Molecular and Cellular Endocrinology, 55 (1988) 107-l 12 Elsevier Scientific Publishers Ireland. Ltd.

107

MCE 01818

Rapid Coruscation

Cloning and DNA sequence analysis of the cDNA for the precursor of porcine follicle stipulating hormone (FSH) p subunit

Yukio Kato Depurtmenr of Protein Chemistry, Institute of End~rinoio~, Gunma University, M~e~~hi, Gunma 371, Japan

(Received 20 November 1987; accepted 23 November 1987)

lyq~ words: Porcine follitropin B subunit cDNA; cDNA cloning; DNA sequencing; Hormone precursor; Foliicfe stimulating hormone /3 subunit: Pituitary hormone

Summary

A cDNA library of porcine anterior pituitary was constructed in an expression vector hgtll. The cDNAs encoding the porcine follicle stimulating hormone (pFSH) j3 subunit were obtained using anti-human FSHP antiserum or synthetic oligonucleotide. The nucleotide sequence of the pFSH@ subunit cDNA clone (929 base) has been determined. The cDNA contained a part of the signal sequence {six amino acids) and the whole amino acid sequence of the mature molecule (109 amino acids). The predicted protein sequence was different from that of the amino acid sequence analysis in ten residues and had an extended carboxyl terminus. Northern analysis showed that the length of the pFSH > subunit mRNA was about 1.8 kb.

Introduction

Follicle stimulating hormone (FSH), which is synthesized and secreted from the anterior pitui- tary, stimulates the development of the follicle and spermatogenesis in the reproductive organs. FSH is a glycoprotein hormone and consists of cy and J3 subunits (Pierce and Parsons, 1981). The QI subunit is common to other pituitary glycoprotein hormones, luteinizing hormone (LH) and thyroid stimulating hormone (TSH), and is encoded by a single gene (Boothby et al., 1981). But the j3 subunit is unique to each hormone. Immunocy- tochemical studies show that FSH and LH are synthesized in the same kind of pituitary cell

Address for correspondence: Yukio Kato, Department of Protein Chemistry, Institute of Endocrinology, Gunma Univer- sity, 3-39-15 Showa-machi, Maebashi, Gunma 371, Japan.

(Kurosumi and Inoue, 1986), and an excess amount of cy subunit mRNA is found in the tissue (Counis et al., 1982), which suggests that different control mechanisms may function in a: and j3 subunit syntheses. However, the control mechanism of the subunit syntheses is not yet known. It also re- mains to be determined how steroids or hypo- thalamic factor(s) control the syntheses of these subunits (Fontaine and Burzawa-Gerard, 1977). Molecular cloning is a powerful tool for the specific detection of each glycoprotein mRNA and the search for the gene expression, but little is known about the gene structure of the FSHP subunit compared to cy and LHP subunits.

The sequence homology between the /_I subunits of FSH, LH and TSH (Saxena and Rathnam, 1976) suggests that these genes had diverged from a common ancestor gene (Fontaine and Burzawa- Gerard, 1977). The amino acid sequences of FSHP

0303-7207/88/$03.50 0 1988 Elsevier Scientific Publishers Ireland, Ltd.

108

subunit for several animals have been reported (Saxena and Rathnam, 1976; Fujiki et al., 1978; Siaram et al., 1981; Esch et al., 1986), but only the porcine sequence (Closset et al., 1978) showed distinct differences, with inserts and gaps being required to align the porcine sequences with others. This suggests that porcine gonadotropin (FSH) has a different phylogenical position from other mammals studied. Analysis of the nucleotide se- quence of the FSHP subunit gene may confirm the distinction. To understand the phylogenical aspect and the gene expression of gonadotropin, the cloning of pituitary hormones has been pro- gressing in our laboratory (Kato et al., 1987). The antibody and synthetic oligonucleotide probe for the FSHP subunit were used to screen a porcine anterior pituitary cDNA library constructed in the expression vector Xgtll, and the DNA sequence of the positive clone was determined.

Materials and methods

Construction of the cDNA library. Porcine an- terior pituitary poly(A)+ RNA was prepared from frozen tissues (Turkey et al., 1981) and the cDNA library was constructed in the phage expression vector Xgtll (Young and Davis, 1983). Xgtll DNA was digested by EcoRI and dephosphory- lated with alkaline phosphatase (intestinal mucosa, P-L Biochem.). A 100 ng aliquot of cDNA was ligated to 20 pg of Xgtll DNA prepared as described above. A library of 5.6 X lo6 primary clones was obtained with 82% recombinant.

Screening of the Xgtl I library. Immunoscreen- ing was performed from 8 X lo5 plaques accord- ing to the method of Young and Davis (1983). Expression of fusion proteins was achieved on nitrocellulose filters (BA85, Schleicher & Schuell) previously soaked in 10 mM isopropyl P-D-

GCC.ATC.TGC.TGC.AAT.AGC.m.GAG.CTG.ACC.AAC.ATC.ACC.ATC.ACA.GTG.~~G.AAA.GAG.GAG. Ala-lle-Cys-Cys-Asn-Ser-Cys-Glu-Leu-Thr-Asn-lle-Thr-~le-Thr-Val-Glu-Lys-Glu-Glu-

e -1 -10

100

TGT.AAC.TTC.TGC.ATA.AGC.ATC.AAC.ACC.ACG.TGG.TGT.GCT.GGC.TAT.TGC.TAC.ACC.CGG.GAC. Cya-Asn-Phe-Cys-Ile-Ser-Ile-Asn-Thr-Thr-Trp-Cys-Ala-Gly-Tyr-Cys-Tyr-Thr-Arg-Asp-

-20 -30

ISO

CTG.GTA.TAC.AAG.GAC.CCA.GCC.AGG.CCC.AAC.ATC.ChG.AAA.ACA.TGT.ACC.TTC.AAG.GAG.CTG. I.eu-Val-Tyr-Lys-Asp-Pro-Ala-Arg-Pro-Asn-lle-Gln-Lys-Thr-Cys-Thr-Phe-Lys-Glu-Leu-

t.0 -so

zoo GTG.TAC.GAG.ACC.GTG.AAA.GTA.CCT.GGC.TGT.GCT.CAC.CAT.GCA.GAC.TCC.CTG.TAT.ACG.TAT~ Val-Tyr-Glu-Thr-Val-Lys-Val-Pro-Gly-Cys-Ala-His-His-Ala-Asp-Ser-Leu-Tyr-Thr-Tyr-

.6O -70

lb0 300 CCA.GTA.GCC.ACT.GAA.TGT.CAC.TGT.GGC.AAG.TGT.GAC.AGT.GAC.AGT.ACT.GAC.TGC.ACC.GTG. Pro-Val-Ala-Thr-Glu-Cys-His-Cys-Gly-Lys-Cys-Asp-Ser-Asp-Ser-~~~-Asp-Cys-Thr-Val-

*E30

9dO AGA.GGC.CTG.GGG.CCC.AGC.TAC.TGC.TCC.TTC.AGT.GAA.ATG.AAA. ~AGCAGTGGACATTTC Arg-Gly-Leu-Gly-Pro-Ser-Tyr-Cys-Ser-Phe-Ser-Glu-~et-Lys-GlU

-100 *LOP

JO0

ATGCTTCCTACCCTTGTCTGAAGGACCAAGACGTCCAAGAAGTTTGTGTGTACATGTGCCCAGGCTGCAhACCACTATGA .dO moo

GAGACCCCACTGATCCCTGCTGTCCTGTGGAGGAGGAGCTCCAGGAATGCAGAGTGCTAGGGCCTCAGTCCCATCACCAC SdO 600

TCAACCCTGTATTTTGGGTCTGGTTCCATAAGTTTTATTCGGTCTTTTTTTTTAhATTACTChATGAATTTTATTACATT 660

TATAATTGTACAATGATCATCACAACCCAATTTTATACGATTTCChTCCCAAACCCCCAGCATAGACCCCCATCTCCCAA TOO TbO

TCTGTCTCATTTCGAAACCATAAGTTTTTCAAAGTCCGTGAGTCAGTATCTACTCAGTCTTATThCCTTAAAGACATGTG -00

GGTGTTTTCTGTTTAATAATCTTAGAAATCCTCTCAAGACAGGGATATGGACCCAGAGGAAGGAAATGGGCTAAGAATGG .9 s 0 DO.3

GTGAAAGGACTAAATGCACCATTCTCCCACTAGACACAGChGCCTACAAGAGCAGGGC~AGTCTCTTTGTCATGAGTGTG 929

GCCG

Fig. 1. Nucleotide sequence of pFSHj3 subunit cDNA. The deduced amino acid sequence is also displayed and the amino terminal of mature protein (Closset et al., 1978) is numbered + 1 and its nucleotide sequence is indicated with reversed letters. A putative

polyadenylation signal and the position of synthetic oligonucleotide are indicated with reversed letters and underline, respectively.

109

t~ogalactopyranoside overnight at 37 o C. An anti-human FSHP subunit rabbit antiserum (NIAMDD batch No. 1) was used diluted to 1: 1000 followed by detection using f’251]Protein A. Synthetic oligonucleotide 48mer, of which the position is indicated in Fig. 1, was synthesized with a Gene Assembler (Pharmacia). Plaque hyb~dization was performed from 1 X lo6 plaques using the o~gonucleotide probe labeled by the random priming method (Feinberg and Vogel- stein, 1983) using oligolabeling kits (Pharmacia and Amersham).

Northern analysis. Total mRNA was electro- phoresed on a denaturing formamide gel (Lehrach et al., 1977) and transferred to nylon membrane, Zeta-Probe (Bio-Rad). The filter was irradiated with UV light at 302 nm (Ultraviolet Corp.) for 15 min to fix RNA according to a method recently developed (submitted for publication). Denatured double-strands cDNA was labeled as described above.

Hybridization. Hybridization was performed in a sealed plastic bag containing 0.9 M of NaCl, 0.02% each of Ficoll, bovine serum albumin and polyvinylpyrrolidone, and 1% SDS at 5068°C overnight. The membrane was washed twice with O.l-IO x SSC contai~ng 1% SDS followed by exposure to X-ray film (Kodak XAR-5) at - 80” C using an intensifying screen (Toshiba, E-32).

DNA sequencing. A porcine FSHP subunit cDNA insert was subcloned to pUC9 or pUC119, then the subclones having deletions of various length were prepared (Yanisch-Perron et al., 1985). Nucelotide sequencing was performed by the dide- oxynucleotide ter~nation method (Sanger et al., 1977) using denatured double-stranded DNA as template (Hattori and Sakaki, 1986).

Results and discussion

Isolation and nucleotide sequence of pFSHfi cL)NA. Using antibody, 53 immunoreactive clones were obtained at the first screening. But 32 of them were hybridized with pLH/3 > cDNA (not hybridized to FSHj3 cDNA; results to be published elsewhere) and finally one clone was obtained by repeated i~unoscree~ng and plaque hybridization using a synthetic oligonucleotide. From an independent screening using a synthetic

oligonucieotide, four positive clones were ob- tained. The nucleotide sequence of the clone hav- ing the longest cDNA insert is shown in Fig. 1. The sequence consisted of a total of 929 nucleo- tides, which consisted in part of a signal sequence (six amino acids) and 109 amino acids of a mature subunit followed by 583 bases of an untransla- tional region. A putative polyadenylation signal was found including the stop codon. The synthetic nucleotide (48mer) corresponding to the bovine FSH/? cDNA sequence (Esch et al., 1986) resulted in only one base mismatch.

Northern analysis. Northern analysis of por- cine pituitary RNA (Fig. 2) shows that the length of mRNA encoding the pFSHP subunit is about 1.8 kb. This result is similar to the bovine FSH@ subunit mRNA (1.9 kb) (Esch et al., 1986). One polyadenylation signal was present at 344, includ- ing a termination codon (Fig. l), and there was none in the downstream of the 3’-untranslated region. Because the typical polyadenylation sig-

Fig. 2. Northern analysis of porcine pituitary mRNA for FSH/3 subunit. Polyadenylated RNA (1 pg) was ekctro- phoresed on a 1% ag~ose-fo~~dehyde gel and transferred to nylon membrane. The pFSHj3 subunit cDNA insert was labeled by the random priming method and used as a hybridization probe. The positions of the 18 S and 28 S rRNAs of rat are

indicated.

110

nals are appro~mately 20 nucleotides apart from the poly(A) tail (Proudfoot and Brownlee, 1976) there may be another signal sequence. A long poly(A) tail of 1 kb in the bovine FSHP subunit mRNA is described by Esch et al. (1986). The pFSH/I subunit mRNA (1.8 kb) is considerably longer than mRNAs encoding rat FSHP (0.68 kb long) (Jut&z et al., 1986), other porcine pituitary glycoprotein subunits ((Y, LHP and TSHfl, unpub- lished data) and those of other species.

Comparison with the predicted sequence and the amino acid sequence of the pFSH~ ~~uhu~~t. The

amino acid composition (Closset and Hennen, 1978) and the sequence (Closset et al., 1978) of the pFSH/? subunit were reported. The present results show good correspondence to the composition, but there are some differences in the N-terminal sequence. Moreover, their sequence data were dif- ferent from their amino acid composition analysis of the N-terminal tryptic peptide, Tl, reported in Closset et al. (1978). The sequence deduced from cDNA analysis of this study has no insertion or gap as reported by Closset et al. (Fig. 3). Recently, the partly revised amino acid sequence was listed (Bousfield et al., 1987), which shows the same sequence as this study except two residues at 51

and 52, and the carboxyl ter~nus. As expected, pFSHP is phyloge~cal~y not different. One methionine residue is present at residue 107. Clos- set et al. (1978) found 0.3 residue of methionine and minor serine residue (20%) as carboxyl amino terminal residue, which suggest that their prepara- tion may be a mixture of a whole FSHj3 subunit sequence (l-109) and a deleted one (l-105, serine as the carboxyl terminus). A variability in the carboxyl terminus among different species is shown in Fig. 3. pFSH/3 cDNA shows an ex- tended carboxyl terminal sequence of Met-Lys- Glu, which is not found in the protein sequence (Closset et al,, 1978). Similar extended carboxyl termini in human (Hayashizaki et al., 1985) and porcine TSHp subunits (unpublished data) are found, which are absent from the secretory form. This is interesting if the post-transcriptional processing of the terminus is involved in the as- sociation of (Y and /3 subunits (Pierce and Parsons, (1981).

Comparison of the sequences of FSHj3 subunits. Fig. 3 shows highly conserved sequences. The putative N-glycosy~ation site (Pierce and Parsons, 1981; Closset et al., 1978) and the position of 12 cysteine residues are retained among all molecules.

Porcine” ___~~-_-----,--+~-,~--_

Y L _mm------_-f-,- -__-__--_---____~~~-~~~__ _.._ ._..

c

Bovine R________--------C--- _____ _________ ----R------ _~ _~~~~ _ _..

Human __________A~----_.~-.-~~---_---_---_- ._.. --N----K-__-~_-----_-_- _R

Ovine p-p------.-------‘- __~ ____~~~-_----------B___B_~~ ~. __ ___..

Equine B__Z~~~~--A-._--~-~---~---------_ _---------K__~~~~----_ ___

Fig. 3. A comparison of the predicted porcine FSHg subunit sequence with other sequences of different species. The human (Saxena and Rathnam, 19X+, ovine (Sairam et ai., 1981), equine (Fujiki et al., 1978), and porcine (Closset et al., 1978) sequences were obtained from protein sequencing. The bovine (E!sch et al., 1986) one was from DNA sequencing. The sites of glycosylation and CAGY regions (Pierce and Parsons, 1981) are indicated with (-CHO) and overline, respectively. Symbols, -, A and * , indicate the identical ammo acid residue of this study, insert and gap. t) The sequence of protein (Closset et al., 1978) without the distinction of

the amide form of acidic residues.

103

Q EC cl

201

a

301

403

pFSHP 1 101 201 301

Fig. 4. Harr plot analysis for comparison of the nucleotide

sequences in pFSHP and pLHP subunit cDNAs. The dot

represents the position where ten out of 15 nucleotides match

in the two sequences.

The region important for the biological function, the CAGY region (Mullin et al.,, 1976; Pierce and Parsons, 1981; Hayashizaki et al., 1985), is also retained in the amino acid sequences of FSH/3 and p subunits of other glycoprotein hormones except for the salmon j? subunit (Trinh et al., 1986) but two silent mutations between porcine and bovine are found. In a comparison of the nucleotide sequences in pig and cow (Esch et al., 1986), 19 silent nucleotide changes and six amino acid substitutions, four of which are one base and the others are two base changes, are present. The nucleotide sequence of the coding region of pFSH/? shows 92% homology with the bovine coding re- gion but low homology in the 3’-untranslated re- gion.

Comparison of the sequence of pFSHj3 with pLHj3. Haar plot analysis for comparison of the nucleotide sequences of pFSHj3 and pLHP (Fig. 4) shows some homologies along the molecules, especially in the first 110 nucleotide length of pFSH/3. But this homology is not available to test the cross-hybridization including pTSHP. This se- quence homology between the /3 subunits of gly-

111

coprotein hormones suggests that a common ancestral molecule gave rise to three types of p subunits by duplication as described in Mullin et al. (1976) Fontaine et al., (1977) Pierce and Par- sons (1981).

Acknowledgements

I thank Dr. A.F. Parlow and the NIADDK Pituitary Hormone Program for providing anti- pituitary hormone antibody, and Dr. Y. Hasegawa for preparing the [‘251]Protein A. I am grateful to Mr. T. Hirai and Mr. K. Yoshihama for their technical assistance and former Professor Dr. K. Iwai for his stimulating and helpful discussions. This study was supported in part by a grant from the Ministry of Education, Science and Culture of Japan.

References

Boothby, M., Ruddon, R.W., McWilliams, D. and Boime, I.

(1981) J. Biol. Chem. 256, 5121-5127.

Bousfield, G.R., Liu, W.-K., Sugino, H. and Ward, D.N. (1987)

J. Biol. Chem. 262, 8610-8620.

Closset, J. and Hennen, G. (1978) Eur. J. B&hem. 86,105-113.

Closset, J., Maghuin-Rogister, G., Hennen, G. and Strosberg,

A.D. (1978) Eur. J. B&hem. 86, 115-120.

Counis, R., Corbani, M., Poissonnier, M. and Jutisz, M. (1982)

B&hem. Biophys. Res. Comrnun. 107, 998-1005.

Esch, F.S., Mason, A.J., Cooksey, K., Mercado, M. and

Shimasaki, S. (1986) Proc. Nat. Acad. Sci. U.S.A. 83,

6618-6621.

Feinberg, A. and Vogelstein, B. (1983) Anal. Biochem. 137,

6-13.

Fontaine, Y.-A. and Burzawa-Gerard, E. (1977) Gen. Comp.

Endocrinol. 32, 341-347.

Fujiki, Y., Rathnam, P. and Saxena, B.B. (1978) J. Biol. Chem.

253, 5363-5368.

Hamemik, D.L., Crowder, M.E., Nilson, J.H. and Nett, T.M.

(1986) Endocrinology 119, 2704-2710.

Hattori, M. and Sakaki, Y. (1986) Anal. B&hem. 152.232-238.

Hayashizaki, Y., Miyai, K., Kato, K. and Matsubara, K. (1985)

FEBS Lett. 188, 394-400.

Jutisz, M., Counis, R. and Corbani, M. (1986) in Pars Distalis

of the Pituitary Gland - Structure, Function and Regu-

lation (Yoshimura, F. and Gorbman, A., eds.), pp. 323-330,

Elsevier, Amsterdam. Kato, Y., Kato, T. and Hirai, T. (1987) in Kyoto Prolactin

Conference (Hoshino, K., ed.), Vol. 2, pp. 51-60, Kyoto

University, Kyoto.

Kurosumi, K. and Inoue, K. (1986) in Current Topics in

Neuroendocrinology (Ganten, D. and Pfaff, D., eds.), Vol.

7, pp. 99-134, Springer-Verlag, Berlin-Heidelberg.

112

Lehrach, H., Diamond, D., Wozney, J.M. and Boedtker, H. (1977) Biochemistry 16, 4743-4751.

Mullin, B.R., Fisbman, P.H., Lee, G., Aloj, SM., Lediey, F.D.. Winand, R.J., Kohn. L.D. and Brady, R.O. (1976) Proc. Natl. Acad. Sci. U.S.A. 73, 842-846.

Pierce, J.G. and Parsons, T.F. (1981) Annu. Rev. Biochem. 50, 465-495.

Proudfoot, N.J. and Brownlee, G.G. (1976) Nature 263, 211-214.

Sairam, M.R., Seidah, N.G. and Chretien, M. (1981) Biochem. J, 197, 541-552.

Sanger, F., Nicklen, S. and Coulson, A.R. (1977) Proc. Natl. Acad. Sci. U.S.A. 74, 5463-5467.

Saxena, B.B. and Ratbnam, P. (1976) J. Biol. Chem. 251, 993-100s.

Trinh, K.-Y., Wang, NC, Hew, C.L. and Grim, L.W. (1986) Eur. J. Biochem. 159, 619-624.

Turkey, R.H., Nebert, D.W. and Ncgisbi, M. (1981) J. Biol. Chem. 256, 6969-6974.

Yanisch-Perron, C., Viera, J. and Messing, J. (1985) Gene 33, 103-119.

Young, R.A. and Davis, R.W. (1983) Proc. Natl. Acad. Sci. U.S.A. 80, 1194-1198.