ORIGINAL PAPER

Co-suppression of synthesis of major a-kafirin sub-class togetherwith c-kafirin-1 and c-kafirin-2 required for substantiallyimproved protein digestibility in transgenic sorghum

Andile W. Grootboom • Nompumelelo L. Mkhonza • Zodwa Mbambo •

Martha M. O’Kennedy • Laura S. da Silva • Janet Taylor •

John R. N. Taylor • Rachel Chikwamba • Luke Mehlo

Received: 8 October 2013 / Revised: 4 December 2013 / Accepted: 18 December 2013 / Published online: 19 January 2014

� Springer-Verlag Berlin Heidelberg 2014

Abstract

Key message Co-suppressing major kafirin sub-classes

is fundamental to improved protein digestibility and

nutritional value of sorghum. The improvement is

linked to an irregularly invaginated phenotype of pro-

tein bodies.

Abstract The combined suppression of only two genes, ckafirin-1 (25 kDa) and c-kafirin-2 (50 kDa), significantly

increases sorghum kafirin in vitro digestibility. Co-sup-

pression of a third gene, a-kafirin A1 (25 kDa), in addition

to the two genes increases the digestibility further. The

high-digestibility trait has previously only been obtained

either through the co-suppression of six kafirin genes

(a-A1, 25 kDa; a-B1, 19 kDa; a-B2, 22 kDa; c-kaf1,

27 kDa; c-kaf 2, 50 kDa; and d-kaf 2, 18 kDa) or through

random chemical-induced mutations (for example, the high

protein digestibility mutant). We present further evidence

that suppressing just three of these genes alters kafirin

protein cross-linking and protein body microstructure to an

irregularly invaginated phenotype. The irregular invagin-

ations are consistent with high pepsin enzyme accessibility

and hence high digestibility. The approach we adopted

towards increasing sorghum protein digestibility appears to

be an effective tool in improving the status of sorghum as a

principal supplier of energy and protein in poor commu-

nities residing in marginal agro-ecological zones of Africa.

Keywords Sorghum � Biofortified � Transgenic � Protein

bodies � Protein digestibility � Gamma-kafirin

Introduction

Sorghum is a key C4 (carbon 4 photosynthesis) plant and is

endowed with many attractive attributes of C4s including

high photosynthetic efficiency, high water and nitrogen use

efficiency, and significant tolerance to biotic and abiotic

stresses (Ishimaru et al. 1997; Matsuoka et al. 2001).

Sorghum is a primary source of energy and nutrients for

many millions of people in marginal agricultural parts of

the semi-arid tropics of Africa, where other cereals have

inferior productivity (ICRISAT 2011; ICRISAT and FAO

1996). Unfortunately, sorghum has some nutritional limi-

tations; specifically, it is deficient in the essential amino

acid lysine and its protein has lower wet-cooked digest-

ibility when compared to other cereals. Comparative

studies have revealed the following in vitro digestibility

values for important cereals when cooked: 60 % white tan-

plant sorghum, 86 % wheat, 85 % maize, and 84 % rice

(Mertz et al. 1984). The question of what is the exact cause

of sorghum low protein digestibility has never been

answered satisfactorily because there are many factors that

play a significant role. Secondary metabolites such as

Communicated by L. Jouanin.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00299-013-1556-5) contains supplementarymaterial, which is available to authorized users.

A. W. Grootboom � N. L. Mkhonza � Z. Mbambo �M. M. O’Kennedy � R. Chikwamba � L. Mehlo (&)

CSIR/BioSciences, Meiring Naude Road, Brummeria,

Pretoria 0001, South Africa

e-mail: lmehlo@csir.co.za

L. S. da Silva � J. Taylor � J. R. N. Taylor

Department of Food Science, University of Pretoria, Private Bag

X20, Hatfield 0028, South Africa

L. S. da Silva

Department of Biotechnology and Food Technology, Tshwane

University of Technology, Pretoria 0001, South Africa

123

Plant Cell Rep (2014) 33:521–537

DOI 10.1007/s00299-013-1556-5

tannins are rich in phenolic hydroxyl groups and therefore

form complex with proteins (Butler et al. 1984). This

makes them inaccessible to digestive enzymes. It is clear

that other factors besides tannins are influential because

low digestibility in sorghum proteins is still prevalent even

amongst tannin-free sorghums (Elkin et al. 1996). Much

evidence, however, suggests that the nature and arrange-

ment of kafirin storage proteins may be a major determi-

nant of protein digestibility. The a-, b- and c-kafirins make

up about 70–80 % of total endosperm protein (Hamaker

et al. 1995), and out of this combined value, the a-sub-class

alone comprises about 80 % of total kafirin endosperm

proteins (Shewry 2002). The a-kafirins are majorly located

at the centre of protein bodies, whereas the b- and c-kafi-

rins are concentrated at the periphery of the protein body

(Hamaker et al. 1995; Oria et al. 1995b; Shull et al. 1992;

Watterson et al. 1993).

The widely accepted theory suggests that poor digest-

ibility of the abundant and easily digestible (when isolated)

a-kafirins is a result of their interior location and the fact

they are surrounded by a kafirin protein complex of

disulphide-bonded c- and b-kafirins (Duodu et al. 2003;

Oria et al. 1995a; Rom et al. 1992). Important support for

this theory is the observation that a unique microstructure

of mutant sorghum protein bodies (derived from the

chemically induced opaque O-721 mutant), which are

characterized by irregularity and invagination, is consis-

tently correlated with the high protein digestibility of this

mutant (Oria et al. 2000). This probably is because of

increased protein body surface area which favours easy

accessibility to proteolytic enzymes. Significantly, in the

high protein digestibility mutant (Oria et al. 2000) and in

the original O-721 mutant (Sastry et al. 1986), the pro-

portions of the kafirin sub-classes appear to be normal, but

the c-kafirin sub-class is located at the base of the folds in

the invaginated protein bodies of the high-digestibility

mutant (Oria et al. 2000).

Efforts such as the African Biofortified Sorghum project

(ABS) aimed at improving the protein quality of sorghum

have been described (Lipkie et al. 2013; Zhao 2007). The

approach involved techniques such as the suppression of

the synthesis of the c-kafirin sub-class by the application of

RNAi technology (Shewry 2007). The transgenic lines

emanating from the ABS project had substantially

increased lysine content and improved in vitro digestibility

(Henley et al. 2010). A further examination of the

improved transgenic sorghum lines that were designed to

have various combinations of suppression of kafirin sub-

classes revealed that co-suppression of several kafirin sub-

classes was required to obtain high protein nutritional

quality in sorghum, but this seemed to result in a floury

type grain endosperm texture (Da Silva et al. 2011b). It was

further demonstrated that in transgenic sorghum designed

to have a wide range of kafirin sub-class suppression,

kafirin disulphide-bonded cross-linking was considerably

reduced and this seemed to improve protein digestibility

(Da Silva et al. 2011a). However, in both papers the work

was based on supposition as no direct evidence of specific

kafirin sub-class suppression was reported.

In the present study, we provide conclusive proof that

the combined suppression of two gamma-kafirins signifi-

cantly improves in vitro digestibility and that to obtain

further improvements in digestibility, a third gene (a-

kafirin) should also be co-suppressed. We further provide

evidence that the additional increase in protein digestibility

when the a-kafirin is suppressed probably results from

alterations in protein body ultrastructure.

Materials and methods

Transformation

Immature zygotic embryos isolated about 12 days post-

pollination from the sorghum public line P898012 (origi-

nally from Purdue University) were used for all transfor-

mations. P898012 is a purple plant, type II tannin sorghum.

Donor plants were grown in pots in the greenhouse in a soil

mix consisting of red soil, rough sand and compost in a

ratio of 1:1:1. Plants were watered three times per week

with a soluble fertilizer called Hortichem (Ocean Agri-

culture) with a nitrogen, phosphorus and potassium ratio of

3:1:5, respectively.

Two RNAi minimal cassette plasmid DNA constructs

designated as pABS042 and pABS044 were used for

transforming the sorghum embryos. These constructs were

obtained from Pioneer Hi-Bred International (Johnston,

Iowa, USA) and are outlined in a schematic way in Fig. 1.

The pABS042 construct was designed to co-suppress the

synthesis of the following sorghum kafirin grain storage

protein species: d-kafirin 2 (18 kDa), c-kafirin 1 (25 kDa)

and c-kafirin 2 (50 kDa). In addition to the kafirins, this

construct was also designed to suppress the synthesis of an

enzyme involved in lysine catabolism called lysine a-

ketoglutarate reductase (LKR). The pABS044 construct

was aimed at the combined suppression of all the kafirin

sub-classes in pABS042 combined with an additional

25 kDa a-kafirin-A1 sub-class (d-kafirin 2, c-kafirin 1, c-

kafirin 2, and a-kafirin-A1). Similar to pABS042, the

enzyme LKR was also targeted for suppression in

pABS044. Each of the constructs pABS042 and pABS044

was co-bombarded into sorghum immature embryos with a

minimal plasmid cassette encoding for mannose selection

as previously reported (O’Kennedy et al. 2004a). All

plasmid DNA preparations were carried out using the

Qiagen Maxiprep Kit (Qiagen) according to the

522 Plant Cell Rep (2014) 33:521–537

123

manufacturer’s recommendations. Minimal transgene

expression cassettes were used for transformation follow-

ing restriction enzyme digestion of parent plasmids with

EcoRI to remove the backbone carrying the kanamycin

resistance gene (Fig. 1).

Explants were prepared and transformed essentially

according to previously described methods (Grootboom

et al. 2010). Briefly, immature zygotic embryos were pre-

cultured for 3–4 days in the dark on callus initiation

medium [CIM; medium J as previously described

(O’Kennedy et al. 2004b)] and then placed on CIM con-

taining 0.2 M D-sorbitol and 0.2 M D-mannitol as osmoti-

cum, for 3–4 h, as previously described (Vain et al. 1993).

Bombardment mixtures were prepared by DNA precipita-

tion on 0.6 lm gold particles with 2.5 M CaCl2 and 0.1 M

spermidine-free base (Vain et al. 1993). Following bom-

bardment with 40 ng linearized plasmid DNA, the embryos

were incubated on this medium for 16 h, followed by

7 days on osmoticum-free CIM. Selection and regeneration

of transgenic plants were carried out as previously descri-

bed (O’Kennedy et al. 2004b).

DNA extraction and Southern hybridization analysis

Genomic DNA was extracted from putative transgenic

sorghum leaf material using a mini-extraction procedure

(Dellaporta et al. 1983). The DNA was then resolved in a

0.8 % agarose gel, transferred to a nylon membrane and

probed with a DIG labelled DNA fragment spanning the

zein promoter and a-kafirin (44zk) and also the d- and c-

kafirin coding sequences (42cr). Southern hybridization

was carried out as previously described (O’Kennedy et al.

2004a). The 42cr probe was prepared using the following

primers: forward 50-GTTACGTGACCCGGACCGAA-30

and reverse 50-ACGCCGAAGATCGCCTGGTA-30. The

44zk probe was prepared using the following primers:

forward 50 GCTTGCTGCGATTGCCTGTT 30 as well as

reverse primer 50-CGGTGGGGATCGAGTGATTC-30.

Protein extraction from whole seeds

Ten mature dry T1 seeds from each transgenic event were

halved, and the halves were ground to a fine meal using a

mortar and pestle. As the T1 population was segregating, it

was expected that it would do so at a ratio of 3:1 (trans-

genic vs. non-transgenic) assuming that each of the genes

was heterogeneously integrated into one locus for each

genome. Each grain was sectioned longitudinally into half,

with one half retained for endosperm structure studies and

the other half for protein analysis. Endosperm texture,

defined here as the proportion of corneous endosperm

relative to floury endosperm in the grain, was determined

by viewing the longitudinal sections of half kernels under a

stereomicroscope and comparing them to sorghum

δ-kaf2 γ-kaf1 γ-kaf2 LKR

ADH1 Intron

δ-kaf2γ-kaf1γ-kaf2LKR Maize 19 kDaAlpha B1 zein promoter

EcoRI EcoRINdeI

δ-kaf2 γ-kaf1 γ-kaf2 LKR

ADH1 Intron

δ-kaf2γ-kaf1γ-kaf2LKR Maize 19 kDaAlpha B1 zein promoter

EcoRI EcoRINdeIα-kafA1 α-kafA1

a

b

Fig. 1 Plasmids used for transformation. a Plasmid pABS042.

b Plasmid pABS044. Both plasmids were digested with EcoRI and

gel purified to yield minimal transgene cassettes used for transfor-

mation. NdeI cuts once in each construct and the site is within the

maize 19-kDa Alpha B1 zein promoter. The NdeI site was used for

distinguishing independent transformation events through Southern

blot analysis. The main difference between pABS042 and pABS044

is that pABS044 is intended to silence the a-kaf-A1 subspecies in

addition to the kafirin subspecies indicated in pABS042. The two

plasmids were supplied by Pioneer Hi-Bred International

Plant Cell Rep (2014) 33:521–537 523

123

standards (ICC 2008). Use of SDS-PAGE analysis com-

bined with Western blot hybridization with cross-reacting

antibodies for each of the targeted proteins (d-kaf 2; c-kaf

1; c-kaf 2; a-kaf-A1) allowed the non-ambiguous identi-

fication of transgenic sorghum seeds and negative segre-

gants. To ensure that almost identical amounts of total

protein were analysed, 10 mg of each ground meal was

weighed separately and placed into 1.5 ml microfuge

tubes. Four hundred microlitres of a reducing total protein

extraction buffer (100 mM DTT; 2 % SDS; 60 mM Tris,

pH 6.8) was then added to each tube. The mixture was

vortexed briefly and the tubes were incubated at 100 �C for

8 min with intermittent vortexing. The mixture was cen-

trifuged at 14,000 rpm for 10 min at room temperature,

and the supernatant was collected and transferred into a

clean microfuge tube. Total protein concentration was

determined by the Bradford assay (Bradford 1976), using

bovine serum albumin (BSA) as the protein standard (Bio-

Rad). The BSA concentration range chosen for the standard

curve was 0, 1, 3, 5, 10, and 20 ng/ll protein.

RT-PCR assay for LKR

LKR suppression was only tested through reverse trans-

criptase PCR (RT-PCR) because currently there is no

monoclonal antibody specific for the LKR protein. Total

seed RNA was isolated at about 15 days post-anthesis

using Sigma-Aldrich (USA) total RNA extraction kit as per

manufacturer’s instructions. First-strand cDNA synthesis

was carried out from 1 lg total RNA using the manufac-

turer’s recommendations (cDNA synthesis kit, Roche-

South Africa). PCR methods were then carried out in 50 ll

reaction volumes using the following LKR-specific prim-

ers: forward 50-ACCGCATTCTGACAGGTCTTCTGA-30

and reverse 50-GGGCAATGGAGTTGTTGGAATTCT-30.Cycling conditions included an initial denaturation at

94 �C for 2 min, followed by 25 cycles consisting of

denaturation at 94 �C for 45 s, annealing at 64.6 �C for

30 s and extension at 72 �C for 45 s. The final extension

was for 3 min at 72 �C.

SDS-PAGE analysis

Ten micrograms of sample protein from each transgenic

line was resolved by SDS-PAGE. Electrophoresis was

performed using pre-cast 12 % Bis–Tris Bio-Rad Criterion

gel system (Bio-Rad). Briefly, protein extracts were pre-

mixed at a dilution of 4:1 with 49 sample loading buffer

containing dithiothreitol (DTT) (200 mM Tris–HCl, pH

6.8; 400 mM DTT; 8 % (w/v) SDS; 0.5 % (w/v) bromo-

phenol blue; 50 % glycerol). The samples were incubated

at 100 �C for 1 min before loading the gels. The voltage

was set at 120 V for 90 min and separation was monitored

using a pre-stained protein size marker (PageRulerTM

Prestained Protein Ladder, Fermentas). Visualization of

resolved protein bands was carried out after Coomassie

brilliant blue staining (0.2 % Coomassie stain, 45:45:10;

methanol:water:acetic acid) for 1 h, followed by destaining

in methanol:water and acetic acid combined in a ratio of,

45:45:10, respectively. Unless stated, the wild-type

P898012 or the null segregants of the transgenic plants

were used as reference controls.

Western blot analysis

Following separation and visualization of proteins by SDS-

PAGE, the semi-dry HoeferTM TE 77 transfer unit (Amer-

sham BioSciences) was used to transfer the resolved protein

bands onto the 0.45 lm pore size PVDF membranes (Sigma-

Aldrich). The PVDF membranes were pre-equilibrated in

99.9 % methanol for 5 min and re-suspended in Towbin’s

transfer buffer (25 mM Trizma-Base, pH 8.3; 192 mM

glycine; 20 % (v/v) methanol) for 5 min. The acrylamide gel

was also pre-equilibrated in Towbin’s transfer buffer for

15 min. The gel-membrane sandwich and current settings

were performed according to the manufacturer’s recom-

mendations (Bio-Rad). Membrane blocking was performed

for 1 h in blocking buffer (20 mM Tris, pH 7.5; 150 mM

NaCl; 0.05 % Tween 20; 3 % fat-free milk powder). Cross-

reacting antibodies directed against maize zein storage pro-

teins were used to probe their equivalent counterparts in

sorghum (25 kDa c kafirin-1, 50 kDa c-kafirin-2, 18 kDa d-

kafirin, and 25 kDa a-kafirin A1). Cross-reactivity was

previously demonstrated at Pioneer Hi-Bred International

(data not shown). All antibodies were used at a dilution of

1:10,000. Unbound antibodies were washed-off from the

membranes three times (10 min each wash) with TBST

buffer (20 mM Tris, pH 7.5; 150 mM NaCl; 0.05 % Tween

20) with constant shaking at 180–250 rpm. The membranes

were incubated for 1 h at room temperature with a 1:10,000

diluted secondary antibody (anti-rabbit conjugated horse-

radish peroxidase; Sigma-Aldrich). The membranes were

then washed three times for 10 min with TBST buffer. All

the steps were performed at room temperature. For protein

detection, the ECL PlusTM Western blotting system (Amer-

sham) was used according to the manufacturer’s instructions

to detect target antibody cross-reactions with targeted kafi-

rins. This was followed by autoradiography using the

‘‘8 9 10’’ BioMax MR Film (Kodak).

Transgenic trait: endosperm phenotype linkage and T1

Mendelian segregation

SDS-PAGE analysis of suppressed proteins, Western blot

analysis and seed endosperm texture of transgenic sorghum

were used to determine the correlation between the

524 Plant Cell Rep (2014) 33:521–537

123

transgenic trait suppression using RNAi constructs and the

endosperm structure. Sectioned seeds were independently

scored for endosperm phenotype in two categories, i.e.

‘corneous’ vs. ‘floury’ endosperm texture. Ten seeds per

independent event, and from the same panicle, were inde-

pendently genotyped for the presence or absence of the

transgenic trait (suppression of target kafirin protein sub-

classes) as revealed by SDS-PAGE analysis. Western blot

analysis of the same protein extracts was performed to

confirm the identity of kafirin proteins suppressed as pre-

dicted from the constructs used. Known quantities of pro-

tein were loaded onto SDS-PAGE. A G:BOX gel

documentation system (Syngene) was used to capture

images of multiple replicates of the gels of each indepen-

dent transgenic line. In order to measure the extent of kafirin

suppression, intensities of specific bands (densitometry)

corresponding to gamma-kafirins were determined using

Gene Tools software (Syngene). Flouriness was determined

using a scheme devised by Rooney and Miller (1982) in

which one (1) represents corneous, three (3), intermediate

and five (5), floury endosperm. A statistical correlation

between the seed flouriness and extent of transgenic protein

suppression was then performed for seeds of both transgenic

events of pABS042 and pABS044. A Chi-square test, at a

5 % level, was also used to determine whether there was

any deviation from the expected T1 3:1 Mendelian segre-

gation ratio of transgenic to non-transgenic seeds. Whole T1

seeds were further screened for any possible abnormalities

as a result of the tissue culture stress by comparison to wild-

type seeds that had been subjected to the same tissue culture

and bombardment stress. Ten randomly chosen seeds per

event, from the same panicle, were weighed and compared

to wild-type P898012 seeds that had been regenerated on

the same medium, but lacking mannose selection.

Grain materials used for physical and chemical

characterization

Two groups of sorghums were analysed (Table 1): (1)

Transgenic sorghums and their null controls from cultivar

P898012 (a white type II tannin sorghum)—independent

transgenic events generated from constructs pABS042, and

pABS044) (Fig. 1), a null segregant P898012 control sample

(NS), and two parent types; and (2) Non-transgenic sorgh-

ums all white non-tannin tan-pant types—seven high protein

digestibility mutant lines (HPDM 1–7), either original lines

as described by Oria et al. (2000) or crosses between HPDM

and normal lines (all obtained from Texas A&M University);

five normal protein digestibility (NPD), either parent or

progeny lines (NPD 1–5); plus Macia, a popular improved

sorghum variety cultivated and used for food preparation in

southern Africa.

Table 1 Transgenic, high protein digestibility mutant and normal

sorghum lines studied

Sorghum lines Project

code

Sample

type

Source

Transgenic (type II tannin)

ABS042 (AGNM 42-2B) ABS042-1 H/CG Pretoria

(2007)a

ABS042 (AGNM 42-5C) ABS042-2 H/CG Pretoria

(2007)a

ABS042 (AGNM 42-6A) ABS042-2 H/CG Pretoria

(2007)a

ABS042 (AGNM 42-9B) ABS042-2 H/CG Pretoria

(2007)a

ABS044 (AGNM 44-1A) ABS044-1 H/CG Pretoria

(2007)a

ABS044 (AGNM 44-2G) ABS044-2 H/CG Pretoria

(2007)a

ABS044 (AGNM 44-3A) ABS044-3 H/CG Pretoria

(2007)a

Controls (type II tannin)

P898012 (null control tissue

culture)

P898012-

TC

H/CG Pretoria

(2007)a

P898012 (parent) P898012-

H/CG

H/CG Pretoria

(2007)a

P898012 (parent) P898012-

Bulk

Bulk

(WCG)

Johnston,

Iowa

(2007)b

High protein digestibility mutants (HPDM) (non-tannin)

HD parent PI851171 WES HPDM1 Bulk

(WG)

Weslaco,

Texas

(2006)c

HD parent PI850029 WES HPDM2 Bulk

(WG)

Weslaco,

Texas

(2006)c

HD parent PI851171 LUB HPDM3 Bulk

(WG)

Lubbock,

Texas

(2006)c

HD progeny 04CS11248-1

XTX436 WES

HPDM4 Bulk

(WG)

Weslaco,

Texas

(2006)c

HD progeny 04CS112278 X

851171/96GCP0124 WES

HPDM5 Bulk

(WG)

Weslaco,

Texas

(2006)c

HD progeny 04CS11186-1

X 850029/TX635 WES

HPDM6 Bulk

(WG)

Weslaco,

Texas

(2006)c

HD progeny 04CS11278 X

851171 and 96GCPO124

LUB

HPDM7 Bulk

(WG)

Lubbock,

Texas

(2006)c

Normal protein digestibility (NPD) (non-tannin)

LD parent 96GCPOB124

WES

NPD1 Bulk

(WG)

Weslaco,

Texas

(2006)c

LD parent BTX436 WES NPD2 Bulk

(WG)

Weslaco,

Texas

(2006)c

Plant Cell Rep (2014) 33:521–537 525

123

As indicated in Table 1, samples were received as

10–15 single half or crushed kernels, or a bulk samples

(3–15 kg), which were received as whole grains, or whole

crushed grains. For chemical analyses, whole or crushed

bulk samples were milled into flour using a hammer mill

fitted with a 500-lm opening screen. Small samples were

milled by hand using a mortar and pestle. All samples were

stored ±8 �C until use.

Physical characterization

Endosperm texture

To characterize endosperm texture, longitudinal sections of

20 half kernels were viewed under a stereomicroscope,

followed by comparison to sorghum standards (ICC 2008).

Due to the small sample size of the transgenic lines ana-

lysed, all half kernels obtained were viewed (±6 kernels).

Light micrographs were taken using a stereomicroscope

(Nikon Optiphot) fitted with a digital camera.

Transmission electron microscopy

For transmission electron microscopy (TEM), grains were

sectioned longitudinally using a sharp scalpel. The pericarp

was scraped from the top of the kernel directly opposite to the

germ, leaving the sub-pericarp and aleurone layers intact. In

brief, the preparation procedure involved taking small sec-

tions (1–2 mm thick) of cleaned peripheral endosperm using

a sharp scalpel. Specimens were fixed as described by Da

Silva et al. (2011b), in glutaraldehyde (2.5 %) in pH 7.4,

0.075 M phosphate buffer for 18 h before staining with

0.5 % aqueous osmium tetroxide for 2 h. The specimens

were then dehydrated in a graded aqueous acetone series

before infiltration with Quetol resin. Ultrathin sections were

cut with an ultra-microtome fitted with a diamond knife.

Sections were stained with aqueous uranyl acetate and then

further stained in Reynold’s lead citrate. Sections were

examined either with a Phillips EM301 or Phillips CM10

TEM (Eindhoven, the Netherlands).

Chemical characterization

Tannin content

Condensed tannin content was determined on all bulk

sorghum samples using the modified Vanillin HCl assay

(1 % conc. HCl in methanol extraction) according to

Maxson and Rooney (1972), with subtraction of sample

blanks. Tannin content was then expressed as catechin

equivalents. Total protein content (N 9 6.25) was deter-

mined by Dumas combustion, according to AACC standard

method 46–30 (AACC International 2000). Moisture con-

tent was determined by air oven drying using AACC

standard method 44–15A (AACC International 2000). For

small samples, 10 % moisture content was assumed. All

analyses were expressed on a dry weight basis.

Lysine determination

Lysine was determined on defatted samples using the Pico-

Tag method (Bidlingmeyer et al. 1984), with reversed-

phase high-performance liquid chromatography.

In vitro protein digestibility

In vitro protein digestibility (IVPD) was determined on whole

grain flour under wet-cooked conditions, using either 200 mg

or 20 mg flour scale using the pepsin digestibility method of

Hamaker et al. (1986), suitably modified for small-scale

assays. Briefly, the method involved incubating the flour with

pepsin at pH, 37 �C for 2 h. Protein digestibility was then

defined as the percentage N solubilised under the conditions of

the assay relative to flour total N. This was measured in terms

of insoluble residue by the above Dumas method.

Results

Suppression of c- and a-kafirin sub-classes

Several P898012 sorghum transgenic events were recov-

ered following particle bombardment transformation with

the constructs pABS042 designed to suppress the kafirin

Table 1 continued

Sorghum lines Project

code

Sample

type

Source

LD parent TX635 WES NPD3 Bulk

(WG)

Weslaco,

Texas

(2006)c

LD parent 96GCPOB124

LUB

NPD4 Bulk

(WG)

Lubbock,

Texas

(2006)c

LD progeny 04CS11199-1

X 850029/TX635 WES

NPD5 Bulk

(WG)

Weslaco,

Texas

(2006)c

Macia Macia Bulk

(WG)

Botswana

(2004)

H/CG half/crushed grain, WCG whole crushed grain, WG whole graina CSIR Biosciences, Pretoria, South Africab Pioneer Hi-Bred, Des Moines, Iowa, USAc Texas A&M University, College Station, Texas, USA

526 Plant Cell Rep (2014) 33:521–537

123

storage proteins d-kafirin 2, c-kafirin 1, c-kafirin 2 and the

catabolic enzyme lysine a-ketoglutarate reductase (LKR),

and pABS044 designed to suppress a-kafirin-A1 in addi-

tion to the suppression of the kafirin sub-classes in

pABS042. The pABS042 construct was similar in design to

that used to produce ABS 149 (Da Silva et al. 2011b).

However, this study looked at a similar construct individ-

ually and in combination with the suppression of the alpha

A1 kafirin sub-classes in events generated by particle

bombardment in a different sorghum type background.

Recovery of transgenic events was achieved at a transfor-

mation efficiency that varied between 2 and 5 %. Eight

independent transgenic events from each of the constructs

pABS042 and pABS044 were initially screened using

SDS-PAGE to ascertain the extent to which each construct

influenced the targeted kafirin sub-classes suppression. As

shown in Fig. 2, construct pABS042 was able to suppress

the c-kaf sub-classes (Fig. 2a), whereas pABS044 suc-

ceeded in suppressing both the c-kaf and the a-kaf sub-

classes (Fig. 2b), and this was confirmed further via

Western blot analysis in subsequent experiments. Further

verification of stable integration of each of the constructs

was carried out by Southern hybridization analysis of

genomic DNA extracted from each putative T0 transgenic

event following digestion with NdeI, a unique restriction

site within each construct. Independent events were

therefore distinguished from each other on the basis of the

occurrence of different integration patterns. Seeds from

transgenic progeny were also able to germinate on man-

nose-containing medium as previously described (O’Ken-

nedy et al. 2004a).

From the eight independent transgenic events containing

the pABS042 construct, four independent transgenic events

were chosen for further analysis. Three independent

transgenic events bearing the construct pABS044 were also

selected for further evaluation. These transgenic lines were

chosen on the basis that they exhibited complete suppres-

sion of the c-kafirin proteins (pABS042) and the combined

M W NS1 NS2 WpABS042 TRANSGENIC EVENTS

M W NS1 NS2 W pABS044 TRANSGENIC EVENTS

a

b

26 kDa

34 kDa

26 kDa

34 kDa

1 2 3 4 5 6 7 8

1 2 3 4 5 6 7 8

Fig. 2 SDS-PAGE analysis of kafirin storage proteins of transgenic

sorghum events with specific kafirin sub-classes targeted for

suppression. Protein profiles of eight independent events generated

from the pABS042 construct are shown in a, whereas eight

independent events generated from the pABS044 construct are also

shown in b. M 26 and 34 kDa bands of the protein molecular weight

marker, SM1841 from Fermentas Life Sciences. W protein profile of

wild-type (untransformed) P898012 sorghum seed total protein. NS1

and NS2 protein profiles of total seed protein of two independent null

segregants of transgenic events. The thick black arrow indicates the

relative apparent molecular weight position (about 26 kDa) of protein

bands identified as suppressed based on comparisons with the wild-

type and null segregant controls

Plant Cell Rep (2014) 33:521–537 527

123

complete suppression of c-kafirin and a-kafirin A1 protein

sub-class (pABS044) as confirmed by Western blot ana-

lysis (Fig. 3). In order to assess the impact of suppressing

either the c-kaf subspecies or the combined c-kaf and a-

kaf-A1 subspecies, it was important to choose only those

transgenic events exhibiting complete suppression. Our

observation of the two categories of independent events on

SDS-PAGE (pABS042; pABS044) indicated a range of

suppression encompassing complete-partial suppression

(compare for example, events 1–3 vs. events 6–8 in

Fig. 2b; events 1–3 exhibit complete suppression).

Even though the RT-PCR data for LKR suppression was

inconclusive, it appears that all 16 independent transgenic

events (8 of pABS042 and 8 of pABS044) had LKR

expression (supplementary data). Our inference was there-

fore that since LKR was not suppressed it is unlikely that it

(LKR) had much influence on lysine content, endosperm

microstructure and protein digestibility in transgenic events

of both pABS042 and pABS044. Western blot analysis of

the d-kaf 2 protein in both transgenic and non-transgenic

plants suggested that this protein was not expressed in the

sorghum line P898012. However, the d-kaf 2 gene is present

in the P898012 sorghum genome although not expressed.

This is the case with a limited number of other sorghum

varieties where allelic variations of kafirin genes are

observed (Laidlaw et al. 2010). Similar to LKR, no changes

in lysine, endosperm structure and protein digestibility in

transgenic P898012 events could therefore be directly

attributed to the suppression of d-kaf 2.

Physical and chemical characterization

To assess the effect of suppressing specific sub-classes of

kafirin proteins in sorghum, physical and chemical

M NS M NS M NS M NSEV1 EV2 EV3 EV4

NSNSNS EV2EV1 EV3

NS NS NS NS EV1 EV2 EV3 EV4

NS NS NSEV1 EV2 EV3e

pABS042 events

Typical pABS044 event

26 kDa 17 kDa 10 kDa

50 kDa

50 kDa 25 kDa: Not targeted in pABS042; But targeted in pABS044

a

b

c

d

Fig. 3 Western blot analysis of kafirin protein suppression in

transgenic P898012 sorghum plants generated from constructs

pABS042 and pABS044. a Gamma-kafirin-1 suppression in four

independent events of pABS042. Four replicates (clones) of each

independent event were used. b Gamma-kafirin-1 suppression in three

independent events of pABS044. Four replicates of each independent

event were used. c c-kafirin-2 suppression in four independent events

of pABS042. Each event was replicated four times (clones). d c-

kafirin-2 suppression in three independent events of pABS044. Each

independent event was replicated three times (clones). e Western

analysis of typical non-targeted 25 kDa alpha A1 kafirin protein in

independent events of pABS042 and targeted in a typical alpha A1

protein suppressed independent event of pABS044. As expected, the

alpha A1 protein was completely suppressed only in targeted

pABS044 events and not in pABS042. Total seed proteins of T1

transgenic sorghum seeds were used. EV1, EV2, etc. represent

independent events. NS is null segregant seed protein (control) and

was derived from each respective category of transgenic events

(pABS042 or pABS044)

528 Plant Cell Rep (2014) 33:521–537

123

analyses of the sorghum grains were carried out.

Transgenic sorghum lines (pABS042 and pABS044) all

had floury endosperm textures (Fig. 4a, b). Their normal

sorghum parent (P898012) had intermediate endosperm

texture (Fig. 4f). The HPDM also had floury endosperm

texture (Fig. 4c), but its parent had corneous endosperm

texture, as did Macia (Fig. 4d, e, respectively). Many of

the transgenic grains derived from the constructs

pABS042 and pABS044, and to a lesser extent their

normal parent, P898012, showed a distinct lumen (small

hole) in the centre of the endosperm (Fig. 4, black

arrows).

The floury endosperm texture was observed in trans-

genic seeds obtained from both constructs pABS042 and

pABS044 as explained in Fig. 4. There was variation

amongst transgenic events in the degree of endosperm

flouriness and the extent of gamma-kafirin suppression as

surmised from SDS-PAGE analysis. As such, 20 seeds

from each of the 8 independent transgenic events of

pABS042 and pABS044 were therefore sectioned longi-

tudinally and viewed under a stereomicroscope. The per-

centage of endosperm flouriness was estimated from

comparisons with sorghum standards (ICC 2008). A plot of

percentage flouriness and percentage gamma-kafirin

a b

dc

fe

Fig. 4 Longitudinal cross sections of representative sorghum grains

of the different types. a pABS042, b pABS044, c HPDM Progeny

04CS11248-1 XTX436 WES, d normal protein digestibility parent

BTX436 WES, e Macia, f P898012. Scale bar 2 mm. Black arrow

indicates lumen in centre of endosperm; black dashed arrow indicates

tannin staining, white arrow indicates dark pigmented testa layer

Plant Cell Rep (2014) 33:521–537 529

123

suppression indicated that there was a high probability that

the extent of floury endosperm texture in sorghum was

positively correlated with the extent of gamma-kafirin

suppression (Fig. 5).

All the P898012 lines were type II tannin sorghums

according to previously suggested classifications (Maxson

and Rooney 1972). The parent line showed typical tannin

staining of the corneous endosperm (Fig. 4f, black dashed

arrow). This is due to tannin leaching from the testa layer

and binding to the proteins in the dense peripheral endo-

sperm tissue. Tannin leaching was not visible in the

transgenic sorghum lines with floury endosperm. Never-

theless, a pigmented testa layer was visible between the

pericarp and endosperm layers of these grains (Fig. 4a, b,

white arrows). The tannin content of the parent, P898012,

was 2.77 mg catechin equiv./100 g flour, when extracted

with acidified methanol (Table 2). All the other sorghum

lines were classified as type I (non-tannin) sorghums, as

they contained low levels of phenols and no tannins (0.03

and 0.04 mg catechin equiv./100 g flour for HPDM and

NPD, respectively).

Considering grain protein content, the transgenic

sorghums had similar mean protein contents (12.7 % for

pABS042 and 14.3 % for pABS044) to their controls

(11.7 %) and the HPDM (12.8 %), and to the NPD

sorghums (13.2 %) (see Table 1 for notations, Table 2 for

data).

With regard to grain lysine content, the pABS042 con-

struct did not increase grain protein content of the P898012

line (Table 2). This is in agreement with previous findings

(Da Silva et al. 2011b) using a similar construct ABS049 to

transform TX430, a corneous endosperm sorghum. Due to

very limited sample size, only one pABS044 construct

sample was analysed for protein lysine content. Its protein

lysine content was high (3 %), so also was its protein

content (16 %) (Table 2). Hence, it is not clear whether

this gene construct caused increased protein lysine content.

In contrast, the protein lysine content of the HPDM (mean

2.1 %) was considerably higher than their normal digest-

ibility controls (1.4 %), as was previously reported (Wea-

ver et al. 1998) and thought to be as a result of

compensatory synthesis of lysine-rich non-kafirin proteins

(Guiragossian et al. 1978).

In vitro protein digestibility (IVPD)

The IVPD of the transgenic sorghum containing the

pABS042 gene construct (mean 39.2 %) was significantly

higher than its control (mean 28.5 %) (Table 2). It was

however not different from the mean IVPD of 41.1 % for a

non-tannin sorghum line TX430 transformed with the

similar pABS149 construct (Da Silva et al. 2011b) but was

higher than the 28.5 % cooked protein digestibility of the

TX-430 line with c-kafirin suppression (Kumar et al.

2012). This contrasted with the IVPD of cooked flours

from the transgenic sorghum lines with the pABS044 gene

construct (mean 53.7 %), which was considerably higher

than the control and also higher than the 35–39 % protein

digestibility of the TX430 line with the predicted 29 kDa

a-kafirin suppression (Kumar et al. 2012). Significantly,

the IVPD of pABS044 was similar to that of the HPDM

sorghums (mean 57.7 %). This is despite the fact that the

pABS044 sorghum contained tannins, which are well

known to reduce sorghum protein digestibility (Duodu

et al. 2003). As expected, the HPDM sorghums had sub-

stantially higher IVPD than their normal parent and normal

progeny. However, the IVPD of HPDM was similar to that

of Macia. The cooked IVPD values of the HPDM sorgh-

ums in this present study were much lower than those of

HPDM sorghums reported for decorticated grain (Tesso

et al. 2006; Weaver et al. 1998) (range 72.5–80.8 %),

where some factors inhibiting protein digestion would have

been removed (Duodu et al. 2003), but almost identical

(55.4 %) to that reported for whole grain (Taylor and

Taylor 2011).

To assess the possibility of a link between endosperm

texture and digestibility, protein body structure of trans-

genic sorghum obtained following suppression of the c-

and a-kafirin sub-classes was studied by TEM. A signifi-

cant finding was that the protein bodies from the pABS042

transgenic line (Fig. 6c) appeared to be identical in size

and shape to the protein bodies of its normal control,

y = 1.0195x - 0.0803

R2 = 0.9916

0

10

20

30

40

50

60

70

80

90

100

0 20 40 60 80 100 120

% Floury endosperm

% g

amm

a ka

f b

and

su

pp

ress

ion

Fig. 5 Correlation chart for suppressed gamma-kafirin expression

with the floury endosperm phenotype for transgenic events. Twenty

seeds from each of the eight independent transgenic events of

pABS042 and pABS044 were cross sectioned and visualized under a

stereomicroscope and also analysed via SDS-PAGE and Western blot

analysis. When the extent of endosperm flouriness [as estimated from

sorghum standards (ICC 2008)] was plotted against the extent of

gamma-kafirin suppression as estimated from SDS-PAGE and

Western blot analysis, it appears that there was a positive correlation

between gamma-kafirin suppression and endosperm flouriness as

indicated by a co-efficient of 0.9916

530 Plant Cell Rep (2014) 33:521–537

123

P898012 (Fig. 6a). This was in agreement with previous

observations (Da Silva et al. 2011b) where it was found

that the protein bodies of ABS 149 (with the same kafirin

suppression as pABS042) had protein bodies that were

normal in shape, packing density and size to that of the

parent. Similarly for TX430 (Kumar et al. 2012) with only

c-kafirin suppression, the protein bodies were normal in

appearance but those with the predicted 29-kDa a-kafirin

suppression had distorted protein bodies. pABS042 had

densely packed, individual spherical protein bodies,

2–3 lm in diameter. Some of the protein bodies exhibited

the internal concentric ring structure (black dashed arrow),

but were fewer in number than those observed in the pro-

tein bodies of normal sorghum (Fig. 6a) and in the litera-

ture (Shull et al. 1992). The more limited concentric ring

structures from the pABS042 construct compared to nor-

mal sorghum is probably related to the suppression of

c-kafirin sub-class, since the rings normally comprise high

concentrations of both b- and c-kafirins (Shull et al. 1992).

The protein body structure of pABS042 resembled that of

Table 2 Tannin, protein and lysine content and in vitro protein digestibility (IVPD) of wet-cooked whole grain flour of different transgenic and

high protein digestibility mutant sorghum compared to normal parents and Macia

Sorghum lines Tannin (mg CE/100 g flour) Protein (g/100 g flour db)

(N 9 6.25)

Lysine (g/100 g protein) IVPD (%) (wet cooked)

Transgenic (type II tannin)

pABS042-1 ND 10.57 ± 0.22 2.36 ± 0.12 *33.5 ± 8.3

pABS042-2 ND 9.07 ± 0.32 2.04 ± 0.31 *35.7 ± 6.0

pABS042-3 ND 13.21 ± 0.90 ND *41.7 ± 1.6

pABS042-4 ND 17.92 ± 0.39 ND *45.7 ± 9.3

Mean of ABS042 12.69a 2.20 39.2b

pABS044-1 ND 16.03 ± 0.01 3.06 ± 0.00 *55.4 ± 1.2

pABS044-2 ND 14.85 ± 0.29 ND *54.8 ± 0.8

pABS044-3 ND 12.12 ± 0.19 ND *50.9 ± 2.9

Mean of ABS044 14.33a 3.06 53.7c

Controls (type II tannin)

P898012-TC ND 10.19 ± 0.21 29.1 ± 9.3

P898012-H/CG ND 13.95 ± 3.81 30.7 ± 6.2

P898012-Bulk 2.77 ± 0.06 10.90 ± 0.51 2.05 ± 0.0.06 25.6 ± 1.5

Mean of controls 11.68a 2.05 28.5a

High protein digestibility mutant (HPDM) (non-tannin)

HPDM1 0.01 ± 0.02 10.36 ± 0.01 2.10 ± 0.12 60.8 ± 1.0

HPDM2 0.03 ± 0.03 13.21 ± 0.19 2.41 ± 0.31 55.2 ± 1.5

HPDM3 0.04 ± 0.03 14.61 ± 0.05 ND 61.4 ± 1.6

HPDM4 0.01 ± 0.01 11.90 ± 0.04 2.04 ± 0.18 51.9 ± 5.6

HPDM5 0.03 ± 0.02 10.83 ± 0.03 2.22 ± 0.06 58.1 ± 1.6

HPDM6 0.06 ± 0.03 13.37 ± 0.12 1.87 ± 0.06 53.1 ± 1.3

HPDM7 0.01 ± 0.01 15.02 ± 0.01 ND 63.1 ± 1.3

Mean of HPDM 0.03 12.76a 2.13 57.7c

Normal protein digestibility (NPD) (non-tannin)

NPD1 0.08 ± 0.04 13.44 ± 0.02 1.29 ± 0.11 33.3 ± 2.3

NPD2 0.03 ± 0.01 12.16 ± 0.05 1.25 ± 0.17 36.4 ± 1.7

NPD3 0.02 ± 0.02 14.51 ± 0.07 1.37 ± 0.11 33.1 ± 1.6

NPD4 0.02 ± 0.05 15.12 ± 0.17 ND 36.7 ± 2.3

NPD5 0.05 ± 0.05 13.46 ± 0.06 1.20 ± 0.06 32.6 ± 1.1

Macia 0.04 ± 0.03 10.61 ± 0.01 1.87 ± 0.23 59.8 ± 0.7

Mean NPD 0.04 13.22 1.40 38.7b

Values are the mean and standard deviation per cultivar; each analysis was repeated twice with two replicates per sample; except where indicated

(*), where two replicates were analysed once. Values with different letters indicate significant differences between the groups at the 95 % level

using Fisher’s least significant difference (LSD) procedure

ND not determined, CE catechin equivalents

Plant Cell Rep (2014) 33:521–537 531

123

parental line P898012 and as such also had low IVPD

(Table 2). In contrast, the pABS044 transgenic line had

modified peripheral endosperm protein body structure

(Fig. 6d). The protein bodies of pABS044 were densely

packed, 2–3 lm diameters and deeply folded (invaginated)

with dark-staining inclusions (black solid arrows). Signif-

icantly, the protein bodies of pABS044 were similar in

shape to those of the HPDM (Fig. 6b). However, the pro-

tein bodies of the HPDM were smaller (approx. 1 lm

diam.). The protein bodies of pABS044 and HDPM were

also similar in that the majority of inclusions seemed to

extend radially from the protein body periphery (black

solid arrows). In addition, the characteristic internal con-

centric ring structure common to normal protein bodies

was absent. The modified protein body structure of

pABS044 is similar to that of high lysine, high protein

digestibility mutants, where the protein bodies are descri-

bed as being highly invaginated (with deep folds) (Oria

et al. 2000).

Discussion

Previous studies have shown that even though sorghum and

maize share equivalent sequence homology of storage

proteins, sorghum contains higher levels of cross-linked

prolamin storage proteins with an overall bias towards

intermolecular disulphide cross-linking of kafirins (Ha-

maker and Bugusu 2003). The higher disulphide cross-

linking of sorghum kafirins than that of maize zeins may be

related to the fact that both the 19 and 22 kDa a-kafirin

sub-classes contain an additional cysteine residue com-

pared to the zein homologues (Belton et al. 2006). Further,

it has been proposed that disulphide bond formation in

kafirin as a result of heating in food processing also pro-

motes realignment of kafirin into b-sheet structures, and

that these conformational changes cause the lower prote-

olysis susceptibility of kafirin (Emmambux and Taylor

2009). This partly explains the persistence of encapsulated

sorghum proteins (rigid protein bodies) remaining

throughout most food preparations, thus having an impor-

tant bearing on sorghum protein digestibility (Hamaker and

Bugusu 2003). Previously, we reported that co-suppression

of six kafirin genes: a-kaf A1, 25 kDa; a-kaf B1, 19 kDa;

a-kaf B2, 22 kDa; c-kaf1, 27 kDa; c-kaf 2, 50 kDa; and d-

kaf 2, 18 kDa led to increased digestibility in sorghum and

that the digestibility is directly correlated with an alteration

of protein bodies to an invaginated, irregular phenotype

(Da Silva et al. 2011b). In the current research, we present

data indicating that, more specifically, co-suppression of

P P

C

a b

c d

P

Fig. 6 Transmission electron micrographs of protein bodies found in

peripheral endosperm of parent non-transgenic P898012 (a), HPDM

Progeny 04CS11248-1 TX436 WES (b), transgenic pABS042 (c) and

transgenic pABS044 (d) sorghum lines. Within the images, C

represents the cell wall, P protein body, S starch granule; Black

arrow indicates deep folds (invaginations) in protein body wall,

whereas black dashed arrow indicates dark-staining concentric ring

inclusion. Bar 1 lm

532 Plant Cell Rep (2014) 33:521–537

123

only two genes (c-kaf1 and c-kaf2) significantly increases

in vitro protein digestibility and that when an addition of

third gene, a-kaf A1, is also co-suppressed the in vitro

digestibility increases significantly further.

Many cereals including sorghum, maize and rice are

deficient in the essential amino acid lysine. Previous

research suggests that in cereals, for example maize,

increased lysine content could result from many factors.

These include low rate of lysine catabolism due to reduced

levels of two consecutive enzymes, lysine a-ketoglutarate

reductase (LKR) and saccharopine dehydrogenase (SDH),

which are linked on a single polypeptide encoded by a

single LKR/SDH gene; reduced prolamine synthesis;

increased non-zein protein content, and to some extent

through alterations in the regulation of enzymes involved

in the lysine biosynthesis (Azevedo et al. 2003). Since the

catabolism of lysine is carried out by the activities of the

two consecutive enzymes (LKR and SDH), as previously

reported (Fornazier et al. 2005), we made an assumption

that suppressing one of these enzymes, LKR, would pre-

serve any lysine accumulated in transgenic sorghum as a

result of kafirin subspecies suppression. This assumption is

further supported by evidence that in the Opaque-2 mutant

maize containing higher concentrations of soluble lysine in

seeds, there is a reduction in the lysine catabolic rate in the

endosperm, which therefore allows excess lysine to be

incorporated into storage proteins as well as to get accu-

mulated in soluble form (Arruda et al. 2000; Azevedo

2002; Gaziola et al. 1999). Unfortunately, the construct we

used to suppress LKR in both ABS042 and ABS044 did not

achieve the levels of suppression we expected (Supple-

mentary data). This is probably because LKR and SDH are

present in sorghum seeds in many multimeric forms with

distinct molecular masses (Fornazier et al. 2005). Future

experiments utilizing different sorghum genetic back-

grounds may serve to verify whether the LKR approach is

indeed unfeasible. The presence of the LKR suppression

sequence in both the constructs pABS042 and pABS044

(Fig. 1) also implies, though not proven, that the impact or

lack thereof LKR would be approximately similar for both

constructs.

Sorghum lines bearing the three suppressed genes pos-

sessed the typical irregular and invaginated phenotype

associated with high digestibility (Fig. 6d) which favours

easy accessibility of proteolytic enzymes as previously

described (Mehlo et al. 2013; Oria et al. 2000). The two

constructs we used, pABS042 and pABS044 (Fig. 1), were

crafted to differentiate between the effect of suppressing

only two c-kafirin sub-classes (c-kaf1, 27 kDa; c-kaf 2,

50 kDa in pABS042) or the combined suppression of the

two c-kafirin sub-classes, and an a-kafirin sub-class

(c-kaf1, 27 kDa; c-kaf 2, 50 kDa; a-kaf A1, 25 kDa in

pABS044). Analysis of four independent transgenic lines

derived from the pABS042, and three from pABS044,

together with suitable controls [including a high protein

digestible mutant) as shown in Table 1; Figs. 1, 3] con-

firmed the successful suppression of c- and a-kafirins

through the absence of relevant protein bands on SDS-

PAGE which was further confirmed by Western blotting

(Fig. 3). When transgenic seeds were sectioned, we

observed that suppression of c-kaf1 (27 kDa) and c-kaf 2

(50 kDa) alone, or the two c-kafirin sub-classes co-sup-

pressed with a-kaf A1 (25 kDa), resulted in floury endo-

sperm (Fig. 4). Since the two c-kafirin sub-classes (c-kaf1

and c-kaf 2) were common in both pABS042 and

pABS044, we ascribed the floury endosperm phenotype to

the suppression of c-kafirin. However, it appears that there

were two types of floury endosperm: one type resulted in a

lumen in the centre of the endosperm, whereas the other

had completely filled grains. The lumen was predominantly

associated with both pABS042 and pABS044 grains,

whereas some completely filled floury endosperm pheno-

type was associated only with pABS044 (combined c-

kafirin and a-kafirin suppression). The finding that there

was a direct relationship between suppression of c-kafirin

by the pABS042 construct alone and the proportion of

floury endosperm in the intermediate endosperm P8989012

line (Fig. 5) differs somewhat from the observed little or no

effect of the similar pABS149 construct on the corneous

endosperm phenotype of sorghum line TX430. The effect

in P890812 is presumably due to the suppression of

c-kafirin inhibiting the formation of inter-polypeptide

disulphide cross-linking involved in corneous endosperm

structure. This concept is supported by the fact that mod-

ifying genes can be used to increase the level of c-zein in

high-lysine maize to restore the hard endosperm charac-

teristic (Wu et al. 2010). Causes of a floury endosperm

have previously been described and include loosely pack-

aged granules with air spaces (Rooney and Miller 1982).

The floury endosperm particularly that of pABS044 was

similar to that of the HPDM sorghum endosperm (Fig. 4c).

The HPDM has been reported to have high in vitro

digestibility (Oria et al. 2000). The reported explanation

suggests that this is a consequence of the nature of protein

bodies, particularly the irregular, invaginated form which

favours high digestive enzyme accessibility.

Our next set of experiments therefore sought to unravel

the nature of protein bodies in both pABS042- and

pABS044-derived transgenic sorghum seeds and an

assessment of their digestibility. First, irregularly invagi-

nated protein bodies were observed only in the floury

endosperms of pABS044 (where the 27 kDa c-kaf 1;

50 kDa c-kaf 2 and the 25 kDa a-kaf A1 proteins were

targeted for suppression). The irregular and invaginated

protein bodies in seeds of pABS044 resembled those of the

HPDM seeds (compare Fig. 6b with d). We previously

Plant Cell Rep (2014) 33:521–537 533

123

reported a similar phenotype of protein bodies in seeds of

transgenic events in which six kafirin genes (a-A1, 25 kDa;

a-B1, 19 kDa; a-B2, 22 kDa; c-kaf1, 27 kDa; c-kaf 2,

50 kDa; and d-kaf 2, 18 kDa) were targeted for suppres-

sion and the events generated through Agrobacterium-

mediated transformation (Da Silva et al. 2011b). Protein

body structure of pABS42 was similar to those of the

parental low digestibility P898012 control (compare

Fig. 6a with c), though they were comparatively larger.

When assayed for digestibility, floury seeds of pABS044

had significant improvement in IVPD, comparable to that

of the HPDM (Table 2). However, those of pABS042 also

had significant improvement in digestibility over the

parental control even though this improvement was less

than that imparted by the pABS044 construct. When these

results are considered together, it appears that IVPD was

largely influenced by the protein body microstructure,

particularly irregular and invaginated protein bodies, and

not necessarily the floury trait. This is because the floury

trait was common for both constructs. We therefore con-

sider that the combined suppression of c- and a-kafirins

was the primary cause of a significant increase in protein

digestibility (since c-alone in pABS042 failed to achieve

the same levels of digestibility obtained for pABS044). The

fact that in this present study both the transgenic lines and

the HPDM sorghum had all floury endosperms, whereas

their parents did not suggest the suppression of particularly

the c-kafirin sub-class leads to alteration not only of protein

synthesis but also of the involvement of this kafirin sub-

class in cross-linking.

It is clear from the results that altered protein body

structure of the pABS044 transgenic line may be respon-

sible for its higher cooked IVPD compared to pABS042

and normal sorghum lines, as was proposed by Oria et al.

(2000) using high protein digestibility sorghum lines. Thus,

it would appear that the altered protein synthesis of

pABS044, namely the combined reduction in c-kaf 1

(27 kDa), c-kaf 2 (50 kDa) and a-kaf A1 (25 kDa), had a

major effect on the peripheral and internal protein body

structure. Suppression of the a-kaf A1 kafirin probably

adversely affects kafirin polymerization through disulphide

bonding, since c-kafirin and a-1 kafirin link together (El

Nour et al. 1998). This in turn may disrupt normal protein

body formation. It can be speculated that in the case of the

HPDM, where the proportions of the different kafirin sub-

classes are apparently normal (Oria et al. 2000), the

invaginated protein body structure could be due to differ-

ences in the sequence of kafirin sub-classes synthesis.

We were therefore interested in finding out whether the

two different phenotypes engendered by the constructs

pABS042 and pABS044, particularly the floury endo-

sperm, had any serious impact on seed density/weight. Our

results indicate that there was little variation in seed

weight, morphology and germination rates. The approach

we adopted in this study, i.e. suppression of only three

kafirin protein sub-classes (27 kDa c-kaf 1; 50 kDa c-kaf

2; and the 25 kDa a-kaf A1) as opposed to the suppression

of six kafirin protein sub-classes (Da Silva et al. 2011b),

appears to be an effective method for improving sorghum

protein digestibility. Up until recently, there has been

limited progress in improving sorghum protein digestibil-

ity. However, with the advent of recombinant DNA tech-

nology it is now a subject of intense research (Henley et al.

2010; Hoang 2008; Jung 2008; Zhao 2007). Other

researchers (Henley et al. 2010) directly compared the

improvement in protein digestibility and lysine of the

transgenic sorghums having suppressed kafirin sub-class

synthesis with the protein quality of other cereals, using the

international accepted measure of Protein Digestibility

Corrected Amino Acid Score (PDCAAS). They showed

that the PDCAAS of food (porridge) made from the

transgenic sorghums is similar to that of porridges made

from maize, pearl millet and wheat. Further, the levels of

protein digestibility obtained in this present research are

potentially higher than shown because the genotype we

used (P898012) is a type II tannin line that contains tannins

which naturally interfere with digestion.

Tannins are rich in phenolic hydroxyl groups. As such

they have high propensity to bind proteins through

hydrogen bonding, hydrophobic interactions, electrostatic

attraction (which does not occur in sorghum tannin-protein

system) and covalent bonding associated with oxidation

(no evidence in sorghum) (Leatham et al. 1980; Oh et al.

1980; Meek and Weiss 1979). The two major classes of

tannins, hydrolysable tannins and non-hydrolyzable tannins

(condensed), are widespread in plants, but sorghum con-

tains only one class—the condensed tannins, chemically

known as proanthocyanidins (Fraziera et al. 2010). Under

optimal conditions, sorghum tannins have the potential to

bind and precipitate proteins upwards of 12 times their

weight (Harris and Burns 1970). Sorghum grain contains

on average 10 % protein content. This implies that the

grain of high-tannin sorghum cultivars ([2 % tannin)

contains more than enough tannin to bind all the dietary

seed proteins, thus making the protein indigestible when

consumed (Neucere and Sumrell 1980). The most affected

proteins are those that are large, have an open structure,

contain no bound carbohydrate and are rich in proline

(Butler et al. 1984). To counteract the negative impact of

tannins on dietary protein digestibility, animals rely on the

use of several mechanisms. These include high pH gut

adaptations and detergency of insects and the production of

salivary tannin-binding proteins to protect valuable pro-

teins against precipitation by tannins (Martin et al. 1985;

Robins et al. 1991). The biological effects associated with

sorghum tannins are generally beneficial in the field

534 Plant Cell Rep (2014) 33:521–537

123

(against bird predation and fungal infection, and pre-har-

vest seed deterioration, etc.) and harmful in the diet

(binding dietary proteins). Many efforts are being explored

to deal with tannins in sorghum. These include the devel-

opment of lines in which tannins never polymerize to long

antinutritional forms (condensed tannins).

In subsequent phases of this project, the sorghum germ-

plasm developed in this project will be introgressed into non-

tannin sorghum lines. Further investigations are however

required to validate any additional nutritional benefits that

could arise from altered protein expression and accumulation

in sorghum grain following suppression of selected kafirin

sub-classes. In many poor countries, food security is a

complex interplay between availability, quantity and quality

in terms of nutritional composition. It has been argued pre-

viously that one nutritional trait, for example, ‘‘high protein

of sorghum’’ is not a miracle solution for the poor, mal-

nourished communities who farm marginal agro-ecological

zones in Africa (Mayer and Mayer 1974). Genetically

modified (GM) crops generally add another barrier to food

access because they are not readily accepted in developing

countries and the GMO regulations are strict. The transgenic

lines generated in this project are available free of charge to

communities in Africa. However, because Africa is the

centre of origin and diversity for sorghum, these lines still

have to go through rigorous assessments before they can be

grown in open fields.

We sincerely believe that our approach towards

improving sorghum nutrition is logical. Kafirins are the

major storage proteins in sorghum and are the most

abundant, yet they are deficient in many essential amino

acids like lysine, methionine and tryptophan. Previous

research (Kumar et al. 2012) involving molecular charac-

terization showed that downregulation of c-kafirin alone

was insufficient to change sorghum endosperm texture or

increase protein digestibility, but that a predicted 29-kDa

a-kafirin should perhaps be suppressed to alter protein

body morphology and protein digestibility. There is further

evidence which shows that sorghum protein digestibility,

endosperm texture and protein body morphology are highly

influenced by the dosage of high-digestibility mutant

alleles (Tesso et al. 2008). Also in relation to the effect of

kafirin cross-linking on sorghum protein digestibility,

Hoang (2008) overexpressed the reducing compound thi-

oredoxin in transgenic sorghum to produce mutants which

had improved digestibility. The c-kafirin sub-class there-

fore appears to play a major role in the low protein

digestibility of sorghum through its disulphide-bonded

cross-linking of the kafirin polypeptides (El Nour et al.

1998). A critical issue appears to be whether c-kafirin alone

is responsible, or whether additional suppression of other

kafirin sub-classes is necessary to improve protein digest-

ibility and nutrition. We have shown in this research that

the suppression of synthesis of three nutritionally chal-

lenged kafirin proteins leads to higher digestibility than that

imparted by the suppression of the two gamma-kafirins.

The approach we took in this research could be important

in efforts towards improving the nutrition of communities

subsisting on sorghum as a staple crop in marginal agri-

cultural ecologies of Africa.

Acknowledgments We are grateful to the Bill and Melinda Gates

Grand Challenges 9, Africa Biofortified Sorghum (ABS) Project

through a sub-grant from the Africa Harvest Biotechnology Founda-

tion International for funding. We would also like to thank Pioneer

Hi-Bred International for supplying the pABS042 and pABS044

constructs and antibodies, and Dr Dirk Hays of Texas A&M Uni-

versity for the high protein digestibility sorghums. Priscilla Dikiso,

Stella Manganye, Taola Shai and Moses Mokoena are thanked for

their skilled technical assistance.

References

AACC International (2000) Approved methods of AACC, 10th edn.

American Association of Cereal Chemists, St Paul

Arruda P, Kemper EL, Papes F, Leite A (2000) Regulation of lysine

catabolism in higher plants. Trends Plant Sci 5:324–330

Azevedo RA (2002) Analysis of the aspartic acid metabolic pathway

using mutant genes. Amino Acids 22:217–230

Azevedo RA, Damerval C, Lea PJ, Landry J, Bellato CM, Meinardt

LW, Le Guilloux M, Delhaye S, Toro AA, Gaziola SA, Berdejo

DBA (2003) Regulation of maize lysine metabolism and

endosperm protein synthesis by opaque and floury mutations.

Eur J Biochem 270:4898–4908

Belton PS, Delgadillo I, Halford NG, Shewry PR (2006) Kafirin

structure and functionality. J Cereal Sci 44:272–286

Bidlingmeyer BA, Cohen SA, Tarvin TL (1984) Rapid analysis of

amino acids using pre-column derivatization. J Chrom B Biomed

Sci Appl 336:93–104

Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal Biochem 72:248–254

Butler LG, Riedl DJ, Lebryk D, Blytt H (1984) Interaction of proteins

with sorghum tannin: mechanism, specificity and significance.

J Am Oil Chem Soc 61:916–920

Da Silva LS, Taylor J, Taylor JR (2011a) Transgenic sorghum with

altered kafirin synthesis: kafirin solubility, polymerization, and

protein digestion. J Agric Food Chem 59:9265–9270

Da Silva LS, Jung R, Zhao Z, Glassman K, Taylor J, Taylor J (2011b)

Effect of suppressing the synthesis of different kafirin sub-

classes on grain endosperm texture, protein body structure and

protein nutritional quality in improved sorghum lines. J Cereal

Sci 54:160–167

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA miniprepa-

ration: version II. Plant Mol Biol Rep 1:19–21

Duodu K, Taylor J, Belton P, Hamaker B (2003) Factors affecting

sorghum protein digestibility. J Cereal Sci 38:117–131

El Nour I, Peruffo A, Curioni A (1998) Characterisation of sorghum

kafirins in relation to their cross-linking behaviour. J Cereal Sci

28:197–207

Elkin RG, Freed MB, Hamaker BR, Zhang Y, Parsons CM (1996)

Condensed tannins are only partially responsible for variations in

nutrient digestibilities of sorghum grain cultivars. J Agric Food

Chem 44:848–853

Plant Cell Rep (2014) 33:521–537 535

123

Emmambux MN, Taylor JR (2009) Properties of heat-treated

sorghum and maize meal and their prolamin proteins. J Agric

Food Chem 57:1045–1050

Fornazier RF, Gaziola SA, Helm CV, Lea PJ, Azevedo RA (2005)

Isolation and characterization of enzymes involved in lysine

catabolism from sorghum seeds. J Agric Food Chem

53:1791–1798

Fraziera RA, Deavilleb ER, Greenc RJ, Stringanob E, Willoughbyd I,

Plante J, Mueller-Harveyb I (2010) Interactions of tea tannins

and condensed tannins with proteins. J Pharm Biomed Anal

51:490–495

Gaziola SA, Alessi ES, Guimaraes PEO, Darmerval C, Azevedo RA

(1999) Quality protein maize: a biochemical study of enzymes

involved in lysine metabolism. J Agric Food Chem

47:1268–1275

Grootboom AW, Mkhonza N, O’Kennedy M, Chakauya E, Kunert K,

Chikwamba R (2010) Biolistic mediated sorghum (Sorghum

bicolor L. Moench) transformation via mannose and bialaphos

based selection systems. Int J Bot 6(2):89–94

Guiragossian V, Chibber BA, Van Scoyoc S, Jambunathan R, Mertz

ET, Axtell JD (1978) Characteristics of proteins from normal,

high lysine, and high tannin sorghums. J Agric Food Chem

26:219–223

Hamaker BR, Bugusu BA (2003) Overview: sorghum proteins and

food quality. In: Anonymous Afripro. workshop on the proteins

of sorghum and millets: enhancing nutritional and functional

properties for Africa. Pretoria, South Africa, pp 2–4

Hamaker BR, Kirleis AW, Mertz ET, Axtell JD (1986) Effect of

cooking on the protein profiles and in vitro digestibility of

sorghum and maize. J Agric Food Chem 34:647–649

Hamaker B, Mohamed A, Habben J, Huang C, Larkins B (1995)

Efficient procedure for extracting maize and sorghum kernel

proteins reveals higher prolamin contents than the conventional

method. Cereal Chem 72:583–588

Harris HB, Burns RE (1970) Influence of tannin content on preharvest

seed germination in sorghum. Agronomy Journal 62(6):835–836

Henley E, Taylor J, Obukosia S (2010) The importance of dietary

protein in human health: combating protein deficiency in sub-

Saharan Africa through transgenic biofortified sorghum. Adv

Food Nutr Res 60:21–52

Hoang PM (2008) Genetic manipulation of Grain storage protein

digestibility in sorghum. PhD Thesis, School of Land, Crop and

Food Sciences, The University of Queensland, Australia

ICC (2008) Estimation of sorghum grain endosperm texture, ICC

Standard 176

ICRISAT (2011) ICRISAT Mandate Crops: Sorghum. www.icrisat.

org. Accessed November 2011

ICRISAT and FAO (1996) The world sorghum and millet economies:

facts, trends and outlook. ICRISAT, Patancheru

Ishimaru K, Ichikawa H, Matsuoka M, Ohsugi R (1997) Analysis of a

C4 maize pyruvate, orthophosphate dikinase expressed in C3

transgenic Arabidopsis plants. Plant Sci 129:57–64

Jung R (2008) Grain Quality through altered expression of seed

proteins.US Patent Application. 0134361A1

Kumar T, Dweikat I, Sato S, Ge Z, Nersesian N, Chen H, Elthon T,

Bean S, Ioerger BP, Tilley M (2012) Modulation of kernel

storage proteins in grain sorghum (Sorghum bicolor (L.)

Moench). Plant Biotechnol J 10:533–544

Laidlaw HKC, Mace ES, Williams SB, Sakrewski K, Mudge AM,

Prentis PJ, Jordan DR, Godwin ID (2010) Allelic variation of the

b-, c- and d-kafirin genes in diverse sorghum genotypes. Theor

Appl Genet 121:1227–1237

Leatham GF, King V, Stahmann MA (1980) In vitro protein

polymerization by quinones or free radicals generated by plant

or fungal oxidative enzymes. Phytopathology 70:1134–1140

Lipkie TE, De Moura FF, Zuo-Yu Z, Albertsen MC, Che P, Glassman

K, Ferruzi MG (2013) Bioaccessibility of carotenoids from

transgenic provitamin a biofortified sorghum. J Agric Food

Chem 61(24):5764–5771

Martin MM, Rocholm DC, Martin JS (1985) Effects of surfactants,

pH and certain cations on precipitation of proteins by tannins.

J Chem Ecol 11:485–494

Matsuoka M, Furbank RT, Fukayama H, Miyao M (2001) Molecular

engineering of C4 photosynthesis. Annu Rev Plant Biol

52:297–314

Maxson E, Rooney L (1972) Evaluation of methods for tannin

analysis in sorghum grain. Cereal Chem 49:719–727

Mayer A, Mayer J (1974) Agriculture, the island empire. Daedalus

103(3):83–95

Meek KM, Weiss JB (1979) Differential fixation of poly (L-arginine)

and poly (L-lysine) by tannic acid and its application to the

fixation of collagen in electron microscopy. Biochimica et

Biophysica Acta 587:112–120

Mehlo L, Mbambo Z, Bado S, Lin J, Moagi SM, Buthelezi S,

Stoychev S, Chikwamba R (2013) Induced protein polymor-

phisms and nutritional quality of gamma irradiation mutants of

sorghum. Mutat Res-Fund Mol M 749(1–2):66–72

Mertz ET, Hassen MM, Cairns-Whittern C, Kirleis AW, Tu L, Axtell

JD (1984) Pepsin digestibility of proteins in sorghum and other

major cereals. Proc Natl Acad Sci USA 81:1–2

Neucere NJ, Sumrell G (1980) Chemical composition of different

varieties of grain sorghum. J Agric Food Chem 28(1):19–21

O’Kennedy M, Burger J, Botha F (2004a) Pearl millet transformation

system using the positive selectable marker gene phosphoman-

nose isomerase. Plant Cell Rep 22:684–690

O’Kennedy M, Smith G, Botha F (2004b) Improved regeneration

efficiency of a pearl millet (Pennisetum glaucum [L.] R. Br.)

breeding line. S Afr J Bot 70(4):502–508

Oh HI, Hoff JE, Armstrong GS, Haff LA (1980) Hydrophobic

interaction in tannin-protein complexes. J Agric Food Chem

28(2):394–398

Oria MP, Hamaker BR, Shull JM (1995a) Resistance of Sorghum

alpha, beta and. gamma-Kafirins to Pepsin Digestion. J Agric

Food Chem 43:2148–2153

Oria M, Hamaker B, Schull J (1995b) In vitro protein digestibility of

developing and mature sorghum grain in relation to a-, b-, and c-

kafirin disulfide crosslinking. J Cereal Sci 22:85–93

Oria MP, Hamaker BR, Axtell JD, Huang C (2000) A highly

digestible sorghum mutant cultivar exhibits a unique folded

structure of endosperm protein bodies. Proc Natl Acad Sci USA

97:5060–5070

Robins CT, Hagerman AE, Austin PJ, McAthur C, Hanley TA (1991)

Variation in mammalian physiological responses to a condensed

tannin and its ecological implications. J Mammal 72:480–486

Rom D, Shull J, Chandrashekar A, Kirleis A (1992) Effects of

cooking and treatment with sodium bisulfite on in vitro protein

digestibility and microstructure of sorghum flour. Cereal Chem

69:178–181

Rooney L, Miller F (1982) Variation in the structure and kernel

characteristics of sorghum. In: Anonymous International sym-

posium on sorghum grain quality, pp 143–162

Sastry LV, Paulis JW, Cobb LA, Wall JS, Axtell JD (1986) Genetic

variability of alcohol-soluble storage proteins in high-lysine

sorghums. J Agric Food Chem 34:1061–1067

Shewry PR (2002) The major seed storage proteins of spelt wheat,

sorghum, millets and pseudocereals. In: Belton PS, Taylor JRN

(eds) Pseudocereals and less common cereals. Springer,

pp 1–24

Shewry PR (2007) Improving the protein content and composition of

cereal grain. J Cereal Sci 46:239–250

536 Plant Cell Rep (2014) 33:521–537

123

Shull JM, Watterson JJ, Kirleis A (1992) Purification and immuno-

cytochemical localization of kafirins in Sorghum bicolor (L.

Moench) endosperm. Protoplasma 171:64–74

Taylor J, Taylor JR (2011) Protein biofortified sorghum: effect of

processing into traditional African foods on their protein quality.

J Agric Food Chem 59:2386–2392

Tesso T, Ejeta G, Chandrashekar A, Huang C, Tandjung A, Lewamy M,

Axtell JD, Hamaker BR (2006) A novel modified endosperm texture

in a mutant high-protein digestibility/high-lysine grain sorghum

(Sorghum bicolor (L.) Moench). Cereal Chem 83:194–201

Tesso T, Hamaker B, Ejeta G (2008) Sorghum protein digestibility is

affected by dosage of mutant alleles in endosperm cells. Plant

Breeding 127:579–586

Vain P, McMullen MD, Finer JJ (1993) Osmotic treatment enhances

particle bombardment-mediated transient and stable transforma-

tion of maize. Plant Cell Rep 12:84–88

Watterson J, Shull J, Kirleis A (1993) Quantitation of a-, b-, and c-

kafirins in vitreous and opaque endosperm of Sorghum bicolor.

Cereal Chem 70:452–457

Weaver CA, Hamaker BR, Axtell JD (1998) Discovery of grain

sorghum germ plasm with high uncooked and cooked in vitro

protein digestibilities. Cereal Chem 75:665–670

Wu Y, Holding DR, Messing J (2010) c-Zeins are essential for

endosperm modification in quality protein maize. Proc Natl Acad

Sci USA 107:12810–12815

Zhao Z (2007) The Africa biofortified sorghum project–applying

biotechnology to develop nutritionally improved sorghum for

Africa. In: Xu Z, Li J, Xue Y, Yang W (eds) Biotechnology

and sustainable agriculture 2006 and beyond. Springer, pp 273-

277

Plant Cell Rep (2014) 33:521–537 537

123