Cell, Vol. 55, 785-795, December 2, 1988, Copyright 0 1988 by Cell Press

A Deduced Gene Product from the Drosophila Neurogenic Locus, Enhancer of split, Shows Homology to Mammalian G -Protein p Subunit David A. Hartley, Anette Preiss, and Spyros Artavanis-Tsakonas Department of Biology Yale University New Haven, Connecticut 06511

Summary

The correct segregation of neural from epidermal line- ages in Drosophila embryogenesis depends on the ac- tivity of the six zygotic “neurogenic” genes. One of the neurogenic genes, Enhancer of split, is particularly noteworthy in its genetic interactions with Notch and Delta, which both appear to code for t ransmembrane proteins with homology to the epidermal growth fac- tor. Transformation experiments have demonstrated the cloning of sequences necessary for Enhancer of splif gene function. We report here that the gene prod- uct derived from DNA sequencing shows homology to the p subunit of mammalian G proteins and CDC4, a yeast cell cycle gene. We demonstrate that expression of the transcripts relates to the developing central ner- vous system. These data suggest a mechanism of in- teraction between the gene products of Notch and En. hancer of split.

Introduction

The development of the central nervous system in insects is initiated by the delamination of individual precursor cells, termed neuroblasts, from an ectodermal layer known as the neurogenic region (Poulson, 1950; Bate, 1976; Thomas et al., 1984; Hartenstein and Campos-Ortega, 1964; Doe and Goodman, 1965a). The remaining cells of the neurogenic region differentiate as epidermal deriva- tives. Laser ablation experiments in the grasshopper (Doe and Goodman, 1985b) and cell transplantation experi- ments in the fly (Technau and Campos-Ortega, 1988) indi- cate that the selection of fate by cells of the neurogenic region is mediated by cell interactions. Indications that early neurogenesis is under genetic control have derived from studies on mutant phenotypes of the “neurogenic” genes. The neurogenic phenotype results from loss of function of any of the six zygotic neurogenic loci: Notch, big brain, mastermind, Delta, neuralized, and Enhancer of split (Poulson, 1937; Lehmann et al., 1983). This embry- onic lethal phenotype consists of an hypertrophied ner- vous system with the concomitant loss of epidermal struc- tures and results from a misrouting of epidermal cells to a neural fate (Poulson, 1950; Lehmann et al., 1983). The participation of the gene products in a cell interaction mechanism is supported by DNA sequence data that show that Notch (Wharton et al., 1985) and Delta (V&sin et al., 1987) apparently code for t ransmembrane proteins with homology to mammalian growth factors.

Genetic interactions between the neurogenic loci have been amply documented (Welshons, 1956; V&sin et al., 1985; de la Concha et al., 1988). Perhaps the most noteworthy interactions are those between mutations at the Notch and Enhancer of split loci. Enhancer of split was initially identified by virtue of a dominant allele (f(sp/)c), which enhances the phenotype of split, a viable recessive allele of Notch (Welshons, 1956, 1965). Flies of the geno- type sp//+:f(sp/)Dl+ resemble spl homozygotes while sp//sp/:f(sp/)Dl+ have severely reduced and roughened eyes and many additional bristle abnormalities (Wel- shons, 1956, 1965; Knust et al., 1987). Revertants of the dominant mutation are homozygous lethal and exhibit the hypertrophied CNS of the neurogenic phenotype (Leh- mann et al., 1983). The mutual dependence of gene func- tion between Enhancer of split and Notch is further demonstrated by the reduced viability of embryos doubly heterozygote for certain loss of function alleles at both loci (V&sin et al., 1985; Preiss, unpublished data). This partial lethality occurs despite the presence of one wild-type copy of each gene. Despite the mutual dependence, Notch transcription in embryos homozygous for deficien- cies at f(sp/) is relatively normal (Hartley et al., 1987). This, taken with the evidence that the split allele is a single missense mutation in the putatively extracellular domain of the Notch product (Hartley et al., 1987; Kelley et al., 1987) has suggested that the interaction between Notch and Enhancer of split occurs at the level of the gene prod- ucts themselves.

In order to elucidate the mechanism of interaction and to delineate the role of this gene in neurogenesis, we un- dertook a molecular analysis of the Enhancer of split lo- cus. Cytogenetic studies lead to the characterization of a 14 kbp chromosomal deletion that affects f(sp/) functions. We find that from the six independent transcription units mapping within the limits of this deletion, only one dis- plays a maternal expression as expected for the f(sp/) gene. Apparent point mutations in this transcription unit define the only lethal complementation group within this deletion. These point mutants are in homozygous form embryonic lethals and display a weak neurogenic pheno- type. We were able by P element-mediated transforma- tion to completely rescue all phenotypes associated with this lethal complementation group and in addition to par- tially rescue the extreme neural hyperplasia associated with large deletions in the f(sp/) region (Preiss et al., 1988). Our analysis so far, although identifying a tran- scription unit that is necessary for f(sp/) function, does not rigorously show that it is sufficient. Although this evi- dence points to a single transcription unit encoding E(sp/) functions, it does not exclude an alternative view that f(sp/) may be defined by multiple transcription units (Knust et al., 1987). In this paper, we report the nature of the putative gene product that has homology to mamma- lian signal transduction proteins. Furthermore, we demon- strate that the expression of this gene becomes confined to the developing nervous system during embryogenesis.

-5 -10 -15 -20 -25 -30

I I. I I I, I I I I.. I I I I I I I I. I I I I,

B cDNA5.18-1 I I I I*

cDNA5.6-1 I I 1) cDNANB5 I 1 1 iI,

cDNANEi97 I= 1 I*

cDNA 4.9A cDNA 5.12-4

C Figure 1. The Structure of cDNAs

A schematic representation of a genomic region at 96F-97A displaying a restriction map of genomic sequence and some cDNAs isolated from em- bryonic cDNA libraries. (A) A restriction map of 25 kbp of DNA cloned in our chromosome walk representing coordinates -5 to -30 of the walk (Preiss et al., 1966). Proximal is to the left and distal to the right. Polymorphic restriction sites are shown in parenthesis. (6) Cartoon showing representatives of classes of embryonic cDNAs isolated from 3-6 hr (4.9A, 5.6-1,5.18-l, 5.12-4) 4-8 hr (NB5), and 8-12 hr (NB97) cDNA libraries. The putative Enhancer ofsplir transcripts correspond to cDNAs 5.18-1, 5.6-1, NM, and NS97. Neighboring distal and proximal tran- scription units are represented by cDNAs 5.12-4 and 4.9A, respectively. The direction of transcription where known is indicated by arrows. The pres- ence of introns is inferred from differences in sizes and restriction maps between genomic and cDNA clones and is indicated by gaps in the cDNA bars. The absolute position of the introns has not been determined, however. (C) A genomic 10.4 kbp Xhol restriction fragment (shaded area), cloned into a Carnegie 20 transformation vector (outlined), was shown capable of rescuing all the point mutations associated with the putative E&J/J transcription unit (Preiss et al., 1988).

Results

We have cloned sequences from 96Fll-14 in a chromo- some walk of 80 kbp and defined a number of transcrip- tion units, one of which appears to be crucial to Enhancer of split function (Preiss et al., 1988). This transcription unit maps to our walk coordinates -16 to -24 (see Fig- ure 1) and a transformed segment of DNA encompass- ing this region rescues three types of phenotype as- sociated with E&p/j lesions (Preiss et al., 1988). These results have led us to examine the sequence and ex- pression of this transcription unit in detail in our at- tempts to define the molecular events dictating the choice of cell fate during early embryogenesis.

Isolation of Different cDNAs from the Enhancer of split Region Demonstrates Transcriptional Heterogeneity We have described transformation experiments that lead us to assume that the two transcripts (3 kb and 4 kb) de- tected by probes from coordinates -16 to -24 on our chromosome walk are E&I/) mRNAs (Preiss et al., 1988). Using the same probes, we have isolated cDNAs cor-

responding to these transcripts from libraries of 3-6 hr (Poole et al., 1985) 4-8 hr, and 8-12 hr (Brown et al., 1988) embryonic cDNAs. By comparing restriction maps, it ap- pears that the majority of cDNAs we have found share the same structure that is shown for cDNAs NB5 and 5.18-1 (see Figure 1). However, the two differences are cDNA NB97 isolated from the 8-12 hr library and 5.6-l isolated from the 3-6 hr library. All the cDNAs we have isolated are apparently not full-length, being shorter at both the 3’and the 5’ends. The direction of transcription was determined by using strand-specific probes transcribed from sub- cloned fragments. Figure 1 is a diagrammatic representa- tion of the alignment of the restriction maps of the cDNAs to the restriction map of the genome. In addition, the posi- tion of neighboring transcription units is indicated by the alignment of corresponding cDNAs (4.9A proximally and 5.12-4 distally) to the restriction map and the Xho fragment used to rescue point mutants is also illustrated.

Although we have not determined the exact position of intron/exon boundaries, we can predict where some in- trons occur by comparison of cDNA and genomic restric- tion maps and by cross-hybridization of the cDNAs to digests of genomic clones. From these data, the two

G-Protein Homology to Enhancer of split 707

1 *cTGCC*TCG-TATTATTW CAGMGMMAGMTAGCTA CMGTACCATAAMCGCTGGC-LMCAGATAMTATT*GTcc*cGTTTTGc~G~GTTTcTGTG 120

121 CAGG*GTGG*GTGCTCAGGG*TMccGGM~GM~GMGcGGcGT*cGc*Gc*G~G~Gc*Gc*G~cTTccGcTccGGc~TcGGTGTc~ccTcG~c**TcGcTcTTGcTcT*G 240

MetTy~ProSe~P~oV~1ArqHi~ProAlaAl~GlyGlyProProProGlnGlyProI1eLysPheThrIleAl~AspThrLe"GluArq~~eLys 241 CCGGCMChTMCAGCCTMCMChTGThT~CCTChCCGGTGCGCChCCCCGCCGCCGGGG~CChCChCCTChGGGTCCMTCMGTTChCChTCGCC~ThChCTGGMCGChTCM~ 360

Gl"G1UPhehsnPheLc"G1nAlaSisTyr~isSerI1eLysLe"Gl"CyrGl"LysIsuSerAsnGluLysThrGl~etGl~gSiSTyrV~~etTy~TyrGl~etSerTyrGly 361 GAG~GTTCMCTTCCTGCAGGCGCACTACCACAGChTT-TTG~GTGC~GMGCTGTCGMC~-~CG~~TGCAGCGCChTTATGTTATGTACTAC~~TGTCCTATGGC 480

LeullsnV~1GluWatHisLysGlnThrGluIleAl.LysArqLeuAsnThrLe"IleAInClnLe"~"PSOPhe~"Gl~aAsp~isGlnGlnGlnVa1M"G1~l.V~1Gl~~g 481 CTTMCGTG~GATGCACMGCAGACC~GATCGCCMGCGGCT~CACACT~TCMCCAGCTACTTCCATTCCTTCAGGCC~CCACCAGCAGCMGTGCTGCAGGCGGTG~GCGG 600

ProSerSerSerGlyIleLysGlnGlUArgProProSeKArgSerGlySe~SerScrSerSerA~gSeIThrProSerLe"LysTh~LySAs~~tGl"LysProGlyThrProGlyAl~Lys 1081 CCMGCAGTAGTGGCATCMGCAG~CGGCCGCCCT~CGCTCCGGCTCCAGTTCGTChCGTTCChCACCChGCCTCM~C~GATATGG~GCCGGGThChCCGGGCGCCMG 1200

A1~rgThrProThrProAS~laPToAl~AlaP~oAl~PrOGlyV~~snProLysGl~et~etPIoGlnGlyProProProAl~GlyTyrProGlyAlaProTyrGl.nArgProAl~sp 1201 GCACGCACACCGACACCGMCGCCGCTGCTCCGGCGCChGGCGTTMTCCT~C~T~TGCCGChGG~CChCCGCChGCCGGhThTCCGGGTGChCCGThTC~GGCCGGCCGhT 1320

ProTyrGlnArgProProSerAspProA1aTyrGlyArgProProPro~etProTyrA~pP?oSiSAlaSisV~lArqThrAsnGlyIleProHisProSerNaLe"T~rGlyGlyLys 1321 CCCTACCAGCGTCCACCGTCh~TCChGCCThTGGhC~CCGCChCCMTGCCGThCGhTCCGChCGCCChTGTGCGMCCMTGGChTTCChChTCCCTCGGCCCT~CGGGTGG~G 1440

ProAlaTyrSerPheHirMetAsnGlyGl"GlySerLe"GlnProValProPheProProAspA1aLe"V.1GlyValGlyIleProArgHisAla~gGlnIleAsnThrLe"SerHis 1441 CCTGCATACTCTTTCCATATGMCGGCGAGGGTAGTCTACMCCGGTGCCGTTCCCGCCGGACGCGTTGGTGGGTGTTG~TTCCGCGGCACGCCCGTCA~TCM~CGCTGTCGCAT 1560

GlyGluVa1ValCysAlaValThrIleSerAsnProTh~LysTy~ValTyrTh?GlyGlyLysGlyCysValLysV~ 1561 GGA~GGTCGTCTGTGCGGTMCCATCTCT~TCCCAC-GTACGTGTACACGGGCGGCMGGGCTGCGTCMGGT

1800

1920

1921 CACMCOAGATCCTGGTGCGCCAGTTCCAGGGCCGA

I- -.---- s---------.--I----.-.--- I_--

LeuHi~l~SerLysProAspLysTyrGlnLeuHis~uHisGluSerCysVal~"Ser~~~gPheAl~N~CySGlyLyST~pPheV~lSerThrGlyLysAs~sn~"~~sn 2161~~ACGCATC~CCGGACMGTATCMCTGCATCTGCACGA~GCTGCGTTCTGTCGCTGCGCTTTGCCGCCT~GG~TGGTTCGTTTCCACCGGC~~CMCCTGCTTMC 2280 _---.-_--_-_-_--_---.---.-.------- -- -.--m.

ThrValTyrGluValIleTyrEnd 2401 ACTGTCTACGMGTTMTThTT-TCChC~CChTGChGTTTTTTChTTTTGT~TMGCTCGThThGTTTTThTThCMChTGTTCG~TChTGC~TMCMCMC-Ch 2520

2521 ACAGCAGCAGCATCGGCAGT-C- GhhMGChGMhGGCGGCAGThGCMCGCATC TGhMhTTCThTMTATAThTAChhGWGGMMCT 2640

:mA of 5.10-l 2641 ~TTTTMGCGTACTTGTAGCTACTMGCCTMGCTMGTCCMT~C~CCMCMGTT~ChChC~TTGCMGT~G~GMTTCMGT~TGhGMCChGA 2760

2761 GC~TWLTMTGCATGCGAGCMCAG-CGAGTATGTTGT-TT~C-T-CCG-CAG-CAT~GTCGGCGATACCTACCTACGTTCATCTTMCAT 2880

2881 -CAMTAGGAGGATMGTGGMTTAGTCAGTChGTChTTGCMTTGChGGhGCGTT~~TThTGhTThCChGCTGMC~G~GTT~ThC~ThC~TGC~GTGCTTTThGTT 3000

3001 TGTTTTATGTGAGCGGTTTTTGTMTTTAGCTG-GTCAGACAGCGMTGCMCMC-TGTMTTTTMGTTGTCAGTTTCCTTACCTCCCMCGCCCCTCC-CACACACCACA 3120

3121 CACACACAMCACMCATACG-CAC-C~C~TTTGC~T~GGTATAT~TAT~TATAT~TATATATMTTAT~TGMTATACTTAGTMGCATTTT~GTTM~GTTTTAC 3240

3241 ATTATAMTTAMCACG~CCACTTTC~CACT~CTCGCATTGGGGGTCAGTAGTTAGMGCTCA~GCAGTCCGCTTTGCTTGTATGTMTTTGA~TGTGTMT~~ 3360

3361 ATCGAGGMTTMTTGTGTGMTCMCTCTTC~CTCTTChGMCCMGTGT~TCCThThTTTT~GChGCT~CCC~ChChGhGhGhGCCGChTC~CMCCG~CCG~GTh 3480

3481 ~C*C*GCT~TTGTTT*GTGT~~*G*~~*T*T*~*TG~C*G~CGM~~G*~~~*~*~*~*~~~*~~~~*~*~*T*~*~~~~~*~~G~~~~~~GTMTMGCMG*G* 3600

3601 TAUGTGCAGCACACGCTTCGATTTTTT~TTTThC~ThTThTThTThTTGTGGTThThThTGThThTMTThThTThT~T~TT~GC~CG +2&@gga TTATATGT 3720

3721 MTCGMAGT- 3741

Figure 2. The DNA Sequence of cDNAs NB5 and 5.18-l

The DNA sequence of cDNA NB5 with a conceptual translation of the predicted open reading frame. The sequence of cDNA 5.18-1 starts 42 bp beyond the end of NB5 as indicated and ends at nucleotide 2714 of NE5. The open reading frame starts with a consensus translation initiation se- quence CAACATG at nucleotide 261. The single base pair difference between NB5 and 5.16-1 occurs at nucleotide 1736 (G-C) and changes a glycine (NB5) to an alanine (5.18-1) as indicated in the shaded box. The consensus polyadenylation sequences at nucleotides 2685, 2765, and 3704 are indicated by the shaded boxes. The open boxes display the repeated unit in the carboxyl half of the protein, which occurs four times-a fifth less obvious repeat is indicated by a dashed box. The GenBank accession number for this sequence is J03144.

cDNAs that differ from the others, NB97 and 5.6-1, do so However, using a Pstl-RI fragment from NB97 (corre- around the EcoRl site at -17.9. These two cDNAs were sponding to the genome at coordinates -17.7 to -17.9, isolated from different libraries and so we are confident see Figure l), which is specific to these cDNAs, we were that their structure reflects a bona fide message, rather unable to detect any abundant transcripts on Northern than being an artifact of cDNA cloning. In addition, their blots (data not shown). common restriction map indicates an alternate transcript. Hybridizing cDNA and genomic fragments to Northern

Cell 788

A cAAc*Ta AATAM

r** MTW **T*** 111 ****** LARGE TRANSCRIPT

SMALL TRANSCRIPT

Pro-rich Pro-rich TRANSDUCIN II PROTEIN

Figure 3. The Putative E(.sp/J Gene Products

A cartoon displaying the structure of the two putative Efspl) transcripts (A) and the predicted gene product (B). (A) The consensus translation start, termination codon, and polyadenylation sequences are indicated, as is the single base difference between the two cDNAs that were sequenced. The open reading frame is indicated by darker shading. (B) Features present in the amino acid sequence indicated are proline-rich clusters and the repeated motif that shows homology to the 8 subunit of guanine nucleotide regulatory proteins such as transducin.

blots indicated that the source of variation between the smaller, 3 kb transcript and the larger, 4 kb transcript lay at the 3’end of the gene. Indeed, fragments distal (and 3’) to the EcoRl site at -21.1 hybridize only to the larger tran- script (data not shown). In order to compare these tran- scripts more accurately, we chose to sequence the 2.7 kbp cDNA 5.18-1 which stops at this EcoRl site and NB5 (3.8 kbp) which overspans it (see Figure 1). Both of these cDNAs are as long at the 5’ end as any other cDNA we have found, but since they are both smaller than the tran- scripts, it is probable that they are not full-length. The DNA sequences of these two cDNAs both contain 3’ poly(A) tracts; the 5.18-1 cDNA ends after the first consensus poly- adenylation sequence the polymerase would encounter, while the NB5 sequence contains an extra 1 kbp of 3’se- quence, which appears to be untranslated (see below). It seems likely, therefore, that the 5.18-1 sequence corre- sponds to the smaller transcript while NB5 represents the larger transcript, and that the difference between them is in alternate polyadenylation.

The cDNA Sequence Contains a Single Open Reading Frame The DNA sequence of the two cDNAs, NB5 and 5.18-1, is shown in Figure 2. They are identical barring a single base difference of G-+C at position 1736 of NB5 as shown in Figure 2 and schematically in Figure 3. This difference may reflect a natural polymorphism between the stocks from which the libraries were prepared (NB5 is derived from cn dp bw embryos while 5.18-1 is from wild-type Can- tons embryos [Brown et al., 1988; Pooleet,al., 1985)). The 5’ end of NB5 starts 42 bp before that of 5.18-1 and is fol- lowed 261 bases later by a consensus sequence for a Dro- sophila translation initiation sequence (Cavener, 1987), CAACATG (see Figures 2 and 3). The open reading frame succeeding this AUG persists for another 2157 bases; it is the only ORF greater than 250 bp and the only one with codon usage commensurate with other Drosophila genes.

The consensus polyadenylation signal AATAAA occurs at 2685 and the poly(A) tail in 5.18-1 starts 29 bases later. There are two more polyadenylation sequences-one at 2765 and the other at 3704-the last is followed by the NB5 poly(A) tail 26 bases later (see Figures 2 and 3).

Conceptual translation of the single open reading frame of both transcripts yields an amino acid sequence rich in proline, particularly in the amino half of the molecule. The prolines are clustered in three main groups; from residues 3-19, 120-208, and 273-421. The deduced molecular weight of the gene product is 78,928 and hydropathy plots demonstrate that there are no regions of hydrophobicity that one would predict for a membrane protein (Kyte and Doolittle, 1982). Indeed, the amino portion of the molecule is considerably hydrophilic. Computer based predictions of signal peptides or transmembrane sequences indicate that they are absent in this gene product.

A search for internal repetition in the amino acid se- quence revealed a degree of internal homology in the caroboxyl half of the protein. Figure 4 is a dotplot compar- ing the sequence to itself at all points along its length, generated by the UWGCG programs COMPARE and DOTPLOT. The dotplot emphasizes two apparent domains of the molecule-an amino half very rich in proline but lacking any obvious repetitive structure and a carboxyl half exhibiting an ordered internally repetitive sequence. The computer analysis indicates that the latter domain consists of a 43-47 amino acid repeat unit, which occurs four times as indicated in Figure 2 and in the cartoon of Figure 3. The presence of the WDX residues, where X is hydrophobic, is diagnostic for the repeat unit (see Figures 2 and 6).

f(sp/) Sequence Homologies When the entire peptide sequence was compared with the PIR database using the LipmanlPearson algorithm FASTP (Lipman and Pearson, 1985) the predominance of proline biases the output to be other proline-rich se-

76;rotein Homology to Enhancer of split

600

400

200

600

400

200

Ebpl) residues l-7 19

Figure 4. The Amino Acid Sequence Displays Internal Repeats

A dotplot generated by the UWGCG programs COMPARE and DOT- PLOT showing regions of internal homology in the putative E(spl) amino acid sequence. The program was run such that a point represents an identity of 13 amino acids in a window of 30. The cluster of points near the diagonal at residues 275-360 reflects the highest concentration of proline residues in the molecule. The offset diagonals from residues 460-700 show the repeated motif that is homologous to bovine transducin 6 subunit.

quences that align poorly to this sequence. Using the dot- plot as a guide for dividing the sequence into two do- mains, we repeated the search with each half of the molecule. The amino half displays homology to human proline-rich basic peptides l-4 (Azen et al., 1984) be- cause of its high (15%) proline content, but alignments and dotplots demonstrate that this homology does not ex- tend into nonproline portions of the molecule (data not shown). Furthermore, the proline-rich regions of this se- quence are not arranged in the characteristically simple repeat of the human peptides or collagen. In contrast to these rather nonspecific relationships, the carboxyl half of the deduced protein reveals a single striking homology when compared with the PIR or SWISS-PROTEIN data- bases. This homology is to the 8 subunit of transducin, the signal transducing G protein functionally coupling rho- dopsin to cGMP phosphodiesterase in phototransduction.

The homology extends over the entire length of G 6, which shares the 43 amino acid repeated structure of the puta- tive f(spl) gene product (Fong et al., 1988) as the pairwise comparison of the dotplot in Figure 5 demonstrates. Fig- ure 6 shows an optimal alignment between the 8 subunit of transducin and the carboxyl portion of the putative E(spl) peptide sequence computed with the Needleman and Wunsch algorithm (1970). Using the Dayhoff tables of evolutionary similarity between amino acids, the homol- ogy is calculated as 39% over the 340 amino acids of G 6. In terms of amino acid identity, however, the homology is only 21%. In order to estimate the significance of this finding, we used the lntelligenetics program PCOMPARE, which scores optimal alignments by the Needleman and Wunsch algorithm (1970) and compares them with scores from aligning randomly jumbled sequence of identical amino acid composition. A distribution of scores from comparing 30 such random sequences was computed; the optimal alignment of the bona fide sequences was separated by 7.8 standard deviations from the mean of this distribution, indicating with a high degree of significance that the proteins are evolutionarily related.

Since the relationship between the putative E&I/) se- quence and bovine transducin 8 subunit was pointed out to us (Doolittle, personal communication), we were able to infer other homologies to sequences that have not been entered into the database. These include the two human G protein p subunit sequences (Fong et al., 1987; Gao et al., 1987) and the yeast cell cycle gene CDC4 (Yochem and Byers, 1987). All of these sequences have been identi- fied as containing the 43 amino acid repeat unit initially described in the 8 subunit of transducin (Fong et al., 1986), whose position in the E&J/) sequence is illustrated in Figure 3. The homology with CDC4 is intriguing since this sequence is similar in length (779 amino acids) to the putative E(sp/) product, and the transducin 6 subunit-like repeats are at the carboxyl end of each sequence. However, as the dotplot of Figure 7 shows, the amino half of each sequence fails to display an equivalent degree of homol- ogy. The significance of homology between the carboxyl, transducin 6 repeat domain halves of CDC4 and the predicted f(spl) sequence is estimated as 4.4 standard deviations from random.

200 400 ,““‘““““““‘“‘“’

000 Figure 5. Homology between the Repetitive Domains of E&J/) and Transducin 6

A dotplot showing the regions of homology be- tween the amino acid sequences of the puta- tive f(sp/J gene product (horizontal axis) and the 6 subunit of bovine transducin (vertical axis). As with the dotplot of Figure 4, the win- dow size is 30 and the stringency 13. The homology between the repeated motifs in the carboxyl half of the predicted f(spl) and transducin 6 is evident by the repeated di- agonals.

200 400

I 600

E(spl) residues 1-719

Cell 790

601 650

QQ. GYCPT AWY SFSKS G' -__ P 651 700

l **

STG T PYGASIFQSK ETSS”LSCDI

TGS . . . . . . . . . . . . . . . . . . . . _--

701 723

STDDKYI”TG SGDKKATVYE “IY

. . . . . . . . . . . . . . . . . . . . _---------

Figure 6. Alignment of the Transducin and E(spl) Amino Sequence

An optimal alignment of the tranducin 6 and predicted Efspl) se- quences using the UWGCG program GAP. The homology amounts to an identity of 21% or similarity (using the Dayhoff matrix) of 39%. The significance is calculated as 7.6 standard deviations from random (see text). Identical amino acid residues are shaded. Asterisks denote key residues WDX within the -I3 amino acid repeated motif.

Embryonic Expression of the Transcripts The presence of two transcripts differing by their use of polyadenylation sites indicates a mechanism for differen- tial expression. In order to test whether such a mechanism is employed on a topological basis, we hybridized one probe specific to the larger transcript and one common to both to embryonic tissue sections. Figure 8 displays the results that show that both probes detect an indistinguish- able profile of expression. This pattern of expression is similar to Notch expression (Hartley et al., 1987) such that initial expression appears ubiquitously over cellular blastoderms and gastrulae. Labeling of the midgut de- creases in older embryos and grains eventually become confined to the differentiating central nervous system af- ter germ band shortening (see Figure 8). The decrease in labeling of other tissue is preceded by a marked absence of epidermal expression, concomitantly with the increased neural expression (see Figure 8). This pattern contrasts with Notch (Hartley et al., 1987) and Delta (V&sin et al., 1987) transcripts that are ubiquitous to the ectoderm at this earlier stage of germ band extension. Two other ex- ceptions to an exact correlation between this pattern and embryonic Notch transcription are the absence of strong labeling of the foregut and hindgut and a larger field of ex- pression in the central nervous system (CNS). Notch is ex-

200 400 600

200 400 600

E(spl) residues I -7 I 9

Figure 7. Homology between CDC4 and .E(spl)

A dotplot indicating homology between the predicted gene products of E(sp/) (horizontal axis) and CDC4 (vertical axis). The window size is 30 residues and the stringency 13.

pressed along the base of the developing CNS and finally appears over single cells or small clusters of cells in the mature embryonic CNS (Hartley et al., 1987). These tran- scripts, in contrast, are expressed more ubiquitously over both the developing and mature embryonic CNS.

Our Northern analyses indicated a temporal difference in accumulation of the two transcripts during embryogen- esis (Preiss et al., 1988). However, the in situ data sug- gest that this difference is quantitative rather than qual- ita!ive. In particular, the low abundance of the larger transcript in early embryos suggested that it was predomi- nantly zygotic. Using the 3’ probe specific to this tran- script, however, we detect expression over early embryos prior to activation of the zygotic genome, indicating that it too is deposited maternally.

The molecular analysis, and in particular transformation data, present compelling evidence that the coding se- quence we describe here is necessary for E(spl) function in neurogenesis, which emphasizes the significance of these data (Preiss et al., 1988). The nature of the de- duced gene product and its expression in embryos are satisfyingly consistent with the evident phenotypic inter- actions between Notch and E(spl) mutants and ex- perimental data stressing the importance of ceil surface events in the regulation of ectodermal differentiation.

We have detected two predominant transcripts from this region whose coding capacity appears to be the same. The larger transcript contains an extra 1059 bp of 3’ un- translated sequence. Since this is the only difference we detect, we have been unable to construct a probe specific to the smaller transcript, but using a probe specific to the larger transcript, we detect the same pattern of embryonic expression in situ as with common probes. These results

C D

E F G

H

CNi

Figu

re

8.

Embr

yoni

c Ex

pres

sion

of t

he T

wo E

fspl

) Tr

ansc

ripts

In s

itu h

ybrid

izatio

n to

em

bryo

nic

tissu

e se

ctio

ns.

A se

ries

of s

agitt

al

sect

ions

of

em

bryo

s of

inc

reas

ing

age

hybr

idize

d wi

th

anti-

sens

e RN

A pr

obes

, wh

ich

dete

ct

both

tra

nscr

ipts

(A

-D)

or s

pecif

ic to

the

lar

ger

4 kb

tra

nscr

ipt

(E-H

). Bo

th p

robe

s de

tect

th

e sa

me

qual

itativ

e pa

ttern

of

tran

scrip

tion

thro

ugho

ut

embr

yoge

nesi

s.

Embr

yoni

c st

ages

ar

e as

ref

erre

d to

in

Cam

pos-

Orte

ga

and

Harte

nste

in

(198

5).

(A)

and

(E)

Germ

ba

nd e

xten

ded

embr

yos

(sta

ge

8 or

9)

as t

he n

euro

blas

ts

segr

egat

e fro

m

the

ecto

derm

. Gr

ains

up

to

this

stag

e ar

e un

iform

ly di

strib

uted

ov

er

embr

yos

and

ther

efor

e tra

nscr

ipt

is pr

esen

t in

bot

h th

e ne

ural

an

d th

e ep

ider

mal

pr

ecur

sors

be

fore

se

greg

atio

n of

the

neu

robl

asts

. (B

) an

d (F

) Ge

rm

band

ex

tend

ed

embr

yos

afte

r m

ost

of t

he

neur

obla

sts

have

se

greg

ated

(s

tage

11

). At

thi

s st

age

nonu

nifo

rmity

of

exp

ress

ion

first

beco

mes

ob

viou

s.

Mos

t of

the

exp

ress

ion

is in

a b

and

alon

g th

e m

iddl

e of

the

ger

m

band

, co

rresp

ondi

ng

to t

he d

evel

opin

g CN

S.

Grai

ns

are

pres

ent

at a

red

uced

le

vel

else

wher

e an

d ar

e ab

sent

in

a la

yer

of c

ells

(ope

n ar

rows

) al

ong

the

edge

of

the

embr

yo

and

in th

e ce

phal

ic

furro

w.

This

is pa

rticu

larly

ev

iden

t in

the

dar

kfie

ld

phot

ogra

phs.

(C

) an

d (G

) Em

bryo

s af

ter

germ

ba

nd

shor

teni

ng

(sta

ge

13)

and

sepa

ratio

n of

the

CNS

fro

m

the

epid

erm

is

(ep)

. Th

e pr

edom

inan

t ne

ural

ex

pres

sion

and

lack

of

epi

derm

al

expr

essio

n ar

e fu

lly

evid

ent

by t

his

stag

e.

(D)

and

(H)

Upon

co

mpl

etio

n of

dor

sal

closu

re

(sta

ge

18).

expr

essio

n ha

s be

com

e vir

tual

ly co

nfin

ed

to t

he

CNS.

Cell 792

suggest that any regulatory significance for the differ- ences in 3’ untranslated sequence between the tran- scripts will be in translational control. Consistent with an implicated role in neurogenesis, we observe that the ex- pression, albeit initially ubiquitous, becomes confined to the CNS. The early expression parallels early Notch (Hart- ley et al., 1987) and Delta transcription (V&sin et al., 1987), such that when the neurogenic region of the ecto- derm forms after gastrulation, all three transcripts are present in all cells. However, later in development, Notch transcript is absent in some neural cells these transcripts are present in and in addition, it is present in foregut and hindgut cells at a time these E(sp/) transcripts are absent. This lack of complete congruence of later expression sug- gests that at some stage the activity of the gene products are independent. We cannot assume complete mutual de- pendence of gene activity between E(spl) and Notch, al- though the reduced viability of animals doubly heterozy- gous for null alleles of each gene suggests an intimate dependence. A similar dependence is implied between Delta and E(spl) given the reduced viability of doubly het- erozygous mutants. We note that the expression of the putative E(spl) transcripts similarly fails to absolutely mir- ror embryonic Delta transcription (V&sin et al., 1987; Muskavitch, personal communication). This asymmetry of expression of neurogenic genes may be useful to cells in providing them with the necessary context for adopting a particular developmental fate. One interesting observa- tion is that the transcripts appear in other cell types than epidermal and/or neural precursors. This suggests, as we have argued is the case for Notch (Hartley et al., 1987; Artavanis-Tsakonas, 1988), that the gene product plays a more pleiotropic role in development than merely regulat- ing the neural/epidermal dichotomy.

The single long open reading frame of the putative E(sp/) transcripts encodes a 719 amino acid protein that lacks any stretch of hydrophobic sequence characteristic of a transmembrane protein. This observation appears contrary to our hypothesis that the site of the split mutation in the Notch product would mark a site of interaction with the E(sp/) product (Hartley et al., 1987). The split allele of Notch codes for a missense protein with a single amino acid substitution in the 14th EGF-like repeat of the putative extracellular region (Hartley et al., 1987; Kelley et al., 1987). If the gene product we report here is indeed E(spl), then how might we explain the specific interaction with split? The answer to this riddle may lie in the nature of the gene product. Our computer-aided analysis of the amino acid sequence has shown that it may be considered as having two domains. The first domain in the amino half of the molecule is extremely proline-rich and therefore dis- plays homology to other proline-rich peptides such as hu- man basic proline-rich proteins (Azen et al., 1984) or col- lagen (Eyre, 1980). Unlike these proteins, the proline residues are not part of a simple ordered repetitive struc- ture and therefore we cannot impute functionality from the nature of these homologies. It seems likely that the dis- parate arrangement of proline residues will impart un- usual structural properties to this molecule. The second,

carboxyl domain of the protein sequence exhibits a re- peated motif that is revealed by dotplot analysis. This repetitive structure is homologous to the 8 subunit of gua- nine nucleotide regulatory proteins such as transducin. In addition, the yeast cell cycle gene product CDC4 displays a similar domain (Fong et al., 1988), also in the carboxyl half of the amino acid sequence, which is homologous to both G-protein 8 subunit and the putative E(sp/) product described here. The computer based alignments and dot- plots demonstrate that this protein is more related to the G protein 8 subunit sequence than CDC4. These same alignments show that the homology extends over the en- tire length of 8 subunit sequence, which prompts the speculation that this homology does reflect functional similarity. However, this gene product apparently does not represent the Drosophila homolog of the transducin 8 subunit. This is more likely to be a much more related se- quence, isolated by cross-hybridization to the bovine transducin cDNA, which maps to the 13W14A region of the X chromosome (Yarfitz et al., 1988).

The relationship between the gene product we have de- scribed and CDC4 is interesting in that Notch also shows homology to a yeast cell cycle gene, CDClO of S. pombe and the SW78 gene of S. cerevisiae (Breeden and Nas- myth, 1987). The interest is heightened since both CDC4 and CDClO mutants disrupt early cell cycle events, al- though there are no known synergistic effects between mutations at CDC4 and other cell cycle genes. Further- more, the homology between CDC70 and Notch occurs in the intracellular portion of the Notch molecule and thus may define a functional motif for intracellular activity of the Notch product. The functional relevance of Drosophila neurogenic gene homology to cell cycle genes appears initially obscure, but the apparent correspondence of Notch transcript with less differentiated, mitotically active cells(Hartleyet al., 1987; Markopoulou, 1987) is worth not- ing in this respect.

The nature of the homology between G protein 8 subunits and the putative E(spl) product is provocative given what is known on the one hand concerning the biol- ogy and genetics of Drosophila neurogenesis and on the other concerning the mechanism of action of G proteins in signal transduction. We have argued that the deduced nature of the Notch product implicates it in a cell surface mechanism by which uncommitted cells of the ectoderm adopt a particular developmental fate (Wharton et al., 1985; Hartley et al., 1987; Artavanis-Tsakonas, 1988). Simi- larly, the very nature of G proteins as signal transducing molecules confines them to cell surface events (Gilman, 1987). Transducin represents the best characterized G protein since its involvement in phototransduction has been thoroughly researched. It can be purified as a heter- otrimer (a@&). This heterotrimer binds photoexcited rho- dopsin and concomitantly with the exchange of GDP for GTP the protein dissociates into a-GTP and P/r. The a-GTP binds and activates phosphodiesterase, which results in membrane depolarization (Stryer and Bourne, 1988). It is thought that the specificity of action in receptor binding lies with the a subunit of G proteins (Bourne,

F;$rotein Homology to Enhancer of splif

1988). However, two cases contrary to this dogma are the cardiac muscarinic response to acetylcholine, where it is b/r rather than a-GTP subunit that t ransduces the signal by opening K+ channels (Logothetis et al., 1987; although see Codina et al. [1967] for a dissenting view) and the transducin p/r subunit stimulation of Phospholipase A2 activity in rod outer segments (Jelsema and Axelrod, 1987). How does the involvement of G proteins in many di- verse signal transduction processes relate to Enhancer of split gene action? Given what we know of the biology and genetics of E(spl) mutants, we can attempt three predic- tions concerning the nature of the gene product: first, that the action of the gene product be autonomous to the cell expressing it; second, that the gene product be able to in- teract with the Notch and Delta gene products; and third, that this interaction can be affected by extracellular changes in the Notch product.

Elegant experiments transplanting cells between mu- tant and wild-type embryos have implied that of all the neurogenic mutants, only E(sp/) mutants are cell autono- mous (Technau and Campos-Ortega, 1987). However, since the E(sp/) alleles used were all large deficiencies that delete several genes, the phenotypes of these mosaic patches may not represent the true lack of function state. The behavior of large mosaics suggests that the nonau- tonomy of the other neurogenic mutants is “local” in its phenotype (Dietrich and Campos-Ortega, 1984; Hoppe and Greenspan, 1988; Markopoulou, 1987). Molecular analyses of Notch (Wharton et al., 1985) and Delta (V&sin et al., 1987; Muskavitch, personal communication) have indicated that these genes code for large transmembrane proteins, suggesting that they serve to regulate the de- velopmental choice of ectodermal cells by a cell interac- tion mechanism. This suggestion is consistent with laser ablation experiments in grasshoppers (Doe and Good- man, 1985b) and cell t+ransplantation experiments in Dro- sophila embryos (Technau and Campos-Ortega, 1988), which provide direct evidence that cellular environment dictates this neural/epidermal dichotomy. The fact that the neurogenic gene products of Notch and Delta probably ex- ert their effect at the cell surface indicates how local nonautonomy of mutant phenotypes might be explained. On the other hand, a consequence of the presumed au- tonomous behavior of E(spl) phenotypes predicts by the same reasoning that this gene product’s action be limited to the cell expressing it. This prediction is potentially ful- filled by the putative protein we describe here, which lacks secretory or t ransmembrane sequence permitting expres- sion at the cell surface.

A second prediction concerning the E(spl)gene product is that it be able directly or indirectly to interact with other neurogenic gene products. This expectation is born out of results demonstrating phenotypic interactions between both altered function mutations (Welshons, 1956; Knust et al., 1987a) and loss of function mutations (V&sin et al., 1985; de la Concha et al., 1988) at the E&p/), Notch, and Delta loci. Analysis of Notch transcription in E(sp/) mutant embryos indicates that the interaction is not at the level of transcription (Harleyet al., 1987). The implied cytoplasmic

nature of the protein we describe here would require any direct interaction to be with the intracellular portion of the Notch and Delta gene products. The extent to which one can draw mechanistic analogies from the structural simi- larity between the carboxyl half of the putative E(sp/) prod- uct and G p is unclear. However, it is certainly striking that the action of G proteins is intimately associated with re- ceptors and that this homology exists.

The final criterion for an E(sp/) product requires that we explain the nature of the phenotypic interactions with split, an extracellular point mutant of the Notch product (Hartley et al., 1987; Kelley et al., 1987). We have argued that the absence of hydrophobic signal or t ransmembrane se- quences suggests this gene product would appear at the cytoplasmic side of the membrane. However, if one can impute functionality to the homology with G p , one can easily envision mechanisms by which a functional associ- ation of this gene product with the intracellular domain of the Notch protein can be disrupted by an extracellular mu- tation.

It may appear unwise to speculate on the significance of amino acid homology to conservation of function. How- ever, the accumulated data on the nature of the Notch, Delta, and now putatively E(spl) gene products consis- tently suggest that they code for membrane-associated proteins. We know mimimally that these gene products regulate ectodermal differentiation and their more wide- spread expression may indicate a more pleiotropic role in the regulation of other developmental decisions. These data indicate that the mechanisms of action of the neuro- genie gene products is to transduce developmental sig- nals, thus eliciting the appropriate fate from uncommitted cells.

Experimental Procedures

Isolation of cDNAs We screened three cDNA libraries for E&I/J cDNAs, the 3-6 hr library of Poole et al. (1985) and two cDNA libraries kindly donated to us by Nick Brown, representing 4-8 hr and 812 hr embryonic message. The hgtl0 Kauvar library was screened (Benton and Davis, 1977) using ran- domly primed probes (Feinberg and Vogelstein. 1983). The Brown libraries were screened according to a protocol adapted by their maker. The libraries were plated at high density and replicated after 3 hr growth at 37°C then both the original and replicated plates were al- lowed to grow overnight at 25-30%. A second nitrocellulose filter was sandwiched onto the replica, and this sandwich was autoclaved for 5 min. The filters were vacuum baked for 1 hr, prehybridized for 2 hr, and hybridized overnight.

Subcloning and Sequencing Phage and plasmid cDNAs were directly subcloned into Bluescript (Stratagene) or M13mp19 vectors. Templates were sequenced directly or subjected to deletion by either the exonuclease III/S1 (Henikoff, 1984) or T4 DNA polymerase (Dale et al., 1985) methods. Chain ter- mination sequencing used both Klenow (Sanger et al., 1977) and modified T7 polymerases (Tabor and Richardson, 1987) and dlTP (Mizusawa et al., 1986) to eliminate compression where required.

Computer Analysis Sequences were entered by sonic digitizer and overlapping se- quences compiled using the lntelligenetics GEL program accessed by BIONET. Translation, manipulation, and secondary structure predic- tions were accomplished with the lntelligenetics PC-GENE and/or University of Wisconsin suite of programs. Open reading frame predic-

Cell 794

tions used the Wisconsin program CODONPREFERENCE (Gribshov et al., 1984) to predict and plot potential D. melanogaster ORFs by com- parison with a table of ten known genes (Wharton et al., 1985). The PIR and SWISS-PRUT databases were searched with all or part of the ORF using the FASTP program (Lipman and Pearson, 1985) available through BIONET. Internal homology within the identified ORF or be- tween sequences was analyzed by the COMPARE and DOTPLOT (Maize1 and Lenk, 1981) programs of UWGCG. Alignments by the method of Needleman and Wunsch (1970) were made by GENALIGN, PCOMPARE (Intelligenetics), and GAP(UWGCG).

In Situ Hybrldlzetlon Subclones of Nf35 and 5.18-1 in Bluescript vectors were used to synthe- size transcript-specific RNA probes. Transcription in vitro, pretreat- ment, hybridization, and autoradiography has been previously de- scribed (Hartley et al., 1987; lngham et al., 1985).

Acknowledgments

We wish to acknowledge with gratitude the initial observation of Russel Doolittle concerning homology to the 8 subunit of transducin. We gratefully acknowledge the technical assistance of Ruth Bryant and thank our colleagues in the Artavanis lab for critical review of the manuscript. We thank Nick Brown and Larry Kauvar for their cDNA libraries. During this work, both D. A. H. and A. P were the recipients of long-term fellowships from the European Molecular Biology Organi- zation. This work was financed by grants from the American Cancer Society and the National Institutes of Health to S. A.-T.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 USC. Section 1734 solely to indicate this fact.

Received June 30, 1988; revised August 22, 1988.

References

ArtavanisTsakonas, S. (1988). The molecular biology of the Notch lo- cus and the fine tuning of differentiation in Drosophila. Trends Genet. 4, 95-100.

Azen, E., Lyons, K. M., McGonigal, T., Barrett, N. L., Clements, L. S., Maeda, N., Vanin, E. F., Carlson, D. M., and Smithies, 0. (1984). Clones from the human gene complex coding for salivary proline-rich proteins. Proc. Natl. Acad. Sci. USA 81, 5581-5585.

Bate, C. M. (1978). Embryogenesis of an insect nervous system. I. A map of the thoracic and abdominal neuroblasts in Locusta migratoria. J. Embryol. Exp. Morphol. 61, 317-330.

Benton, W. D., and Davis, R. W. (1977). Screening lambda gtl0 recom- binant clones by hybridizing to single plaques in situ. Science 196, 189-182. Bourne, H. R. (1988). One molecular mechanism can transduce di- verse signals. Nature 327, 814-818.

Breeden, L., and Nasmyth, K. (1987). Similarity between cell cycle genes of budding yeast and fission yeast and the Notch gene of Dro- sophila. Nature 329, 851-854.

Brown, N. H., and Kafatos, F C. (1988). Functional cDNA libraries from Drosophila embryos. J. Mol. Biol., in press. Campos-Ortega, J. A., and Hartenstein, V (1985). The embryonic de- velopment of Drosophila melanogastes (Berlin: Springer-Verlag). Cavener, D. R. (1987). Comparison of the consensus sequence flank- ing translational start sites in Drosophila and vertebrates. Nucl. Acids Res. 15, 1353-1381.

Codina, J., Yatani, A., Grenet, D., Brown, A. M., and Birnbaumer, L. (1987). The alpha subunit of the GTP binding protein Gk opens atrial potassium channels. Science 236, 442-445. Dale, R. M. K., McClure, B. A., and Houchins, J. P (1985). A rapid single-stranded cloning strategy for producing a sequential series of overlapping clones for use in DNA sequencing: application to se- quencing the corn mitochondrial 18s rDNA. Plasmid 13, 31-40. de la Concha, A., Dietrich, U., Weigel, D., and Campos-Ortega, J. A.

(1988). Functional interactions of neurogenic genes of Drosophila me- lanogaster. Genetics 118, 499-508.

Dietrich, U., and Campos-Ortega, J. A. (1984). The expression of neu- rogenic loci in imaginal epidermal cells of Drosophila melanogastef. J. Neurogenet. 1, 315-322.

Doe, C. Q., and Goodman, C. S. (1985a). Early events in insect neuro- genesis. I. Development and segmental differences in the pattern of neuronal precursor cells. Dev. Biol. 111, 193-205.

Doe, C. Q., and Goodman, C. S. (1985b). Early events in insect neuro- genesis. II. The role of cell interactions and cell lineage in the determi- nation of neuronal precursor cells. Dev. Biol. 111, 208-219.

Eyre, D .R. (1980). Collagen: molecular diversity in the bodys protein scaffold. Science 207, 1315-1322.

Feinberg, A. P, and Vogelstein, B. (1983). A technique for radiolabel- ling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 8-13.

Fong, H. K. W., Hurley, J. B., Hopkins, R. S., Miake-Lye, R., Johnson, M. S., Doolittle, R. F., and Simon, M. I. (1988). Repetitive segmental structure of the transducin 5 subunit: homology with the CDC4 gene and identification of related mRNAs. Proc. Natl. Acad. Sci. USA 83, 2182-2186.

Fong, H. K. W., Amatruda, T. T, Ill, Birren, B. W., and Simon, M. I. (1987). Distinct forms of the 5 subunit of GTP-binding regulatory pro- teins identified by molecular cloning. Proc. Natl. Acad. Sci. USA 84, 3792-3798.

Gao, B., Gilman, A. G., and Robishaw, J. D. (1987). A second form of the 8 subunit of signal-transducing G proteins. Proc. Natl. Acad. Sci. USA 84, 6122-8125.

Gilman, A. G. (1987). G proteins: transducers of receptor-generated signals. Annu. Rev. Biochem. 56, 615-849.

Gribshov, M., Devereux, J., and Burgess, R. R. (1984). The codon preference plot: graphic analysis of protein coding sequences and prediction of gene expression. Nucl. Acids Res. 12, 539-549.

Hartenstein, V., and Campos-Ortega. J. A. (19&). Early neurogenesis in wild-type Drosophila melanogaster. Roux’s Arch. Dev. Biol. 193. 308-325.

Hartley, D.A., Xu, T., and Artavanis-Tsakonas, S. (1987). The embryonic expression of the Notch locus of Drosophila melanogaster and the im- plications of point mutations in the extracellular EGF-like domain of the predicted protein. EMBO J. 6, 3407-3417.

Henikoff. S. (1984). Unidirectional digestion with exonuclease Ill cre- ates targeted breakpoints for DNA sequencing. Gene 28, 351-359.

Hoppe, P E., and Greenspan, R. J. (1986). Local function of the Notch gene for embryonic ectodermal pathway choice in Drosophila. Cell 46, 773-783.

Ingham, P W., Howard, K. R., and Ish-Horowitz, D. (1985). Transcrip- tion pattern of the Drosophila segmentation gene hairy. Nature 318, 439-445.

Jelsema, C. L., and Axelrod, J. (1987). Stimulation of phospholipase A2 activity in bovine rod outer segments by the p/gamma subunits of transducin and its inhibition by the cz subunit. Proc. Natl. Acad. Sci. USA 84, 3623-3827.

Kelley, M. R., Kidd, S., Deutsch, W. A., and Young, M. W. (1987). Muta- tions altering the structure of epidermal growth factor-like coding se- quences at the Drosophila Notch locus. Cell 51, 539-548.

Knust, E., Bremer, K. A., V&sin, H., Ziemer, A., Tepass, U., and Campos-Ortega, J. A. (1987a). The Enhancer of split locus and neuro- genesis in Dmsophile melanogaster. Dev. Biol. 122, 282-273.

Knust, E., Tietze, K., and Campos-Ortega, J. A. (1987a). Molecular analysisof the neurogenic locus Enhancer of split of Drosophilemelan- ogaster EMBO J. 6, 4113-4123.

Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 757, 105-132.

Lehmann, R., Jimenez, F., Dietrich, U., and Campos-Ortega J. A. (1983). On the phenotype and development of mutants of early neuro- genesis in Drosophile melanogaster Roux’s Arch. Dev. Biol. 192, 62-74.

G-Protean Homology to Enhancer of split 795

Lipman, 0. J., and Pearson, W. Ft. (1985). Rapid and sensitive protein similarity searches. Science 227, 1435-1441.

Logothetis, D. E., Kurachi, Y., Galper, J., Neer, E. J., and Clapham, D. E. (1987). The B/gamma subunits of GTP-binding proteins activate the muscarinic K+ channel in heart. Nature 325, 321-326.

Maize&J. V., and Lenk, R. P. (1981). Enhanced graphic matrix analysis of nucleic acid protein sequences. Proc. Natl. Acad. Sci. USA 78, 7665-7669.

Yochem, J., and Byers, 8. (1987). Structural comparison of the yeast cell division cycle gene CDC4 and a related pseudogane. J. Mol. Biol. 195, 233-245.

Markopoulou, K. (1987). The role of the Notch locus in the imaginal de- velopment of Drosophila melanogasfer Ph.D. thesis, Yale University, New Haven, Connecticut.

Mizusawa, S., Nishimura, S., and Seela, F. (1986). Improvement of the dideoxy chain termination method of DNA sequencing by use of deoxy 7 deazaguanosine triphosphate in place of dGTP. Nucl. Acids Res. 74, 1319-1324.

Needleman. S. B., and Wunsch, C. D. (1970). A general method ap- plicable to the search for similarities in the amino acid sequence of two proteins. J. Mol. Biol. 48, 443-453. Poole, S. J., Kauvar, L. M., Drees, B., and Kornberg, T. (1985). The en- grailed locus of Drosophila: structural analysis of an embryonic tran- script. Cell 40, 37-43.

Paulson, D. F. (1937). Chromosomal deficiencies and embryonic devel- opment of Drosophila melanogaster. Proc. Nab. Acad. Sci. USA 23, 133-137.

Paulson, D. F. (1950). Histogenesis, organogenesis, and differentiation in the embryo of Drosophila melanogaster In Biology of Drosophila, M. Cemerec, ed. (New York: Wiley). pp. 168-274.

Preiss, A., Hartley, D A., Artavanis-Tsakonas, S. (1988). The molecular genetics of enhancer ofsplit, a gene required for embryonic neural de- velopment in Drosophila. EMEO J. 7, in press.

Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5483- 5467.

Stryer, L., and Bourne, H. R. (1986). G proteins: a family of signal trans- ducers. Annu. Rev. Cell Biol. 2, 391-419.

Tabor, S., and Richardson, C. C. (1987). DNA sequence analysis with a modified bacteriophage T7 DNA polymerase. Proc. Natl. Acad. Sci. USA 84, 4767-4771.

Technau, G. M., and Campos-Ortega. J. A. (1986). Lineage analysis of transplanted individual cells in embryos of Drosophila melanogastez II. Commitment and proliferative abilities of epidermal and neural cell precursors. Roux’s Arch. Dev. Biol. 795, 445-454.

Technau, G. M., and Campos-Ortega, J. A. (1987). Cell autonomy of expression of neurogenic genes of Drosophila melanogaskx Proc. Natl. Acad. Sci. USA 84, 4500-4504.

Thomas, J. B., Bastiani, M. J., Bate, M., and Goodman, C. S. (1984). From grasshopper to Drosophila: a common plan for neuronal develop ment. Nature 310, 203-207.

Vlssin, H., Vielmetter, J., and Campos-Ortega, J. A. (1985). Genetic interactions in early neurogenesis of Drosophila meknogaster. J. Neu- rogenet. 2, 291-395.

V&sin, H., Bremer, K. A., Knust, E., and Campos-Ortega. J. A. (1987). The neurogenic locus Delta of Drosophila melanogasfer is expressed in neurogenic territories and encodes a putative transmembrane pro- tein with EGF-like repeats. EMBO J. 77, 3431-3440.

Welshons, W. J. (1956). Dosage experiments with split mutants in the presence of an enhancer of split. Dros. Inf. Service 30, 157-158.

Welshons. W. J. (1965). Analysis of a gene in Drosophila. Science 150, 1122-1129.

Wharton, K. A., Johansen, K. M., Xu, T., and Artavanis-Tsakonas, S. (1985). Nucleotide sequence from the neurogenic locus Notch implies a gene product that shares homology with proteins containing EGF-like repeats. Cell 43, 567-581.

Yarfitz, S., Provost, N. M., and Hurley, J. 6. (1986). Cloning of a Dro- sophila melanogaster G protein 6 subunit gene and characterization of its expression during development. Proc. Natl. Acad. Sci. USA, in press.