mater Res2001;31:81–110.

[53] Coultas L, Chawengsaksophak K, Rossant J. Endothelial cells and VEGF invascular development. Nature 2005;438:937–45.

[54] Nakamura T, Mochizuki Y, Kanetake H, Kanda S. Signals via FGF receptor 2regulate migration of endothelial cells. Biochem Biophys Res Commun2001;289:801–6.

[55] Bernabeu C, Lopez-Novoa JM, Quintanilla M. The emerging role of TGF-bsuperfamily coreceptors in cancer. BBA Mol Basis Dis 2009;1792:954–73.

[56] Duda DG, Fukumura D, Jain RK. Role of eNOS in neovascularization: NO forendothelial progenitor cells. Trends Mol Med 2004;10:143–5.

[57] Chen Y, Wang J, Zhu X, Fan Y, Zhang X. Adsorption and release behaviors ofvascular endothelial growth factor on porous hydroxyapatite ceramic undercompetitive conditions. J Biomater Tissue Eng 2014;4:155–61.

[58] Ziegler J, Mayr-Wohlfart U, Kessler S, Breitig D, Günther KP. Adsorption andrelease properties of growth factors from biodegradable implants. J BiomedMater Res 2002;59:422–8.

[59] Autefage H, Briand-Mésange F, Cazalbou S, Drouet C, Fourmy D, Gonçalvès S,et al. Adsorption and release of BMP-2 on nanocrystalline apatite-coated anduncoated hydroxyapatite/b-tricalcium phosphate porous ceramics. J BiomedMater Res B 2009;91:706–15.

[60] Boix T, Gómez-Morales J, Torrent-Burgués J, Monfort A, Puigdomènech P,Rodríguez-Clemente R. Adsorption of recombinant human bonemorphogenetic protein rhBMP-2m onto hydroxyapatite. J Inorg Biochem2005;99:1043–50.

[61] Yuan H, Zou P, Yang Z, Zhang X, De Bruijn J, De Groot K. Bone morphogeneticprotein and ceramic-induced osteogenesis. J Mater Sci - Mater Med1998;9:717–21.

[62] Zhu X, Fan H, Xiao Y, Li D, Zhang H, Luxbacher T, et al. Effect of surfacestructure on protein adsorption to biphasic calcium-phosphate ceramicsin vitro and in vivo. Acta Biomater 2009;5:1311–8.

[63] Santos MI, Reis RL. Vascularization in bone tissue engineering: physiology,current strategies, major hurdles and future challenges. Macromol Biosci2010;10:12–27.

[64] Van der Meulen J, Koerten H. Inflammatory response and degradation of threetypes of calcium phosphate ceramic in a non-osseous environment. J BiomedMater Res 1994;28:1455–63.

[65] Duan Y, Wang C, Chen J, Zhang X. Bone-like apatite formation inintramuscularly implanted calcium phosphate ceramics in different kinds ofanimals. J Mater Sci Lett 2002;21:775–8.