Chemico-Biological Interactions 202 (2013) 116–125

Contents lists available at SciVerse ScienceDirect

Chemico-Biological Interactions

journal homepage: www.elsevier .com/locate /chembioint

A novel transcriptional repressor PhaR for the steroid-inducibleexpression of the 3,17b-hydroxysteroid dehydrogenase gene inComamonas testosteroni ATCC11996

0009-2797/$ - see front matter � 2013 Elsevier Ireland Ltd. All rights reserved.http://dx.doi.org/10.1016/j.cbi.2012.12.014

⇑ Corresponding author. Tel.: +49 431 597 3540; fax: +49 431 597 3558.E-mail address: maser@toxi.uni-kiel.de (E. Maser).

Mingtang Li a,b, Guangming Xiong a, Edmund Maser a,⇑a Institute of Toxicology and Pharmacology for Natural Scientists, University Medical School, Schleswig-Holstein, Campus Kiel, Brunswiker Str. 10, Kiel D-24105, Germanyb College of Resource and Environmental Science, Jilin Agricultural University, Changchun 130118, PR China

a r t i c l e i n f o

Article history:Available online 4 January 2013

Keywords:Repressor PhaR3,17b-HSDShort-chain dehydrogenases/reductasesComamonas testosteroniPhaR Knock-out mutant

a b s t r a c t

Comamonas testosteroni is able to catabolize a variety of steroids and polycyclic aromatic hydrocarbonsand might be used in the bioremediation of contaminated environments. 3,17b-Hydroxysteroid dehydro-genase (3,17b-HSD) from C. testosteroni is a member of the short-chain dehydrogenase/reductase (SDR)superfamily and a key enzyme in steroid degradation. The genome of C. testosteroni ATCC11996 wassequenced in our previous work. In addition to the gene coding for 3,17b-HSD (bhsd), a novel transcrip-tional repressor phaR gene (phaR) which locates 2290 bp upstream of the bhsd gene was found. PhaRknock-out mutants of C. testosteroni were prepared and shown to grow better than wild-type C. testoste-roni in the presence of 1 mM testosterone, 0.5 mM estradiol or 0.5 mM cholesterol in both Standard 1Nutrient (SIN) medium and 1:10 diluted SIN medium. After 1 mM testosterone induction, 3,17b-HSDexpression in the mutant was 2.5 times higher than in wild type C. testosteroni. Accordingly, PhaR is arepressor that controls 3,17b-HSD expression. Moreover, phaR knock-out mutants grow at higher ratesand produce more protein in the presence of steroids as carbon source. However, ELISA results showedthat 0.5 mM estradiol and cholesterol could not induce bhsd gene expression in both wild-type andmutant C. testosteroni. Probably, in addition to the bhsd gene, PhaR regulates some other genes that relateto steroid degradation. The genes coding for PhaR and 3,17b-HSD together with their promoter domainswere cloned into plasmids pK18 and pUC19. Escherichia coli HB101 was co-transformed with these plas-mids. The results suggest that PhaR is a repressor, which might bind on a special bhsd promoter domain(214 bp). A 2509 bp DNA fragment that contained a putative promoter for the bhsd gene (without thephaR gene) was cloned into plasmid pUC2.5-3. The plasmid was transformed into HB101 (E. coli) andinduced with testosterone. As a result, 3,17b-HSD expression was at a high level, but could not be furtherenhanced by testosterone. Taken together, phaR knock-out mutants have better ability to degrade ste-roids than wild-type C. testosteroni ATCC11996 and might therefore be used in bioremediation.

� 2013 Elsevier Ireland Ltd. All rights reserved.

1. Introduction

Human activities have resulted in the release and introductioninto the environment of a wide range of aromatic chemicals andsteroid compounds. These environmental pollutants can have toxiceffects or provide new carbon sources for bacteria which haveadapted their metabolism to degrade these compounds [1–3].Comamonas testosteroni is a Gram-negative bacterium which cangrow well on organic acids and amino acids [4]. Moreover, this bac-terium is able to grow on steroids or aromatic hydrocarbons as solecarbon and energy source and thus may represent an importantmeans in the mineralization of these stable compounds. 3a-

Hydroxysteroid dehydrogenase/carbonyl reductase (3a-HSD/CR)from C. testosteroni ATCC11996 is a member of the short-chaindehydrogenase/reductase (SDR) superfamily and a key enzyme in-volved in steroid degradation. It can catalyze the conversion of hy-droxyl groups to oxo groups at position three of the steroid nucleusof a great variety of C19–27 steroids [5,6]. The gene, hsdA, encoding3a-HSD/CR, can be induced by testosterone, progesterone and cho-lic acid [5–7]. Thus, the mechanism of steroid-dependent gene reg-ulation of hsdA attracted great interest in our lab. Initially we foundthat induction of hsdA by steroids is a de-repression where steroi-dal inducers bind to two repressor proteins, RepA and RepB, there-by preventing blocking of hsdA transcription and translation,respectively [8,9]. We have also reported that a LysR-type tran-scriptional regulator hsdR (3a-HSD/CR regulator) was identifiedto activate the expression of hsdA at the transcriptional level [10].

M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125 117

Pruneda-Paz et al. reported that another enzyme of the SDRsuperfamily, 3,17b-hydroxysteroid dehydrogenase (3,17b-HSD),from C. testosteroni ATCC11996 may be a key enzyme involved insteroid degradation [11]. The gene, bhsd (765 bp), encoding3,17b-HSD, can also be induced by testosterone. In their studies,Pruneda-Paz et al. investigated the promoter domain of the bhsdgene and reported on repeat sequences present in a 3.2 kb DNAfragment of C. testosteroni in that region.

Recently, we published the complete sequence of the C. testos-teroni ATCC11996 genome [12]. According to the sequences de-rived thereof (Fig. 1 and 2), the promoter that regulates the genefor 3,17b-HSD (2407–3172 bp) expression is located on 663–877 bp. Pruneda-Paz et al. reported that only one promoter wasfound in the 3.2 kb DNA fragment. Both sip48 (1383 bp) and bhsdcould be induced by testosterone on the transcriptional level. Insip48 knock-out mutants the bhsd gene also became silent afterinduction [11].

Normally, inducible genes contain operator(s) for the binding ofregulator protein(s) [13,14]. To this operator domain(s), repres-sor(s) may bind and block target gene expression. On the otherhand, inducer molecules (testosterone) might form a complex withthe repressor protein(s) to promote target gene transcription. Thisis one of the mechanisms of gene ‘‘induction’’ which we know to-day. Our bioinformatics studies revealed that the sip48 gene de-scribed by Pruneda-Paz et al. [11] might be rseB which could beinduced and expressed together with bhsd in a polycistronic man-

Fig. 1. Fragment containing the 3.182 kb DNA sequence of the C. testosteroni chromos0.546 kb), rseB (a periplasmic negative regulator of the alternative sigma factor sigma E;ATCC11996 sequencing [12].

ner. In other words, rseB (sip48) is probably not a regulating genefor 3,17b-HSD expression because it shares the same promoter inthe 3.2 kb DNA fragment as the bhsd gene [11]. The protein rseB(a periplasmic negative regulator of the alternative sigma factorsigma E) is known as a negative regulator in Escherichia coli, whereit inhibits proteolysis by DegS in vitro by binding tightly to theperiplasmic domain of RseA [15].

In our bioinformatics analyses, we found a potential repressorgene, phaR (546 bp, coding for polyhydroxyalkanoate synthesisrepressor), 2290 bp upstream of the bhsd gene, which could possi-bly be involved in bhsd gene regulation. In the present study, thephaR gene was cloned and expressed in E. coli. PhaR knock-out mu-tants of C. testosteroni were prepared. Our results suggest that PhaRbinds to the repeat sequences and negatively regulates 3,17b-HSDexpression.

2. Materials and methods

2.1. Bacterial strains and growth conditions

Host strains E. coli HB101 (Promega) and C. testosteroniATCC11996 (Deutsche Sammlung für Mikroorganismen) were usedfor cloning and gene expression. Cloning of PCR fragments was car-ried out in pCR2.1-TOPO (Invitrogen). The target genes were sub-cloned into plasmid pUC18 (Invitrogen). Plasmid pK18 containing

ome. Indicated are three genes, phaR (polyhydroxyalkanoate synthesis repressor;1.383 kb), bhsd and three potential promoters which were found by C. testosteroni

Fig. 2. Subcloning of the bhsd gene containing constructs. The phaR gene was cloned into plasmid pK18. DNA fragments with 0.765 kb and 0.912 kb which contain the bhsdgene (pUC765-2 and pUC765-8) and its potential promoter (pUC912-10 and pUC1126-5) were cloned into plasmid pUC18. Upstream of the bhsd gene there is a lac promoterin pUC765-8.

118 M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125

the kanamycin resistance gene was a gift from Ciba PharmaceuticalsInc., Department of Biotechnology (Basel, Switzerland) [16]. To over-express and purify 3,17b-HSD and PhaR proteins, E. coli strain BL21(DE3) was transformed with plasmid pET15b from Novagen. Bacte-rial cells were grown in a shaker (180 rpm) in SIN medium (Stan-dard I Nutrient broth medium, Merck, Darmstadt) at 37 �C (E. coli)or 27 �C (C. testosteroni ATCC11996). Growth media contained100 lg/ml ampicillin and 30 lg/ml kanamycin if necessary.

2.2. Enzymes, kits and other reagents

Restriction enzymes were obtained from Boehringer Mann-heim, Biolabs, MBI and Amersham, and used according to the man-ufacturer’s instructions. Shrimp alkaline phosphatase was fromUSB. T4 DNA ligase and Taq DNA polymerase were from Fermentas.TOPO TA cloning kit was from Invitrogen. QIAGEN Plasmid Midi Kitwas from QIAGEN. Ampicillin and kanamycin were from AGS, Hei-delberg. All other chemicals were of analytical grade and obtainedfrom commercial suppliers. Testosterone, estradiol and cholesterolwere supplied by Sigma.

2.3. DNA manipulations, sequencing

Recombinant DNA work was carried out following standardtechniques according to Sambrook and Russel [17]. The fragmentscloned in this work are shown in Fig. 2. All of the primers were pre-pared by MWG (Ebersberg, Germany). Before further cloning, frag-ments prepared by PCR were cloned into pCR2.1-TOPO and thenchecked for correct sequence by MWG.

2.4. Isolation of chromosomal DNA of C. testosteroni

To isolate and clone the phaR and bhsd genes, chromosomalDNA of C. testosteroni was isolated by phenol/chloroform extrac-tion. One ml of overnight culture of C. testosteroni cells was har-vested by centrifugation at 13,000 rpm for 20 s and thenresuspended in 1 ml distilled water containing 1 lg lysozyme.

Cells were lysed by freezing (�20 �C, 30 min) and thawing (at roomtemperature, 30 min) three times. DNA was then recovered fromthe lysate by phenol/chloroform extraction, followed by ethanolprecipitation. The DNA was suspended in TE buffer (10 mM Tris–HCl, 1 mM EDTA, pH 8) and stored at 4 �C. The purified chromo-somal DNA was used for target gene PCR.

2.5. Gene cloning and plasmid preparation

C. testosteroni chromosomal DNA was used as a template forPCR amplification of phaR, bhsd and promoters. Primers P1 andP2 were used to clone the DNA fragment which contains promoter1, rseB, promoter 2, and bhsd (Table 1). The resulting fragment wascloned into pCR2.1-TOPO. After control sequencing, SalI and HindIIIwere used to subclone the 2.509 kb fragment into pUC19 (ampicil-lin resistant) to yield plasmid pUC2.5-3. Primers P3 and P4 wereused to clone the phaR gene into pCR2.1-TOPO and pK18 (kanamy-cin resistant). In plasmid pKPhaR-11 the lac promoter locates up-stream of the phaR gene. P5 and P6 were used to prepare thephaR knock-out plasmid pTOPO-300-10. Here, P5 contained anadditional ‘‘G’’ (italics) after ‘‘ATG’’ to form a reading frame shiftmutant (Table 1) (Fig. 3a). P7 and P8 were used to confirm theknock out by PCR. Pa1, Pb and Pc were used to clone the promotersand the bhsd gene into pUC19. Plasmids pUC1126-5 (bearing pro-moter 1 and promoter 2), pUC912-10 (bearing promoter 2),pUC765-2 (without promoter) and pUC765-8 (bearing the lac pro-moter) were obtained by subcloning according to Fig. 2. Finally, thephaR-containing plasmid pKPhaR-11, which contains the kanamy-cin resistant gene and other bhsd fragments, were cloned into theampicillin resistant plasmid pUC19 (Fig. 2). PUC19 and pK18 arecompatible plasmids for E. coli HB101 cotransformation.

2.6. Protein purification and antibody preparation

The plasmid pTOPO-3,17b-HSD and pKPhaR-11 were digestedwith NdeI and BamHI. The resulting DNA fragments containingthe bhsd (765 bp) and phaR (546 bp) genes were isolated with

Table 1Primers for DNA fragment preparations by PCR.

Name Sequence Direction Usage

P1 TGCGTCGACCTGAACGAAATCTGC Forward

SalIP2 CCCAAGCTTCTATAGCCCCATGCC Reverse pUC2.5-3 (2.509 kb)

HindIII (promoter 1 + RseB + promoter 2 + 3,17ß-HSD)P3 CGCCATATGCAAGAAAACAAA Forward

NdeIP4 CGGGATCCTCAGCGCTTGATGCC Reverse pKPhaR-11 (546 bp)

BamHIP5 ATGGCAAGAAAACAAAGAG Forward

P6 CTGCATGGCATGACCATA Reverse PhaR Knock-out (300 bp)P7 GAACATAAAGGACTTGCG ForwardP8 GTAACGGCCGCCAGTGTG Reverse Proof of PhaR Knock-outPa1 GCCGCATTCATTTTGCCTAGTCTCCTTG pUC1126-5 (1.126 kb)

(Promoter 1 + Promoter 2 + 3,17ß-HSD)Pb AAAATGAATGCGGCAAACAG Forward pUC912-10 (912 bp)

(Promoter 2 + 3,17ß-HSD)Pc ATGACAAATCGTTTGCAGGG Forward pUC765-8, pUC765-2 (765 bp)

(3,17ß-HSD)

M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125 119

low melting agarose and cloned into expression plasmid pET-15b.The proteins were expressed in BL21 (E. coli) cells with 1 mM IPTGinduction. After 5 h induction, 3,17b-HSD and PhaR were purifiedon a Ni-column [10]. An amount of 200 lg purified protein wasused to prepare antisera in rabbits [11]. The antisera were usedto quantify the expression of 3,17b-HSD in HB101 and C. testoste-roni cells with ELISA.

2.7. Protein determination

Protein concentration was determined by the method of Brad-ford with Roti-Quant solution (Roth) using bovine serum albuminas standard [18].

2.8. ELISA of 3,17b-HSD

3,17b-HSD protein expression in C. testosteroni was quantifiedafter induction with steroids by a specific ELISA established inour laboratory. C. testosteroni and mutants were cultured in SINmedium which contained 0.5 mM testosterone, 0.25 mM estradiolor 0.25 mM cholesterol, respectively. After 20 h, 1 ml of the cellsuspension was used to isolate bacterial proteins. Lysozyme(100 lg/ml) was added to 200 ll bacterial suspension. After threetimes freezing and thawing (30 min each), total protein was sepa-rated by 13,000 rpm centrifugation for 20 min. Protein concentra-tion was determined, and adjusted to 1 mg/ml. Protein sampleswere diluted to 2.5 lg/ml with coating buffer (pH 9.6). ELISA plateswere coated with 200 ll of total protein/well containing 3,17b-HSD. After washing, antibodies against 3,17b-HSD (1:1000 dilu-tion) were added. The further procedure corresponded to that ofthe CAT ELISA kit from Boehringer, Mannheim. Antibodies against3,17b-HSD protein were generated by a procedure which has beendescribed previously for 3a-HSD [19]. Antibody titer determina-tion in the rabbit serum was performed by western blotting. Thespecificity for 3,17b-HSD and the detection limit was sufficientfor establishing an ELISA for 3,17b-HSD determination.

2.9. Preparation of a phaR knock-out mutant of C. testosteroni

In order to investigate the functions of PhaR in C. testosteroni, aphaR knock-out mutant of C. testosteroni was prepared by homolo-gous integration and additional reading frame-shift mutation. Theentire phaR gene contains 546 bp. For preparing a phaR knock-outmutant the primers P1 and P2 (Table 1) were used for PCR. A

300 bp PCR fragment was cloned into plasmid pCR2.1-TOPO, whichcontained the kanamycin resistant gene. The knock-out mutationwas verified by PCR.

2.10. Identification of the phaR knock-out mutant of C. testosteroni

Two primers, P7 and P8, were used to verify the correct insertintegration into the phaR knock-out mutant M6 by PCR. Chromo-somal DNA of the knock-out mutant M6 was purified accordingto point 2.4. The primers were complementary to vector plasmidpCR2.1-TOPO and the chromosomal DNA of the mutant.

2.11. Statistics

For statistical analysis at least four repeated experiments (n = 4)were performed. The data are expressed as mean ± SD and wereobtained from ‘‘Microsoft Excel’’ software. The ‘‘Graph Pad’’ soft-ware (Inc, La Jolla, CA92037, USA) was applied for the Student’st-test to obtain p-values. Significant levels were set at ⁄p < 0.05,⁄⁄p < 0.01.

3. Results

3.1. PhaR gene cloning

As shown in Fig. 1, phaR consists of 546 bp and locates 2290 bpupstream of the bhsd gene. Probably, phaR has its own promoter.The phaR gene was isolated by PCR and cloned into plasmidpCR2.1-TOPO to yield pTOPO-PhaR. After control sequencing, the546 bp fragment was subcloned into plasmid pK18 (yieldingpKPhaR-11). The original lac promoter from plasmid pK18 wascloned upstream to the phaR gene. Therefore, PhaR could be ex-pressed in E. coli HB101 cells after transformation (Fig. 2).

3.2. Cloning of a phaR knock-out plasmid and preparation of a phaRknock-out mutant of C. testosteroni

A 300 bp DNA fragment was prepared by PCR with pKPhaR-11as the template. On the 50 end an additional ‘‘G’’ was inserted(Fig. 3a). The fragment was cloned into pCR2.1-TOPO (yieldingpTOPO-300-10). After homologous integration, the phaR genewas split into two parts. Because of the additional ‘‘G’’, the readingframe of part aB was shifted and the part Ab of phaR expressed intruncated form. This procedure should result in a phaR knock-out

Fig. 3. (a) PhaR knock-out mutant preparation. According to DNA sequence analyses, the phaR gene locates 2.290 kb upstream of the bhsd gene. PhaR is a potential repressorof 3,17b-HSD expression. Plasmid pTOPO-300-10 was transformed into C. testosteroni cells. After homologous integration, phaR gene knock-out mutants of C. testosteroni wereisolated. The mutants are kanamycin resistant. (b) PCR proof of the phaR gene knock-out in mutant M6.

120 M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125

mutant M6. With the following PCR the correct phaR knock-outmutant M6 was verified. As shown in Fig. 3b, the expected597 bp DNA fragment, containing the sequences of pCR2.1-TOPOand the phaR gene, was found upon agarose gel electrophoresis.

3.3. Growth of wild type C. testosteroni and the phaR knock-outmutant with steroids

Wild type C. testosteroni and the phaR knock-out mutant M6were cultured in SIN medium with 1 mM testosterone, 0.5 mMestradiol and 0.5 mM cholesterol. After overnight culture, 1 ml bac-terial suspension was collected by centrifugation and total proteincontent was determined. Compared to the controls without ste-roids, total protein in the phaR knock-out mutant M6 considerablyincreased in the presence of testosterone or estradiol (Fig. 4).3,17b-HSD is a key enzyme for steroid degradation in C. testoste-roni. The fact that phaR knock-out mutants grew better on steroidsthan wild type C. testosteroni suggests that PhaR acts as a repressorfor 3,17b-HSD expression.

3.4. 3,17b-HSD protein purification, antibody preparation and ELISA

For determination of 3,17b-HSD expression in C. testosteroni theplasmid pET17b-HSD21 was transformed into E. coli BL21 cells. Thecells were induced with IPTG for 5 h and 3,17b-HSD was purifiedon a Ni-column (Fig. 5). To generate antibodies, two rabbits wereimmunized with purified 3,17b-HSD protein. The antibodies wereused to quantify 3,17b-HSD expression in wild-type and mutantcells of C. testosteroni by ELISA.

3.5. PhaR knock-out mutants express higher levels of 3,17b-HSD aftertestosterone induction

Wild-type C. testosteroni and phaR knock-out mutants M6 werecultured in SIN medium and induced with 1 mM testosterone,0.5 mM estradiol or 0.5 mM cholesterol. ELISA was used to deter-mine 3,17b-HSD expression in C. testosteroni and M6 cells. Asshown in Fig. 6, testosterone induction resulted in a much higher3,17b-HSD expression in M6 cells than in wild-type C. testosteroni.

Fig. 4. Total protein in mutant cells after steroid induction. Wild-type C. testosteroniATCC11996 and phaR knock-out mutants M6 were cultured with 1 mM testoster-one, 0.5 mM estradiol or 0.5 mM cholesterol. As a result, the total protein of thebacteria increased after incubation especially with testosterone and estradiol in theM6 mutants.

Fig. 5. Overexpression and purification of the 3,17b-HSD protein. The bhsd genewas cloned into plasmid pET-15b and expressed in E. coli BL21 after 1 mM IPTGinduction. A mini nickel-nitrilotriacetic acid (Ni–NTA) column (Qiagen) was used topurify the 3,17b-HSD protein. SDS–PAGE revealed the pure protein, which was usedto prepare specific antibodies. M, protein marker; T, total protein of induced BL21culture; E1–4, elution 1–4 (100 ll each).

Fig. 6. Estradiol and cholesterol could not induce 3,17b-HSD expression. 3,17b-HSDexpression in the phaR knock-out mutant (M6) and wild-type C. testosteroniATCC11996 were determined after induction with 1 mM testosterone, 0.5 mMestradiol or 0.5 mM cholesterol. Without PhaR the knock-out mutant M6 expressedmuch more 3,17b-HSD than wild-type C. testosteroni after testosterone induction.Estradiol and cholesterol could not induce 3,17b-HSD expression.

Fig. 7. Estradiol and cholesterol inhibit testosterone induction. 3,17b-HSD expres-sion in the phaR knock-out mutant (M6) and wild-type C. testosteroni ATCC11996was determined after induction with 0.5 mM testosterone, 0.5 mM testoster-one + 0.5 mM estradiol or 0.5 mM testosterone + 0.5 mM cholesterol in SINmedium. The result showed that estradiol and cholesterol could inhibit testosteroneinduction. Estradiol and cholesterol might compete with binding to therepressor(s).

Fig. 8. 3,17b-HSD expression in wild-type C. testosteroni ATCC11996 after inductionwith different concentrations of testosterone and estradiol.

M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125 121

Accordingly, PhaR indeed seems to be a repressor which controls3,17b-HSD expression in C. testosteroni. Estradiol and cholesterolcould not induce 3,17b-HSD expression in both phaR knock-outmutants and wild-type C. testosteroni cells.

3.6. Estradiol and cholesterol inhibit testosterone induction of 3,17b-HSD expression in both wild-type and mutant C. testosteroni

Wild-type C. testosteroni and the phaR knock-out mutant M6were incubated with a combination of testosterone plus estradiolor testosterone plus cholesterol. Interestingly, the inducing effect

of testosterone on 3,17b-HSD expression in both wild-type C. test-osteroni and the phaR knock-out mutants M6 cells was inhibited byestradiol and cholesterol (Fig. 7). This inhibition was stronger inM6 cells than in wild type C. testosteroni. At present, we do notknow the inhibiting mechanism, but this effect might be used fortestosterone, estradiol or cholesterol determination in unknownsamples. As already seen in Fig. 6, 3,17b-HSD expression after tes-tosterone induction was higher in M6 cells compared to wild typeC. testosteroni, which again indicates that PhaR is a repressor for3,17b-HSD expression in C. testosteroni.

3.7. Quantification of testosterone by 3,17b-HSD expression in C.testosteroni

Wild-type C. testosteroni was cultured in SIN medium with dif-ferent concentrations of testosterone. After 20 h, ELISA was used todetermine 3,17b-HSD expression (Fig. 8). Testosterone in concen-trations ranging between 0.5 mM and 500 nM in the culture med-ium could be detected indirectly by this method. The result inFig. 8 suggests that bhsd induction may be used for quantitativeanalyses of testosterone concentrations in certain media. Estradiolcould not be quantified by this method.

3.8. Quantification of estradiol by inhibition of 3,17b-HSD expression

With a slight modification, estradiol could be determined bythis method as well. A fixed concentration of testosterone

122 M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125

(0.5 mM) was used together with decreasing concentrations ofestradiol in the medium (Fig. 9). Estradiol, in a range between0.5 mM and 500 nM, inhibited 3,17b-HSD expression after testos-terone induction in a concentration dependent manner. This pat-tern of inhibition may be used to indirectly quantify estradiol inthe bacterial medium. Clearly, this procedure is not suitable todetermine estrogen in samples that contain several different ste-roid compounds. The phaR knock-out mutant M6 could also notbe used for this determination (data not shown).

3.9. Promoter and phaR regulation domain of the bhsd gene in C.testosteroni

Usually, repressor proteins that bind to the promoter domain oftheir target gene regulate specific gene expression on the tran-scriptional level. We prepared several plasmids that contained dif-ferent promoters: promoter 1 and promoter 2 derived from thechromosomal DNA of C. testosteroni with localization upstream ofthe bhsd gene, and the common lac promoter from the lactose op-eron. The plasmids were transformed into E. coli HB101, and 3,17b-HSD expression was determined by ELISA. The lac promoter wascloned upstream to the bhsd gene in plasmid pUC765-8 and servedas positive control (Figs. 2 and 10). When plasmid pUC765-8 wasco-transformed together with plasmids pKPhaR-11 or pK18 intoE. coli HB101 cells, large amounts of 3,17b-HSD (up to 130 lg/mgprotein) were expressed in cells with the pUC765-8 and pK18 com-bination. On the other hand, 3,17b-HSD expression decreased by50% in cells with the pUC765-8 and pKPhaR-11 combination. This

Fig. 9. 3,17b-HSD expression in wild-type C. testosteroni ATCC11996 after inductionwith testosterone and different concentrations of estradiol.

Fig. 10. 3,17b-HSD expression in E. coli HB101. Cells were co-transformed withplasmids pUC765-8 (bhsd) plus pK18 (control) or pUC765-8 (bhsd) plus pKPhaR(with the repressor gene phaR). ELISA results reveal that PhaR is a repressor for3,17b-HSD expression in C. testosteroni.

again reveals that PhaR is a repressor for 3,17b-HSD expression,which also works in the E. coli system. Whereas 3,17b-HSD expres-sion did not change after testosterone induction without pKPhaR-11, PhaR inhibition towards 3,17b-HSD expression was almostabolished by testosterone (Fig. 10).

The E. coli system does not contain natural repressors, thereforetestosterone induction could not influence 3,17b-HSD expression(Fig. 11). Plasmid pUC765-2 does not contain any promoter of bhsd,pUC912-10 contains promoter 2 and pUC1126-5 contains bothpromoter 1 and promoter 2 from C. testosteroni chromosomalDNA. Highest expression of 3,17b-HSD was obtained with plasmidpUC912-10, revealing that only promoter 1 is of relevance with re-gard to 3,17b-HSD expression (Figs. 2 and 11). The cells containingboth promoter 1 and promoter 2 (pUC1126-5) expressed lowerlevels of 3,17b-HSD. Pruneda-Paz et al. [11] reported that promoter1 regulates 3,17b-HSD expression. It is possible that the potentialpromoter 1 is not recognized in our E. coli system.

In a next approach, E. coli HB101 cells were co-transformed withplasmids pUC765-2, pUC912-10 or pUC1126-5 together witheither pK18 (control) or phaR containing plasmid pKPhaR-11. Asshown in Fig. 12, 3,17b-HSD expression was inhibited by PhaRwhen promoter 1 and promoter 2 (pUC1126-5) or only promoter2 (pUC912-10) were present. No inhibition was found in the ab-

Fig. 11. The bhsd gene promoter 1 could not be recognized in E. coli. According tothe results of Pruneda-Paz et al. [11], promoter 1 regulates bhsd gene induction. Thepotential promoter 2 was cloned together with the bhsd gene into plasmid pUC912-10, while both promoters 1 and 2 were cloned into pUC1126-5. The plasmids weretransformed into E. coli HB101. ELISA results reveal that low levels of 3,17b-HSDwere expressed in HB101 with pUC765-2 (without promoter), while promoter 2 inpUC912-10 yielded a high bhsd gene expression. Since pUC1126-5 resulted in alower expression of 3,17b-HSD, we believe that promoter 1 is not recognized in theE. coli system.

Fig. 12. 3,17b-HSD expression in E. coli HB101. Plasmids pUC765-2, pUC912-10 andpUC1126-5 were cotransformed with either the repressor gene containing plasmidpKPhaR-11 or the empty vector pK18 into E. coli HB101. PhaR only inhibits bhsdgene expression when HB101 cells contain either promoter 2 or promoter 1 and 2.

Fig. 13. 3,17b-HSD expression in E. coli HB101 after testosterone induction.Plasmids pUC765-2, pUC912-10 and pUC1126-5 were cotransformed with therepressor gene containing plasmid pKPhaR-11 and additionally induced withtestosterone. ELISA results reveal that testosterone induces bhsd gene expression incells with pUC765-2 and slightly with pUC1126-5, but not with pUC912-10.

M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125 123

sence of any C. testosteroni promoters (pUC765-2). Finally, plas-mids pUC765-2, pUC912-10 and pUC1126-5 were co-transformedwith the repressor gene phaR (plasmid pKPhaR-11) and addition-ally induced with testosterone. ELISA results reveal (Fig. 13) that3,17b-HSD expression increased with pUC765-2 and pUC1126-5in the presence of pKPhaR-11 and testosterone, whereas PhaRcould significantly abolish the inducing effect of testosterone withpUC912-10 and pKPhaR-11. Thus, it again appears that promoter 2is important for regulating 3,17b-HSD expression both in the pres-ence or absence of the inducer testosterone. Plasmids pKPhaR-11and pUC2.5-3, which contain promoter 1, promoter 2 and the rseBgene, were co-transformed into E. coli HB101. 3,17b-HSD expres-sion was similar to that of pKPhaR-11 and pUC1126-5 after testos-terone induction (data not shown). The results also reveal thatE. coli HB101 can be used for the determination of PhaR activityand 3,17b-HSD expression.

Fig. 14. Two repeat sequences upstream of the bhsd gene. Two repeat sequences (13 bpupstream of the bhsd gene. Between these repeat sequences there are 1661 bp which mawhich the repressor PhaR may bind.

3.10. PhaR protein purification

For future experiments on the quantification of the PhaR pro-tein in our assays, as well as determining PhaR binding to theDNA, we sought to prepare antibodies against PhaR. PlasmidpKPhaR-11 was digested with BamHI and NdeI and the resulting546 bp fragment was subcloned into expression plasmid pET-15bto obtain pET-PhaR-10. For PhaR protein purification, six histidinecoding triplets were added to the N-terminus of the phaR gene inpET-PhaR-10. The plasmid was transformed into E. coli BL21 andthe cells were induced with 1 mM IPTG for 5 h. Purified PhaR pro-tein was produced on a Ni-column (data not shown). The purifiedprotein will be used for rabbit immunization and antibodypreparation.

4. Discussion

Compared to eukaryotic systems, the mechanism of steroid reg-ulation [20] was largely unknown in bacteria until now. It has longbeen postulated that prior to their degradation, steroids require asignaling system that mediates their recognition and transporta-tion through the bacterial plasma membrane as well as ensuringaccumulation and catabolism of the steroid substrates in the cyto-plasm. The Gram-negative proteobacterium C. testosteroni hasserved as an important model organism for bacterial steroid degra-dation for several decades [21]. With two-dimensional gel electro-phoresis, we previously found that testosterone induced theexpression of several steroid catabolizing enzymes in C. testosteroniATCC11996 [5]. We then focused on the regulation of the gene(hsdA) encoding 3a-HSD/CR, one of the enzymes being consideredat the beginning of the steroid degradation pathway [5,6,22]. Weidentified two genes coding for negative regulators of hsdA expres-sion, repA and repB. Whereas RepA was found to block hsdA tran-scription, RepB was proven to interfere with hsdA translation[8,9]. Later, the teiR gene and lysR gene encoding positive regula-tors of steroid-degrading enzymes, including 3a-HSD/CR, were

; in bold letters in the upper panel; un-filled circles in the lower panel) were foundy form a DNA loop structure (A) or represent two separated repeat sequences (B) to

124 M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125

identified in C. testosteroni ATCC11996 by transposon mutagenesis[23,10].

It was reported that 3,17b-HSD is another important enzyme forsteroid degradation in C. testosteroni ATCC11996 [11]. Like 3a-HSD/CR, it is a steroid inducible enzyme, but the mechanism ofits regulation was not clear until now. In the present study, phaRknock-out mutants of C. testosteroni proved that PhaR is a repressorthat inhibits 3,17b-HSD expression. Further, 3,17b-HSD expressioncould be induced to higher levels in phaR knock-out mutants thanin wild-type cells of C. testosteroni (Figs. 4 and 6). Regarding posi-tive regulation, we could only find an enhanced expression of thebhsd gene by testosterone induction. Without testosterone, bothmutant and wild-type C. testosteroni expressed the same levels of3,17b-HSD. When looking at the complex regulation of the hsdAgene, it is quite possible that other (positive) regulators than PhaRmight control bhsd gene expression in C. testosteroni.

According to the genome sequence of C. testosteroni [12] and theresults from Pruneda-Paz et al. [11], several potential repressorgenes locate near the bhsd gene in C. testosteroni ATCC11996. Oneof them, the phaR gene, is located 2290 bp upstream of the bhsdgene on the 3.2 kb fragment (Fig. 2). The PhaR protein possibly bindsto the promoter domain(s) and blocks bhsd gene expression.

Overall, three potential promoters could be found in the rele-vant DNA fragment (Fig. 1). Since PhaR has been clearly verifiedas being a repressor for the bhsd gene, the promoter which locatesupstream of the phaR gene should not be the promoter for 3,17b-HSD expression. Another two potential promoters, promoter 1and promoter 2 (Fig. 2), might come into question for bhsd generegulation. Determination of their activity with ELISA in E. coliHB101 (Fig. 11) revealed that only promoter 2 controls bhsd geneexpression. With both promoters, 1 and 2, bhsd gene expressionwas not induced, because E. coli HB101 does not contain the phaRgene. Similar to the results from Pruneda-Paz et al. [11], we foundthat promoter 2 is not induced by testosterone, but it is able to reg-ulate bhsd gene expression in C. testosteroni. Probably, the E. colisystem could not recognize promoter 1 from C. testosteroni, whichcould be the reason for the lower 3,17b-HSD expression withpUC1126-5 (containing promoter 1 and 2).

Interestingly, instead of promoter 2, a strong lac promoter fromE. coli was cloned upstream to the bhsd gene in plasmid pUC765-8.After co-transformation with the phaR gene (pUC765-8 andpKPhaR-11), 3,17b-HSD expression was inhibited and this inhibi-tion was reversed after testosterone induction (Fig. 10). Here, itmay be that the bhsd gene itself contains a PhaR binding domain.

As shown in Fig. 14, two repeat (12 bp) sequences (RS1, RS2)were found upstream of promoter 1 and promoter 2, respectively.Between the two promoters, the rseB gene (sip48, 1383 bp) is lo-cated (Figs. 1 and 2). It is quite possible that the repeat sequencesform a loop structure, such that PhaR may bind to this hybridizeddomain (Fig. 14). So far, we cloned the two promoters (includingthe repeat sequences) in plasmid pUC1126-5. However, in this con-struct there are only 262 bp left between the repeat sequencessuch that no stable loop structure could be formed. Accordingly,with plasmid pUC1126-5 and pKPhaR-11 we did not find repressoractivities (data not shown).

Wild type C. testosteroni ATCC11996 could be used to determinetestosterone and estradiol concentrations in the culture mediumindirectly via bhsd gene expression by ELISA. The phaR knock-outmutant M6 was not suitable for this procedure. The reason maybe as follows: normally, PhaR binds to the repeat sequences andinhibits bhsd gene expression. Testosterone and estradiol bind toPhaR and prevent binding of PhaR to the repeat sequences, suchthat bhsd gene expression may proceed. PhaR knock-out mutantM6 cannot perform this de-repression of the bhsd gene and cantherefore not be used for this indirect steroid quantificationmethod.

Taken together, PhaR can be considered as an important playerin the steroid dependent signaling network in C. testosteroni. Over-all, the function and mechanism of PhaR in C. testosteroni is aninteresting and complex subject. We have cloned and purified PhaRon a Ni-column, and we plan for mobility electrophoresis to locatePhaR binding to the corresponding DNA fragment (EMSA) and forfootprinting analysis of the PhaR-DNA binding domain in our fu-ture work.

5. Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgments

This study was supported by a grant from the DeutscheForschungsgemeinschaft (MA 1704/4-1; MA 1704/4-2) and theexcellence Cluster ‘‘The Future Ocean’’. The German AcademicExchange Service (Deutscher Akademischer Austausch Dienst,DAAD) and China Scholarship Council are acknowledged forfinancial support.

References

[1] D.H. Pieper, W. Reineke, Engineering bacteria for bioremediation, Curr. Opin.Biotechnol. 11 (2001) 262–270.

[2] T. Zhang, G. Xiong, E. Maser, Characterization of the steroid degradingbacterium S19-1 from the Baltic Sea at Kiel, Germany, Chem. Biol. Interact.191 (2010) 83–88.

[3] Y. Sang, G. Xiong, E. Maser, Steroid degradation and two steroid-inducibleenzymes in the marine bacterium H5, Chem. Biol. Interact. 191 (2011) 89–94.

[4] A. Willems, P. de Vos, J. de Ley, A. Balows, H.G. Trueper, M. Dworkin (Eds.), TheProcaryotes: A Handbook on the Biology of Bacteria Ecophysiology, Isolation,Identification and Applications, Springer-Verlag, Berlin, 1992, pp. 2583–2590.

[5] E. Möbus, M. Jahn, R. Schmid, D. Jahn, E. Maser, Testosterone-regulatedexpression of enzymes involved in steroid and aromatic hydrocarboncatabolism in Comamonas testosteroni, J. Bacteriol. 179 (1997) 5951–5955.

[6] E. Möbus, E. Maser, Molecular cloning, overexpression, and characterization ofsteroid-inducible 3a-hydroxysteroid dehydrogenase/carbonyl reductase fromComamonas testosteroni, J. Biol. Chem. 273 (1998) 30888–30896.

[7] U.C.T. Oppermann, E. Maser, Characterization of a 3a-hydroxysteroiddehydrogenase/carbonyl reductase from the Gram-negative bacteriumComamonas testosteroni, Eur. J. Biochem. 241 (1996) 744–749.

[8] G. Xiong, E. Maser, Regulation of the steroid-inducible 3a-hydroxysteroiddehydrogenase/carbonyl reductase gene in Comamonas testosteroni, J. Biol.Chem. 276 (2001) 9961–9970.

[9] G. Xiong, H.J. Martin, E. Maser, Identification and characterization of a noveltranslational repressor of the steroid-inducible 3a-hydroxysteroiddehydrogenase/carbonyl reductase gene in Comamonas testosteroni, J. Biol.Chem. 278 (2003) 47400–47407.

[10] W. Gong, G. Xiong, E. Maser, Identification and characterization of thetranscription factor HsdR for steroid-inducible expression of the 3a-hydroxysteroid dehydrogenase/carbonyl reductase gene in Comamonastestosteroni, Appl. Environ. Microbiol. 78 (2012) 941–950.

[11] J.L. Pruneda-Paz, M. Linares, J.E. Cabrera, S. Genti-Raimondi, Identification ofnovel steroid inducible gene associated with the bhsd locus of Comamonastestosteroni, J. Steroid Biochem. Mol. Biol. 88 (2004) 91–100.

[12] W. Gong, M. Kisiela, M.B. Schilhabel, G. Xiong, E. Maser, Genome sequence ofComamonas testosteroni ATCC11996, a representative strain involved in steroiddegradation, J. Bacteriol. 194 (2012) 1633–1634.

[13] S. Morelle, E. Carbonelle, X. Nassif, The REP 2 repeats of the genome of Neisseriameningitidis are associated with genes coordinately regulated during bacterialcell interaction, J. Bacteriol. 185 (2003) 2618–2627.

[14] B.M. Bundy, L.S. Collier, T.R. Hoover, E.L. Neidle, Synergistic transcriptionalactivation by one regulatory protein in response to two metabolites, Proc. Natl.Acad. Sci. USA 99 (2002) 7693–7698.

[15] B.O. Cezairliyan, R.T. Sauer, Inhibition of regulated proteolysis by RseB, Proc.Natl. Acad. Sci. USA 104 (2007) 3771–3776.

[16] R.D. Pridmore, New and versatile cloning vectors with kanamycin-resistancemarker, Gene 56 (1987) 309–312.

[17] J. Sambrook, D.W. Russel, Molecular Cloning: A Laboratory Manual, ColdSpring Harbor Laboratory Press, New York, 2001.

[18] M.M. Bradford, Rapid and sensitive method for the quantitation of microgramquantities of proteins using the principle of dye-binding, Anal. Biochem. 72(1976) 248–254.

[19] E. Maser, E. Möbus, G. Xiong, Functional expression, purification, andcharacterization of 3a-Hydroxysteroid Dehydrogenase/Carbonyl Reductase

M. Li et al. / Chemico-Biological Interactions 202 (2013) 116–125 125

from Comamonas testosteroni, Biochem. Biophys. Res. Commun. 272 (2000)622–628.

[20] M. Beato, Gene regulation by steroid hormones, Cell 56 (1989) 335–344.[21] M. Watanabe, L.P. Sy, D. Hunt, Y. Lefebvre, Binding of steroids by a partially

purified periplasmic protein from Pseudomonas testosteroni, J. Steroid.Biochem. 10 (1979) 207–213.

[22] J.R. Maddock, L. Shapiro, Polar location of the chemoreceptor complex in theEscherichia coli cell, Science 259 (1993) 717–1723.

[23] A. Göhler, G. Xiong, S. Paulsen, G. Trentmann, E. Maser, Testosterone-inducibleregulator is a kinase that drives steroid sensing and metabolism in Comamonastestosteroni, J. Biol. Chem. 283 (2008) 17380–17390.