221 Gene, 138 (1994) 227-232

0 1994 Elsevier Science B.V. All rights reserved. 0378-l 119/94/$07.00

SSDI 0378-1119 (93) E0638-T

GENE 07584

Construction and features of hEMBL3cosW, a h replacement vector for detailed analysis of large regions of genomic DNA

(Bacteriophage h; SP6 and T7 RNA polymerase promoters; transcription terminators; cos-labelling; contigs; restriction

maps; cloning techniques)

Paul A. Whittaker and Lynn Wood

University Clinical Biochemistry, Southumpton Generul Hospital, Southampton SO9 4XY, UK

Received by K.F. Chater: 21 July 1993; Accepted: 11 August 1993; Received at publishers: 9 September 1993

SUMMARY

A phage h replacement vector, hEMBL3cosW, is described which expedites detailed analysis of large regions of

chromosomal DNA. Two features of the vector aid this process. Firstly, the replaceable stuffer in hEMBL3cosW is

flanked by SP6 and T7 promoters so that end-specific hybridisation probes can be rapidly generated from cloned inserts

for identification of sequentially overlapping clones in genomic libraries. Secondly, because all the phage coding sequences

in the vector (which are placed to the right of the replaceable stuffer) can be removed from cloned inserts by cleavage

with NotI, restriction mapping of cloned inserts using partial digest strategies is greatly facilitated. Other features of the

vector are: (1) strategically placed BumHI and XhoI sites for the cloning of genomic DNA partially digested with MboI

or Sau3AI by two different methods; (2) Sal1 and S’I sites for the isolation of intact cloned inserts; and (3) transcription

terminators to insulate vector genes from transcriptional interference from cloned insert DNAs.

INTRODUCTION

Since they were first described in 1983, the EMBL

series of phage h replacement vectors (Frischauf et al.,

1983) have been successfully used for the cloning of DNA

from a variety of organisms (e.g., Kohara et al., 1987).

Subsequent modifications to the basic design have re-

Correspondence to: Dr. P.A. Whittaker, Room LD 58, South Block,

Southampton General Hospital, Southampton SO9 4XY, UK.

Tel. (44-703) 796925; Fax (44-703) 794-760; e-mail:

P.A.Whittaker@UK.ac.soton.mail

Abbreviations: bp, base pair(s); BSA, bovine serum albumin; CIAP, calf

intestinal alkaline phosphatase; cos, cohesive end site of phage h, cos-L

and cos-R, left and right cos ends; DTT, dithiothreitol; HPRI, human

placental ribonuclease inhibitor; kb, kilobase or 1000 bp; LH, left-

hand; Mb, megabase( MCS, multiple cloning site; nt, nucleotide(s);

oligo, oligodeoxyribonucleotide; PFGE, pulsed-field-gel electrophore-

sis; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; pfu,

plaque-forming units; RH, right-hand; rmC, Escherichia co/i rDNA

operon C; trp (I, tryptophan operon attenuator; tsp, transcription start

point(s); u, unit(s); YAC, yeast artificial chromosome.

sulted in vectors which facilitate the construction of link-

ing libraries (Frischauf et al., 1987), restriction mapping

of cloned inserts (Whittaker et al., 1988) or excision of

cloned inserts for further analysis (Lathe et al., 1987;

Altenbuchner, 1993). However, none of these vectors

have been specifically designed to enable the efficient iso-

lation of collections of sequentially overlapping phage

clones (contigs) from genomic libraries, an important step

in the structural and functional characterisation of large

genes, or the identification of disease genes by positional

cloning (for a review, see Whittaker, 1991). Therefore, we

have developed a new vector, hEMBL3cosW, which

simplifies this process.

EXPERIMENTAL AND DISCUSSION

(a) Features of the oligo cassettes

The sequence of the LH and RH oligo cassettes used

in the construction of hEMBL3cosW is shown in Fig. 1.

228

LH

Cassette

Sal1 trpa terminator

SfiI

AAAAGCCCGC TCATTAGGCG GG TTT TTTTCGGGCGAGTAATCCGCCC

4 ~ SP6 Promoter r, '7 ":I "yl' '?I -3,

GCCTC GATGGC TTTAGGTGACAC TATAGAAGGGCTCGAGGGATCCTCGGCCGT G CGGAG CTACCG AAATCCACTGTG ATATCTTCCCGAGCTCCCTAGGAGCCGGCA CTTAA -5'

RH Cassette

XaaIII

EcoRI BaaHI XhoI Not1 SfiI Sal1

444 4 T7 Promoter

C$----j"x; GCCTCGfTGG

rrnC terminator 4

5'4TTCGGAT CCCTCGAGGC GGCCG CTCCCTATAGTGA GTCGTATT CC$A4 TCATC CTTAGCGAAA GCTAAGGATT TTTTTTATCT GAAT 3'- GCCTA GGGAGCTCCG CCGGC GAGGGATATCACT CAGCATAA C CGGAGCTACC G TTAGTAG GAATCGCTTT CGATTCCTAA AAAAAATAGA CTT

4-J

Fig. 1. Nucleotide sequences of the left-hand (LH) and right-hand (RH) oligo cassettes used in the construction of hEMBL3c~osW. Each oligo cassette

has the following features: 4-nt overhangs complementary to SNII (TCGA) and EcoRI (AATT) for directional insertion into hEMBL3ro.s (Fig. 2

legend); restriction sites for $fiI, BumHI, XhoI, XmuIII and Not1 (RH cassette only); T7 (Dunn and Studier, 1983) and SP6 (Melton et al.. 1984)

promoters; and trpu (Young, 1979) and rrnC (Christie et al.. 1981) transcription terminators. The angled arrows indicate the precise tsp and which

DNA strand corresponds to the RNA synthesised by the two polymerases. Constructions: Individual oligos were synthesised on an Applied Biosystems

automatic synthesiser. Duplex cassettes were made by heat denaturing equimolar amounts of the complementary oligos at 70 C for 5 mitt, then

transferring to a beaker containing water at 65‘C. The water was allowed to cool slowly to room temperature to promote annealing of the oligos to

give the duplex cassettes. The cassettes were stored in small aliquots at -20 C.

The presence of BarnHI and XhoI sites allows the cloning

of partial MboI or Sau3A digests by two different strate-

gies (section c). Because S”I is predicted to cut every

150 kb in mammalian DNA (Drmanac et al., 1986), the

@I site in both the LH and RH cassettes allows the

removal of DNA inserts intact from most clones (Sal1

can also be used to cleave out most cloned inserts, but,

because the cutting frequency is every 38 kb, a larger

proportion of cloned inserts would be expected to contain

SUIT sites). The Not1 site in the RH cassette facilitates

partial digest mapping of cloned DNA sequences by al-

lowing removal of the right arm of the vector from cloned

inserts and their attached left arm (section e). The pres-

ence of transcriptional promoters from phage T7 (RH

cassette) and SP6 (LH cassette) allow transcription into

the cloned DNA sequence, to obtain end-specific RNA

probes for detecting overlapping clones during contig

generation (sections d and f). As with the cosmid vector

Lorist 2 (Gibson et al., 1987) transcriptional terminators

have been included in each cassette to insulate vector

genes against transcriptional interference from cloned

insert DNA. Such interference would be expected both

to affect the quantity of phage proteins expressed and to

disrupt the timing of the life cycle, reducing burst size

and possibly clone viability. The effect of this modifica-

tion on clone representation in EMBL3cosW genomic

libraries has yet to be assessed, but studies (Bovre and

Szybalski, 1969; Ward and Murray, 1979) on the effects

of convergent transcription in a phage h system reported

reciprocal depression of gene expression, including total

elimination of the expression of the less strongly tran-

scribed DNA strand.

(b) Construction of hEMBL3cosW

The vector was constructed by inserting the LH and

RH oligo cassettes (Fig. 1) into vector hEMBL3cos

(Whittaker et al., 1988) as described in the legend to

Fig. 2. Probing of phage recovered after in vitro packag-

ing of the ligated DNA with the RH and LH oligos re-

vealed 14 which were positive for both. DNAs from these

clones were cleaved with Not1 to check whether the RH

cassette was on the left- or right-hand side of the stuffer

fragment. Four clones were digested with Not1 to release

the stuffer fragment and attached left arm from the large

right arm of the vector. Sal1 and EcoRI digests of the

four clones were bidirectionally blotted (Smith and

Summers, 1980) and hybridised with the RH and LH

oligos to confirm the RH and LH cassette arrangement

inferred from the Nor1 digests. Each of the clones con-

tained a 4.8-kb Sal1 fragment which hybridised with the

LH oligo and a 7.8-kb fragment which hybridised with

the RH oligo, thus showing that the orientation of the

central fragment is the same as that found in vector

hEMBL3 (Frischauf et al., 1983). No hybridisation to the

229

14kb 9kb 20kb Fig. 2. Structure of phage vector hEMBL3cosW. All the essential phage genes (N-R and A-J) are on the long right arm, leaving cos-L separated by

only 200 bp from the replaceable stuffer fragment (containing the rrd and gclm genes) rather than 20 kb, as in conventional A. replacement vectors

such as AEMBL3 (Frischauf et al., 1983). This arrangement has particular advantages for restriction mapping via partial cleavage of cos-L-labelled

phage DNA (section e). The black box indicates the cos site inactivated with Sl nuclease during the construction of the parent vector hEMBL3co.s

(Whittaker et al., 1988). The direction of transcription from the SP6 and T7 promoters flanking the stuffer fragment is indicated by arrows. The

positions of the transcription terminator sequences (Ter) are also shown. Constructions: EcoRI-digested hEMBL3cn.s DNA ( 1 ug) was ligated with a

500-fold molar excess (1 ug) of the LH and RH unphosphorylated cassettes (Fig. 1 and section a) in a final volume of 10 u1 at 12’C overnight. An

aliquot ( 1 ul) of the ligated DNA was analysed on an 0.8% agarose gel. Successful addition of the cassettes was indicated by lack of ligation of the

vector DNA compared with a control ligation not containing the cassettes. The ligated DNA was ethanol precipitated, then phosphorylated using

polynucleotide kinase (5 u) and ATP (1 mM) in a final volume of 10 pl for 30 min at 37 ‘C. The DNA was electrophoresed on an 0.8% agarose gel

and the stuffer fragment purified from the gel using GeneClean (Bio lOl., La Jolla, CA, USA). The purified stuffer was then ligated to SuII-digested

and CIAP-treated hEMBL3cos DNA (1 Kg) as described above. Plaques obtained after in vitro packaging of the ligated DNA and plating on E. co/i

NM621 were screened with radiolabelled RH and LH probes using standard procedures (for details of packaging reactions. plating strains etc.. see

Whittaker et al., 1988; Whittaker, 1993). The structure of the resulting vector, hEMBL3cosW. was confirmed by restriction and hybridisation analysis

(section b).

left or right phage arms in Sal1 digests was detected with

either oligo. As expected, EcoRl cleaved away the LH

and RH oligos from the stuffer fragment, but left them

attached to the left and right arms respectively. No hy-

bridisation to the stuffer fragment was detected by either

oligo in EcoRI digests.

(c) Library construction in hEMBL3cosW

The presence of strategically placed BamHI and XhoI

sites allows cloning of MboI or Sau3AI partial digests by

two different methods. Partially digested DNA can be

cloned using phage vector DNA which has been doubly

digested with BamHI + EcoRI and dephosphorylated.

Re-ligation of the vector arms with the central stuffer

fragment is virtually eliminated (Whittaker et al., 1988)

so maximising the number of recombinants. The genomic

DNA is size-fractionated after partial digestion to avoid

the possibility of cloning two or more genomic fragments

into the same site. Using this strategy, we have made

several genomic libraries of mouse, human and total yeast

DNA from a strain carrying a 390-kb YAC from the

human dystrophin gene (Whittaker et al., 1993b).

hEMBL3cosW can also be used in an alternative strategy

involving the use of partially filled-in vector XhoI sites

in conjunction with partially filled in MboI- or Sau3AI-

digested genomic DNA (Zabarovsky and Allikmets,

1986). This approach eliminates the need for size fraction-

ation of genomic fragments, since the partial fill-in reac-

tion prevents insert-to-insert ligation. The genomic DNA

is partially filled in with A and G and ligated to XhoI-

digested vector DNA partially filled in with C and T.

Since any fractionation procedure results in the loss of

significant amounts of material, the XhoI half-site cloning

method is especially useful when only small amounts of

genomic DNA are available. For example, we have used

this strategy for the construction of a phage sublibrary

using nanogram quantities of a 160-kb YAC from the

human dystrophin gene purified by PFGE (Whittaker

et al., 1993a).

(d) Generation of end-specific transcripts from cloned

inserts

Hybridisation probes specific for the ends of cloned

inserts can be generated using the SP6 and T7 promoters

flanking the cloning sites in hEMBL3cosW. SP6 and T7

riboprobes for library screening are easily prepared using

small amounts of mini-preparation quality DNA and

32P-label (Whittaker et al., 1993b). Since RNA transcripts

longer than 10 kb can be generated in in vitro transcrip-

tion reactions (Melton et al., 1984), we curtail the length

of RNA transcripts by limiting the UTP concentration

to 5.625 uM (5 uM unlabelled UTP and 0.625 uM

(10 uCi) [E-~~P] UTP). This is simpler and more econom-

ical than the alternative procedure of digesting the clone

DNA with a frequently cutting restriction enzyme before

transcription. The effect of UTP concentration on the

size of T7 riboprobes made using minipreparation DNA

as a template is shown in Fig. 3A. It is apparent that at

5 uM UTP the transcript size is the same as that gener-

ated using DraI-digested DNA as a template (Fig. 3B).

230

A 1 2 3 4 5 6 bp

, - 4361 I

F

B

- 2322 r - 2027 4

- 564 I-

- 125 I-

Fig. 3. Generation of end-specific T7 riboprobes from a cloned DNA

insert in hEMBL3cosW DNA using undigested (A) or restriction

enzyme-digested (B) clone DNA. Methods: The clone (9A) was isolated

from a library made using 48XXXX cell line DNA (Whittaker, 1993)

using the probe pERT84 (Kunkel et al.. 1985). Minipreparation DNA

was prepared as described (Manfioletti and Schneider, 1988) with the

modification that 400 pl of DE52 resin was used per ml of phage lysate

rather than 1 ml (this increases the final yield of DNA). (A) T7

riboprobes were generated using 100 ng of clone DNA in a 20 ~1

reaction containing 40mM TrisHCI pH 7.5/6 mM MgCl,/2 mM

spermidine/O.Ol% BSA/lO mM DTT/20 u HPRI/O.S mM GTP/O.S mM

ATPl0.5 mM CTP/ZOO uM (lane l), 100 pM (lane 2) 50 pM (lane 3)

25 uM (lane 4) IOpM (lane 5) or 5 uM (lane 6) UTP,‘lOpCi

[%-“P] UTP (800 Ci/mmol)jlO u of T7 RNA polymerase. The reactions

were incubated at 37 C for 60 min. Nucleic acids were ethanol precipi-

tated after adding sodium acetate pH 5.6 to 0.3 M. 0.5% of the precipi-

tated material was analysed on a 2% agarose-2.2 M formaldehyde gel

(Sambrook et al., 1989) at 90 V for 60 min. After electrophoresis, the

gel was dried down onto Whatman DE81 paper and autoradiographed.

(B) T7 riboprobe prepared using I ug Drul-digested 9A DNA/10 pCi

[cc-“‘P]UTP!IS pM unlabelled UTP, and analysed exactly as for A.

Size markers are h Hind111 fragments,

Similar results were obtained with SP6 RNA polymerase

(data not shown).

Although the presence of repetitive sequences in end-

specific probes compromises their use because such

probes would hybridise to many clones in the library, we

avoid this problem by preannealing with total genomic

DNA before hybridising against plaque lifts (Whittaker

et al., 1993b).

(e) Restriction mapping of cloned inserts

Two features of the sequence arrangement of

hEMBL3cosW simplify the construction of restriction

maps using the cos-labelling strategy (Rackwitz et al.,

1984; Fig. 4). First, all the phage coding sequences are

placed to the right of the replaceable stuffer fragment so

that cos-L is separated by only 200 bp rather than 20 kb

(as in conventional replacement vectors) from the inserted

DNA fragment in recombinant phage (Fig. 2). Second,

the Not1 site in the RH cassette allows the separation of

insert fragments and the attached radiolabelled left arm

from the extensive right arm, so that only map data from

A

EMBLdcos W Hpal Map

R

B

Ii,12

9.10

7,6

6

5

RHb (Notl)

LHb b-

L

- 13

- 12 - 11

- 10 - 9

- 8 - 7

6

- 5

- 4

- 3

- 2 - I

4 Not1 Site

5

3

2

I

Fig. 4. Rapid restriction mapping of cloned inserts in hEMBL3cosW.

The procedure is illustrated by mapping the position of Hpd sites in

hEMBL3cosW DNA. Methods: Samples (0.2 ug) of undigested (A) or

NorI-digested (B) hEMBL3cosW DNA were partially digested with

HpaI (0.375 u) for 1 h at 37°C. Map data were obtained from the ladder

of partial digest bands visualised after gel electrophoresis and autoradi-

ography of DNA fragments asymmetrically labelled by annealing c,os-L

of the vector molecule with a complementary 3LP-labe11ed oligo

(5’-AGGTCGCCGCCC; for methods see Whittaker et al., 1988). The

presence of a Not1 site in the RH cassette allows the extensive right

arm of the vector (containing HpuI sites 6613) to be separated from

the stuffer fragment and labelled left arm so that only map data from

the stuffer (containing HpuI sites l-5) are generated. Because the cutting

frequency of Not1 is predicted to be every 3000 kb in mammalian DNA

(Drmanac et al., 1986), most cloned DNA fragments will not contain

a Not1 site (a high proportion of inserts containing Nor1 sites would be

expected to be derived from regions of the genome that contain HTF

islands; Lindsay and Bird, 1987).

231

the insert are generated (Fig. 4). As a result, accurate

restriction maps of cloned inserts can be constructed

using only cos-L mapping data (Wood and Whittaker,

1993).

(f ) Applications

We have demonstrated the utility of hEMBL3cosW for

the detailed analysis of large regions of genomic DNA

by using it in the construction of a detailed physical map

of a 386-kb region of the human dystrophin gene. To do

this, total DNA from a yeast strain carrying a 386-kb

YAC from the dystrophin gene was subcloned into

EMBL3cosW. Phage containing human DNA inserts

were then ordered into an overlapping set by hybridisa-

tion of end-specific riboprobes from individual clones

back to plaque lifts of gridded phage clones (Whittaker

et al., 1993b). Thirty-five clones comprising the minimum

overlapping set were then restriction mapped with

Hind111 and EcoRI using the cos-labelling strategy

(Wood and Whittaker, 1993).

(g) Conclusions

(1) We have constructed a phage h replacement vector,

hEMBL3cosW, with features which expedite the cloning

and analysis of large contiguous pieces of DNA, such as

would be encountered in the analysis of large genes, or

the search for genes implicated in disease by positional

cloning.

(2) The vector has been extensively used by us and

shown to be effective in the detailed mapping of a 386-kb

region of the human dystrophin gene (Wood and

Whittaker, 1993). Such maps provide not only positional

information, but allow access to DNA sequences in a

form that can be used for standard molecular investiga-

tions (e.g., probe isolation, gene identification, or

sequencing).

(3) Although phage contigs could theoretically be con-

structed using conventional chromosome walking tech-

niques, the parallel nature of the YAC subclone approach

(Whittaker et al., 1993a,b) makes it superior to the serial

walking process for the detailed analysis of large regions

of DNA.

(4) In addition to aiding restriction mapping of cloned

inserts, the presence of a Not1 site in the RH cassette

allows the cloning of the ends of large, gel-purified Not1

fragments after partial digestion with Mb01 or Sau3AI.

Such end-clones provide indirect end-labelling probes for

partial-digest mapping of large DNA fragments using

PFGE (Poustka et al., 1986), as well as providing entry

points for chromosome walking or jumping (Michiels

et al., 1987).

ACKNOWLEDGEMENTS

This work was supported by the Medical Research

Council as part of the UK Human Genome Mapping

Project. Financial support from the Nuffield Foundation

and Southampton University Research Fund is also

gratefully acknowledged. We thank Amersham

International Plc. for providing the oligo cassettes.

REFERENCES

Altenbuchner, J.: A new hRES vector with a built-in Tnl7?1-encoded

excision system. Gene 123 (1993) 63368.

Bsvre, K. and Szybalski, W.: Patterns of convergent and overlapping

transcription within the b2 region of coliphage h. Virology 38

(1969) 614-626.

Christie, G.E., Farnham, P.J. and Platt, T.: Synthetic sites for transcrip-

tion termination and a functional comparison with tryptophan

operon termination sites in vitro. Proc. Natl. Acad. Sci. USA 78

(1981) 4180-4184.

Drmanac, R., Petrovic, N.. GliSin, V. and Crkvenjakov, R.: A calculation

of fragment lengths obtainable from human DNA with 78 restriction

enzymes: an aid for cloning and mapping. Nucleic Acids Res. 14

(1986) 4691-4692.

Dunn, J.J. and Studier. F.W.: Complete nucleotide sequence of bacterio-

phage T7 DNA and the locations of T7 genetic elements, J. Mol.

Biol. 166 (1983) 4777535.

Frischauf, A.-M., Lehrach, H., Poustka, A. and Murray, N.E.: Lambda

replacement vector carrying polylinker sequences. J. Mol. Biol. 170

(1983) 8277842.

Frischauf, A.-M., Murray, N. and Lehrach, H.: h phage vectors-EMBL

series. Methods Enzymol. 153 ( 1987) IO33 I 15.

Gibson, T.J., Cot&on, A.R., Sulston, J.E. and Little, P.F.R.: Lorist 2, a

cosmid with transcriptional terminators insulating vector genes

from interference by promoters within the insert: effect on DNA

yield and cloned insert frequency. Gene 53 (1987) 2755281.

Kohara. Y., Akiyama, K. and Isono, K.: The physical map of the whole

E. co/i chromosome: application of a new strategy for rapid analysis

and sorting of a large genomic library. Cell 50 ( 1987) 4955508.

Kunkel, L.M., Monaco, A.P., Middlesworth, W.. Ochs. H.D. and Latt,

S.A.: Specific cloning of DNA fragments absent from the DNA of

a male patient with an X chromosomal deletion. Proc. Natl. Acad.

Sci. USA 82 (1985) 477884782.

Lathe, R., Vilotte, J.L. and Clark, A.J.: Plasmid and bacteriophage

vectors for excision of intact inserts. Gene 57 (1987) 1933201.

Lindsay, S. and Bird, A.P.: Use of restriction enzymes to detect potential

gene sequences in mammalian DNA. Nature 327 (1987) 336-338.

Manfioletti. G. and Schneider, C.: A new and fast method for preparing

high quality lambda DNA suitable for sequencing. Nucleic Acids

Res. 16 (1988) 287332884.

Melton, D.A., Krieg, P.A., Rebagliati, M.R., Maniatis, T., Zinn, K. and

Green, M.R.: Efficient in vitro synthesis of biologically active RNA

and RNA hybridisation probes from plasmids containing a bacterio-

phage SP6 promoter. Nucleic Acids Res. 12 ( 1984) 703557056.

Michiels, F., Burmeister, M. and Lehrach, H.: Derivation of clones close

to met by preparative field inversion gel electrophoresis. Science 236

(1987)1305-1308.

Poustka, A., Pohl, T., Barlow. D.P., Zehetner. G., Craig, A., Michiels,

F., Ehrich, E.. Frischauf, A.-M. and Lehrach, H.: Molecular

approaches to mammalian genetics. Cold Spring Harbor Symp.

Quant. Biol. 51 (1986) 131-139.

Rackwitz. H.-R.. Zehetner, G., Frischauf. A.-M. and Lehrach, H.: Rapid

232

restriction mapping of DNA cloned in lambda phage vectors. Gene

30 ( 1984) 1955200.

Sambrook, J.. Fritsch, E.F. and Maniatis, T.: Molecular Cloning. A

Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold

Spring Harbor, NY, 1989.

Smith, G.E. and Summers, M.D.: The bidirectional transfer of DNA

and RNA to nitrocellulose or diabenzyloxymethyl-paper. Anal.

Biochem. IO9 ( 1980) I 23.m 129.

Ward, D.F. and Murray. N.E.: Convergent transcription in bacterio-

phage h: interference with gene expression. J. Mol. Biol. 133

( 1979) 2499266.

Whittaker. P.A.: Chromosome walking technology: a central method

for identification of disease genes. Clin. Biotech. 3 ( 1991) 67779.

Whittaker. P.A.: Storage of unamplified phage libraries on nylon filters.

Methods Enrymol. 218 (1993) 627-636.

Whittaker, P.A., Campbell, A.J.B., Southern. E.M. and Murray. N.E.:

Enhanced recovery and restriction mapping of DNA sequences

cloned in a new h vector. Nucleic Acids Res. 16 (198X) 672556736.

Whittaker, P.A., Mathrubutham, M. and Wood, L.: Construction of

phage sublibraries from nanogram quantities of YAC DNA purified

by preparative PFGE. Trends Genet. 9 (1993a) 1955196.

Whittaker, P.A.. Wood. L.. Mathrubutham, M. and Anand, R.:

Generation of ordered phage sublibraries of YAC clones: construc-

tion of a 400kb phage contig in the human dystrophin gene.

Genomics 15 ( 1993b) 4533456.

Wood, L. and Whittaker, P.A.: Rapid restriction mapping of 386 kb of

genomic DNA in the human dystrophin gene using an ordered

phage sublibrary of a YAC clone containing the region. Gene ( 1994)

23 1~~235.

Young, R.A.: Transcription termination in the Esckrric~hitr c,oli ribo-

somal operon ~rrzC. J. Biol. Chem 254 (1979) 12725512731.

Zabarovsky, E.R. and Allikmets. R.L.: An improved method for the

construction of gene libraries by partial filling-in of cohesive ends.

Gene 42 (1986) 119-123.