β-LACTAMASE-MEDIATED RESISTANCE TO...

β-LACTAMASE-MEDIATED RESISTANCE TO

ANTIMICROBIALS: THE RELATIONSHIP BETWEEN

GENOTYPE AND PHENOTYPE

Tegan Maree Harris

Bachelor of Applied Science (Honours IIa), QUT 2006

School of Biomedical Sciences, Institute of Health and Biomedical Innovation

Queensland University of Technology

Brisbane, Australia

A thesis submitted for the degree of Doctor of Philosophy of the Queensland

University of Technology

September 2014

____________________________________________________________________ ii β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype iii

STATEMENT OF ORIGINAL AUTHORSHIP

The work presented in this thesis has not been previously submitted to meet

requirements for an award at this or any other higher education institution. To

the best of my knowledge and belief, this thesis contains no material previously

published or written by another person except where due reference is made.

Signed:

Tegan Maree Harris B. App. Sci. (Hons)

Date: 29/9/2014

QUT Verified Signature

____________________________________________________________________ iv β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype v

ABSTRACT

Extended-spectrum β-lactamase (ESBL)-mediated antibiotic resistance in Gram

negative pathogens is a global problem. ESBLs confer resistance to third-generation

cephalosporins and monobactams. It is common for ESBLs to be derived from broad-

spectrum precursors by point mutation, and typically this occurs in a clinical situation

where third-generation cephalosporins are in common use. Typically, ESBL-encoding

genes are plasmid-borne, and rapidly disseminated. The overall aim of this project was

to determine, at a molecular level, what genetic events take place when resistance to

third generation cephalosporins is selected for in Klebsiella pneumoniae. The focus was

on β-lactamases of the SHV and TEM families.

Chapter Three explores the genetic structures involved in blaSHV amplification

on a plasmid. Plasmid-borne blaSHV is positioned on composite transposons created

through insertion sequence (IS) IS26-mediated translocation of K. pneumoniae

chromosomal DNA fragments containing blaSHV. Two translocation events saw the

creation of two blaSHV composite transposons that differ in size (referred to in this

thesis as the small- and large-blaSHV transposons). The polymerase chain reaction was

used to amplify fragments of DNA that only existed if tandem repeats of the small- or

large-blaSHV transposons were present. Tandem repeats of the small- and large-blaSHV

transposons were observed in their respective K. pneumoniae isolates. A novel gene

array was observed where aph(3’)-Ia, a gene encoding resistance to aminoglycoside

antibiotics, flanked the large-blaSHV transposon tandem array. aph(3’)-Ia was not

incorporated into the large-blaSHV transposon tandem repeating unit, even in the

presence of selective pressure specific to blaSHV amplification, demonstrating that

homologous recombination events were specific to the gene under selection. In this

instance, selective pressure with one antibiotic did not select for resistance to two

different classes of antibiotics.

Recent changes to antimicrobial susceptibility testing guidelines encompassed a

lowering of third-generation cephalosporin susceptibility breakpoints, and the

recommendation that the testing for, and reporting of an ESBL phenotype is of no

clinical importance. The premise for these changes was that the minimum inhibitory

concentration (MIC) alone is capable of determining the presence of antibiotic

resistance. Chapter Four of this thesis explored the conditions required for the

acquisition of a SHV- or TEM-ESBL mutation, and if the genotype correlated with a

____________________________________________________________________ vi β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

third-generation cephalosporin MIC greater than the susceptibility breakpoint.

Acquisition of an SHV-ESBL genotype resulted in a cefotaxime MIC greater than the

current susceptibility breakpoint, demonstrating that the cefotaxime MIC alone is

sufficient in determining the presence of a SHV-ESBL. Ceftazidime MIC alone was not

able to determine the presence of a TEM-ESBL in all the isolates tested. Ceftazidime

MICs greater than the susceptibility breakpoint were observed only in the presence of a

strong blaTEM promoter sequence and a TEM-ESBL with a high catalytic efficiency. In

this instance, ESBL testing would be warranted to identify isolates that have an ESBL

genotype but are clinically susceptible to third-generation cephalosporins.

Heteroresistance is defined as the presence of bacterial subpopulations with

increased antibiotic MICs compared to the overall population. It was investigated if

isolates harbouring blaSHV or blaTEM were heteroresistant to third-generation

cephalosporins (Chapter Five). Heteroresistance was observed for K. pneumoniae

populations harbouring blaSHV or blaTEM, irrespective of an ESBL genotype. bla gene

amplification conferred heteroresistance for isolates harbouring blaSHV. The mechanism

for heteroresistance in isolates harbouring blaTEM could not be determined. These

findings demonstrate that heteroresistance, and bla copy number plasticity can

confound MIC determination,

Chapter Six describes a high-resolution melt (HRM) assay that discriminates

blaTEM promoter variants. K. pneumoniae isolates harbouring blaTEM were tested. The P4

promoter was differentiated from the P3 and Pa/Pb promoters, and mixed P3 and

Pa/Pb promoter alleles were discriminated from P3, Pa/Pb, and P4 promoters.

Discrimination of stronger promoter alleles in minority, in an excess of weaker

promoter alleles, from pure P3, Pa/Pb, and P4 promoters was next explored. Allele

mixtures containing 10% Pa/Pb alleles in an excess of P3, and 20% P4 alleles in an

excess of Pa/Pb were discriminated from pure P3, Pa/Pb, and P4 alleles. The blaTEM

promoter HRM assay provided a rapid method for the discrimination of blaTEM

promoters.

Overall, the presented work demonstrates that stronger bla gene promoters

and an SHV- or TEM-ESBL genotype are required to confer a third-generation

cephalosporin MIC above susceptibility breakpoints. This indicates that genetic

analyses that reveal the potential to become antibiotic resistant (or more resistant),

rather than simply indicating the existing resistance phenotype, may be clinically

useful. This would allow for the prediction of resistance emergence in the presence of

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype vii

selective pressure, thereby preserving currently available antibiotics and minimizing

treatment failure.

____________________________________________________________________ viii β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

LIST OF KEY WORDS

Klebsiella pneumoniae; blaSHV; blaTEM; β-lactamase; extended-spectrum

β-lactamase; ESBL; bacteria; minimum inhibitory concentration; MIC;

polymerase chain reaction; PCR; real-time PCR; aph(3’)-Ia; stepwise selection to

cefotaxime resistance; third-generation cephalosporins; homologous

recombination; mutation rate; population analysis profile; PAP; high-resolution

melt; HRM; transposon; insertion sequence; IS; IS26; inoculum effect.

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype ix

PUBLICATION AND CITATION STYLE

PUBLICATIONS

Chapters are being prepared for submission. Chapters 4 and 5 will be combined into a

single paper.

CITATION STYLE

The citation style used in this thesis is that of journals published by the American

Society for Microbiology, References are listed in alphabetical order using the last name

of the first author, and numbered. In text citations are represented by the

corresponding number.

____________________________________________________________________ x β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

ACKNOWLEDGEMENTS

First and foremost, I would like to thank my prinicipal supervisor Phil Giffard, and my

associate supervisor Flavia Huygens, for their excellent guidance and support for the

duration of this thesis. Their expertise and insights throughout my Bachelor (Honours)

and PhD studies has been of great benefit to the completion of this pursuit, and future

endeavours as an independent researcher. Phil in particular has been a wonderful

mentor, and I am very fortunate to have been his student. I would also like to thank my

collaborators, Jan Bell and John Turnidge (Women and Childrens Hospital, Adelaide)

for providing the bacterial isolates that I have studied in this project.

A big thank you is extended to QUT and IHBI for allowing me to undertake this project,

and for providing my scholarship and travel funding. I would also like to thank Menzies

School of Health Research for providing a welcoming and stimulating atmosphere for

conducting my research and finishing my studies.

I would like to acknowledge the research groups I have been a part of both at QUT (Erin

Price, Alex Stephens, Shreema Merchant, Raquel Lo, Yu Pei Tan, Erin Honsa) and

Menzies (Deb Holt, Patiyan Andersson, Rebecca Towers, Rachael Lilliebridge, Steven

Tong), and also my fellow PhD candidates Jacklyn Ng, Yuwana Podin, Wajahat

Mahmood and Annette Dougall for their scientific advice and support during my PhD.

I would also like to thank Joshua Chan for writing the MSS-maximum likelihood

mutation rate programs used in Chapter 4, and Mark Chatfield at Menzies School of

Health Research for his statistical analysis support.

Lastly, I extend a special thanks to my family and friends: Sue, Trevor, Pamela, Gillian,

Beck, Lisa, Leon, Eduardo, Nick, Jess, Alice, Margaret, Dylan, James, Robyn, and Natalie.

Words cannot express how appreciative I am of your endless encouragement and

support throughout this journey.

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype xi

LIST OF ABBREVIATIONS

∆G Gibbs Free Energy

AUC Area Under the Curve

BLAST Basic Local Alignment Software Tool

bp Base Pair(s)

CAZ Ceftazadime

CG Confluent Growth

CLSI Clinical and Laboratory Standards Institute

CMT Complex Mutant TEM β-lactamase

CT Cycle threshold

CTAv Mean replicate CT value

CTDiff Difference between two replicate CT values

CTX Cefotaxime

CT/CTL Cefotaxime / cefotaxime + clavulanic acid

DIG Digoxygenin

DNA Deoxyribonucleic acid

DSB Double strand break

dsDNA Double-stranded DNA

ESBL Extended-spectrum β-lactamase

EUCAST European Committee on Antimicrobial Susceptibility Testing

HRM High Resolution Melt

hVISA Heteroresistant Vancomycin-Intermediate Staphylococcus aureus

IRT Inhibitor-Resistant TEM β-lactamase

IS Insertion Sequence

KAN Kanamycin

Kb Kilobase(s)

KESC Klebsiella, Enterobacter, Serratia, and Citrobacter

LB Luria-Bertani

m Number of mutations per culture

MALDI-TOF MS Matrix-Assisted Laser Desorption/Ionisation Time-Of-Flight Mass

Spectrometry

MH Mueller Hinton

____________________________________________________________________ xii β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

MH-CAZ Mueller Hinton agar plates containing 1 μg/mL CAZ

MH-CTX Mueller Hinton agar plates containing CTX

MH-Rif MH agar plates containing 150 μg/mL rifampicin

MIC Minimum Inhibitory Concentration

MR Mutation Rate

Mt Mutant

NBT/BCIP Nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl

phosphate

NGS Next-Generation Sequencing

Nt Number of viable cells plated

NTC No Template Control

O/N Overnight

PAH Princess Alexandra Hospital

PAP Population Analysis Profile

PAP-AUC Population Analysis Profile-Area Under the Curve

PBP Penicillin-Binding Protein

PCR Polymerase Chain Reaction

PCR-RFLP PCR Restriction Fragment Length Polymorphism

PCR-SSCP PCR Single-Strand Conformational Polymorphism

pI Isoelectric point

r-determinant Resistance determinant

Rif Rifampicin

RNA Ribonucleic acid

rpm Revolutions per minute

SNP Single Nucleotide Polymorphism

Tm Melting temperature

Topt Stringent hybridisation temperature

TZ/TZL Ceftazidime / ceftazidime + clavulanic acid

µ Mutation Rate

VISA Vancomycin-Intermediate Staphylococcus aureus

VRE Vancomycin-Resistant Enterococci

Wt Wildtype

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype xiii

TABLE OF CONTENTS

STATEMENT OF ORIGINAL AUTHORSHIP ............................................................ iii

ABSTRACT ..................................................................................................................... v

LIST OF KEY WORDS .................................................................................................. viii

PUBLICATION AND CITATION STYLE ...................................................................... ix

ACKNOWLEDGEMENTS ................................................................................................. x

LIST OF ABBREVIATIONS ............................................................................................ xi TABLE OF CONTENTS ................................................................................................ xiii

LIST OF FIGURES .......................................................................................................... xvi LIST OF TABLES ......................................................................................................... xviii

CHAPTER 1 Literature Review ................................................................................. 1

1.1 Origin of β-lactam Antibiotic Development and Resistance Emergence ....................................................................................................................... 1

1.2 β-lactam Antibiotics ........................................................................................ 3

1.2.1 Penicillins..................................................................................................................... 3

1.2.2 Cephalosporins .......................................................................................................... 3

1.2.3 Monobactams ............................................................................................................ 5

1.2.4 Carbapenems ............................................................................................................. 5

1.2.5 β-lactamase inhibitors ........................................................................................... 6

1.3 Bacterial Mobile Genetic Elements ............................................................ 6

1.4 β-lactamase-Mediated Antibiotic Resistance ........................................ 8

1.4.1 β-lactamase classifications .................................................................................. 8

1.4.2 Ambler Class A β-lactamase numbering system ......................................... 9

1.4.3 SHV β-lactamases ..................................................................................................... 9

1.4.4 TEM β-lactamases..................................................................................................12

1.5 Antimicrobial Susceptibility Testing ..................................................... 14

1.6 β-lactamase-Mediated Resistance Detection in the Clinical Laboratory ....................................................................................................... 15

1.6.1 Phenotypic Methods ..............................................................................................16

1.6.2 Commercial tests for β-lactamase detection ..............................................17

1.6.3 ESBL confirmatory testing .................................................................................19

1.6.4 Genotypic methods of β-lactamase detection ............................................20

1.7 Aims and Hypotheses .................................................................................. 25

CHAPTER 2 General Methods ................................................................................ 27

2.1 Bacterial Isolates .......................................................................................... 27

2.2 Phenotypic Methods .................................................................................... 27

2.2.1 Etest® ..........................................................................................................................27

2.3 Genotypic Methods ....................................................................................... 30

2.3.1 Preparation of Genomic DNA ............................................................................30

2.3.2 Primer Design ..........................................................................................................31

2.3.3 Polymerase Chain Reaction (PCR) ..................................................................31

2.3.4 DNA Quantification ...............................................................................................32

2.3.5 Sequencing ................................................................................................................33

2.3.6 Real-Time PCR .........................................................................................................33

2.3.7 blaSHV Quantitative Real-Time PCR ................................................................34

____________________________________________________________________ xiv β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

2.3.8 blaTEM Quantitative Real-Time PCR ............................................................... 35

2.3.9 Allele-specific PCR to detect the blaSHV codon 238 polymorphism ... 36

CHAPTER 3 Structure of the blaSHV Tandem Repeating Unit and its Response to CTX Selective Pressure ............................................ 39

3.1 Introduction .................................................................................................... 39

3.2 Methods ............................................................................................................ 42

3.2.1 Bacterial Isolates ................................................................................................... 42

3.2.2 Describing the blaSHV Tandem Repeating Unit .......................................... 42

3.2.3 Determining the location of aph(3’)-Ia in relation to the blaSHV

transposon ................................................................................................................ 44

3.2.4 Digoxigenin (DIG) Southern Hybridisation ................................................ 46

3.2.5 Stepwise Selection to CTX Resistance ............................................................ 49

3.2.6 Phenotypic Analysis .............................................................................................. 49

3.2.7 Genotypic Analysis ................................................................................................. 50

3.2.8 Quantitative Real-time PCR .............................................................................. 50

3.3 Results ............................................................................................................... 52

3.3.1 The small-blaSHV transposon forms tandem repeats interspersed

with a single IS26 ................................................................................................... 52

3.3.2 aph(3’)-IA flanks the large-blaSHV transposon tandem repeat region

61

3.3.3 aph(3’)-Ia does not flank the small-blaSHV transposon tandem repeat

region .......................................................................................................................... 61

3.4 DISCUSSION ..................................................................................................... 74

CHAPTER 4 A blaTEM or blaSHV Extended-Spectrum β-lactamase Genotype is not always associated with an Extended-Spectrum β-Lactamase phenotype ............................................... 77

4.1 Introduction .................................................................................................... 77

4.2 Methods ............................................................................................................ 79

4.2.1 Bacterial Isolates ................................................................................................... 79

4.2.2 Characterisation of blaTEM promoter types for individual isolates .. 79

4.2.3 Mutation Rate Determination .......................................................................... 79

4.2.4 Phenotypic Analysis .............................................................................................. 82

4.2.5 Genotypic analysis ................................................................................................. 83

4.3 Results ............................................................................................................... 84

4.3.1 A SHV-ESBL genotype in the absence of blaSHV amplification confers

phenotypic resistance to CTX ............................................................................ 84

4.3.2 A TEM-ESBL genotype does not always confer a CAZ resistant

phenotype .................................................................................................................. 87

4.4 Discussion ........................................................................................................ 98

CHAPTER 5 The Contribution of blaSHV and blaTEM Gene Copy Number Expansion to the Resistance Phenotype of K. pneumoniae Isolates ................................................................................................ 103

5.1 Introduction ................................................................................................. 103

5.2 Methods ......................................................................................................... 106

5.2.1 Bacterial Isolates ................................................................................................ 106

5.2.2 PAP Methodology Development ................................................................... 106

5.2.3 PAP Method Application .................................................................................. 106

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype xv

5.2.4 Phenotypic Analysis ........................................................................................... 108

5.2.5 Genotypic Analysis .............................................................................................. 108

5.3 Results ............................................................................................................ 109

5.3.1 Initial exploration of PAP methodology for β-lactamase expressing

K. pneumoniae ...................................................................................................... 109

5.3.2 CTX-resistant subpopulations are observed for populations

harbouring plasmid-borne blaSHV ................................................................ 113

5.3.3 Subpopulations with reduced susceptibility to CAZ are influenced by

the blaTEM gene promoter variant ................................................................ 121

5.4 Discussion...................................................................................................... 127

CHAPTER 6 Discriminating blaTEM Promoter Variants Using High Resolution Melt Analysis ............................................................... 133

6.1 Introduction.................................................................................................. 133

6.2 Methods .......................................................................................................... 136

6.2.1 Bacterial Isolates ................................................................................................. 136

6.2.2 Characterisation of blaTEM promoter types for individual isolates 136

6.2.3 Preparation of Spiked Template DNA ........................................................ 136

6.2.4 HRM protocol using Invitrogen Platinum® SYBR® Green qPCR

Supermix-UDG Mastermix ............................................................................... 136

6.2.5 HRM protocol using Bioline SensiMix™ SYBR® NoRef ......................... 140

6.2.6 HRM protocol using TrendBio HRM Master Mix containing

LCGreen® Plus+ .................................................................................................... 140

6.2.7 HRM protocol using Bioline SensiMix™ HRM Mastermix containing

EvaGreen® .............................................................................................................. 141

6.2.8 Analysis of HRM Data ........................................................................................ 141

6.2.9 uMeltSM TEM_Pr HRM curve prediction ..................................................... 141

6.3 Results ............................................................................................................ 142

6.3.1 Characterisation of blaTEM promoter type ................................................ 142

6.3.2 Comparison of four mastermixes for HRM-based discrimination of

blaTEM promoter sequences. ............................................................................ 142

6.3.3 Discrimination of P3+Pa/Pb mixed allele promoters from pure P3,

Pa/Pb, and P4 promoters ................................................................................ 145

6.3.4 Discrimination of strong blaTEM promoters in minority allele

frequencies from pure P3, Pa/Pb, and P4 promoters .......................... 147

6.3.5 TEM_Pr HRM curve prediction ...................................................................... 152

6.4 Discussion...................................................................................................... 154

CHAPTER 7 General Discussion .......................................................................... 158

BIBLIOGRAPHY ........................................................................................................... 168

APPENDICES ................................................................................................................ 199

____________________________________________________________________ xvi β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

LIST OF FIGURES

Figure 1.1 The chemical structure of β-lactam antibiotics………………….. 2 Figure 1.2 Bacterial mobile genetic elements……………………………………. 7 Figure 1.3 SHV extended-spectrum β-lactamases (ESBLs) and their

respective codon mutations, relative to their progenitor β-lactamase……………………………………………………………………… 10

Figure 1.4 The two blaSHV composite transposon structures..……………… 11 Figure 1.5 Minimum inhibitory concentration (MIC) determination

and extended-spectrum β-lactamase (ESBL) detection using the Etest®……………………………………………………………...... 18

Figure 2.1 STATA code for the calculation of error propagation relative gene copy numbers……………………………………………… 36

Figure 3.1 The small- and large-blaSHV transposon structures, and the approximate annealing positions of the tandem repeat bridging PCR amplicon primers………………………………………… 40

Figure 3.2 Amplicon bridging adjacent copies of the small-blaSHV transposon………………………………………………………………………. 53

Figure 3.3 Amplicon bridging adjacent copies of the large-blaSHV transposon………………………………………………………………………. 55

Figure 3.4 Amplicon bridging adjacent copies of IS26…………..…………… 58 Figure 3.5 Southern hybridisations to the amplicon bridging adjacent

copies of the large-blaSHV transposon….…………………………….. 60 Figure 3.6 aph(3’)-Ia is adjacent to the 5’ and 3’ ends of the large-

blaSHV transposon……………………………………………………………... 62 Figure 3.7 aph(3’)-Ia neighbours the 3’ end of the small-blaSHV

transposon………………………………………………………………………. 65 Figure 3.8 Stepwise selection to cefotaxime (CTX) resistance flow

diagram…………………………………………………………………………… 68 Figure 3.9 aph(3’)-Ia adjacent to the 5’ end of the small-blaSHV

transposon tandem repeat region can be lost during stepwise selection to cefotaxime (CTX)……………………………... 69

Figure 3.10 blaSHV and aph(3’)-Ia relative gene copy numbers of the stepwise selection to cefotaxime (CTX) resistance derived strains…………………….……………………………………………………….. 72

Figure 3.11 aph(3’)-Ia adjacent to the 5’ and 3’ ends of the large-blaSHV transposon can be lost during stepwise selection to CTX resistance………………………………………………………………………… 73

Figure 4.1 blaTEM promoter variants………………………………………………….. 81 Figure 4.2 Isolate 110 strains cultured during mutation rate

determination subcultured onto the Brilliance™ extended-spectrum β-lactamase (ESBL) chromogenic media (Oxoid)……………………………………….…………………………………… 87

Figure 4.3 Relative blaSHV copy number iterations derived from error propagation calculations…………………………………………………... 89

Figure 4.4 Colony morphologies of strains cultured during mutation rate determination experiements selected for phenotypic and genotypic analysis……………………………………………………... 93

Figure 4.5 Ceftazidime (CAZ) minimum inhibitory concentrations (MIC) distributions of Class 1, 2, and 3 mutants…..……………. 94

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype xvii

Figure 4.6 Relative blaTEM copy number iterations derived from error

propagation calculations………………………………………………….. 97 Figure 5.1 Isolate F1 and B1 colony morphology on Mueller Hinton

agar plates containing cefotaxime (MH-CTX)…………………….. 110 Figure 5.2 Population analysis profile (PAP) of K. pneumoniae isolates

using a logarithmic scale of cefotaxime (CTX) concentrations…………………………………………………………………. 112

Figure 5.3 Population analysis profile (PAP) of K. pneumoniae isolates using a linear scale of cefotaxime (CTX) concentrations ……. 112

Figure 5.4 Population analysis profile (PAP) of K. pneumoniae isolate 110 strains harbouring plasmid-borne blaSHV……………………. 114

Figure 5.5 Cefotaxime (CTX) minimum inhibitory concentrations (MICs) of isolate 110 strains encoding SHV-ESBL…………….... 117

Figure 5.6 Reproducibility of the satellite colony observed within the Etest® zone of growth inhibition for isolate 110 strain C1….. 118

Figure 5.7 Box and whisker plot of population analysis profile-area under the curve (PAP-AUC) values……………………………………. 119

Figure 5.8 Relative blaSHV copy numbers of isolate 110 population analysis profile (PAP)-derivatives…………………………………….. 120

Figure 5.9 Colony morphology differences between population analysis profile (PAP)-derivatives…………………………………….. 121

Figure 5.10 Population analysis profile (PAP) analyses of K.

pneumoniae strains harbouring blaTEM………………………………. 123 Figure 5.11 The correlation between population analysis profile-area

under the curve (PAP-AUC) values and blaTEM promoter sequence………………………………………………………………………….. 126

Figure 5.12 Relative blaTEM copy numbers of population analysis profile (PAP)-derived strains encoding TEM….…………………………….. 127

Figure 6.1 blaTEM promoter variants observed for the clinical K.

pneumoniae isolates…………………………………………………………. 138 Figure 6.2 TEM_Pr amplicon high resolution melt (HRM) melt curves

of K. pneumoniae clinical isolates harbouring pure blaTEM promoter variants……………………………………………………………. 143

Figure 6.3 TEM_Pr amplicon high resolution melt (HRM) melt curves of K. pneumoniae clinical isolates harbouring mixed P3 and Pa/Pb blaTEM promoter alleles (P3+Pa/Pb)………………………… 146

Figure 6.4 Discrimination of P3 promoter template mixed with Pa/Pb template (P3+Pa/Pb) TEM_Pr amplicons from pure P3 and Pa/Pb promoter template TEM_Pr amplicons……………………. 148

Figure 6.5 Discrimination of P3 promoter template mixed with P4 template (P3+P4), and Pa/Pb promoter template mixed with P4 template (Pa/Pb+P4), from pure blaTEM promoter variants using the TrendBio HRM Mastermix…………………….. 151

Figure 6.6 uMelt™ TEM_Pr amplicon dissociation predictions……………. 153 Figure 6.7 Application of the blaTEM promoter high resolution melt

(HRM) assay…………………………………………………………………….. 157

____________________________________________________________________ xviii β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

LIST OF TABLES

Table 2.1 Bacterial isolates used in this thesis………………………………. 28 Table 3.1 Bacterial isolates used in Chapter 3................…………………… 43 Table 3.2 Primer sequences………………………………………………………….. 43 Table 3.3 PCR primer sets and PCR conditions………………………………. 45 Table 3.4 Phenotypic and genotypic analysis of the progenitor and

128 µg/mL CTX-derived K. pneumoniae strains from the stepwise selection to cefotaxime (CTX) resistance experiment……………………………………………………………………. 71

Table 4.1 K. pneumoniae isolates used in Chapter 4………………............. 80 Table 4.2 blaSHV mutation rate determination for isolate 110 at

different cefotaxime (CTX) concentrations……………..……… 85 Table 4.3 Phenotypic and genotypic analysis of isolate 110 strains

cultured during the mutation rate experiments………………. 88 Table 4.4 blaTEM mutation rate colony counts for the 20 parallel

cultures of each isolate………………………………………………….. 90 Table 4.5 MSS-Maximum Likelihood Estimates of the blaTEM

mutation rate to 1.0 µg/mL ceftazadime (CAZ)………............. 92 Table 4.6 Phenotypic and genotypic analysis of strains harbouring

blaTEM cultured during the mutation rate experiments…….. 95 Table 4.7 MSS-Maximum Likelihood Estimates of the blaTEM

mutation rate to 1.0 µg/mL cefotaxime (CTX) resistance – colonies harbouring extended-spectrum β-lactamase (ESBL)-conferring mutations...……………………………………….. 99

Table 5.1 K. pneumoniae isolates and mutation rate-derived strains used for population analysis profile (PAP) analysis………… 107

Table 5.2 Further characterisation of colonies derived from population analysis profile (PAP) K. pneumoniae isolates harbouring plasmid-borne blaSHV.................................................... 111

Table 5.3 Further characterisation of colonies derived from population analysis profile (PAP) culture from isolate 110 strains encoding non-extended spectrum β-lactamse (ESBL) SHV and ESBL SHV…………................................................... 115

Table 5.4 Further characterisation of colonies derived from population analysis profile (PAP) culture from strains encoding non-extended spectrum β-lactamase (ESBL) TEM and ESBL SHV.………………………………………………………. 124

Table 6.1 Real-time PCR and HRM Mastermixes used for TEM_Pr HRM analysis………………………………………………………………… 135

Table 6.2 blaTEM promoters in the K. pneumoniae clinical isolates….... 137

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype xix

__________________________________________________________________________________________________________________________________________

β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype 1

CHAPTER 1 Literature Review

1.1 Origin of β-lactam Antibiotic Development and Resistance

Emergence

The first β-lactam antibiotic discovered was called “penicillin” (101). A zone of growth

inhibition was seen on a Staphylococcus plate culture surrounding a contaminating

blue-green mould. The mould, later identified as Penicillium chrysogenum, was

releasing a substance that inhibited the growth of the Staphylococcus culture, observed

as a zone of growth inhibition surrounding the mould (101). The filtrate of the

Penicillium broth culture (penicillin) was discovered to be an effective antibacterial

agent for Gram positive bacteria, but ineffective against Gram negative bacteria and

fungi. Chain et. al., (1940) were the first to demonstrate in vivo bactericidal activity of

penicillin against Gram positive infections in mice (56). It is claimed that John

Bumstead and Orvan Hess were the first doctors to successfully treat a patient with

penicillin in 1942, although this is debated (338). Elucidation of the molecular

structure of penicillin identified the presence of a 4-membered β-lactam ring (Figure

1.1a), which is the defining feature of extant β-lactam antibiotics.

β-lactam antibiotics target penicillin binding proteins (PBPs) (114), which are

responsible for peptidoglycan synthesis and repair. Peptidoglycan is a key constituent

in the bacterial cell wall, hence interruption to the synthesis of this compound results in

the formation of an unstable bacterial cell wall, resulting in cell death (105). Since its

discovery, the widespread use of penicillin and other β-lactam antibiotics has resulted

in the development of bacterial resistance to these compounds, prompting the

development of new classes of β-lactam antibiotics with wider spectrums of activity

and improved pharmacodynamic properties. The major resistance mechanism to β-

lactam antibiotics is β-lactamase activity. β-lactamases are hydrolytic enzymes, the

majority of which act on the amide bond of the β-lactam ring, creating serine esters and

rendering the antibiotic inactive (137). β-lactamases can either be present on the

chromosome or a plasmid, and are often associated with transposons or integrons (52).

Unsurprisingly, the spread of β-lactamases has pushed further development of β-

lactam antibiotics for the past 60 years.

____________________________________________________________________ 2 β-lactamase-mediated resistance to antimicrobials: the relationship between genotype and phenotype

Figure 1.1. The chemical structure of β-lactam antibiotics.

A, penicillin; B, cephalosporin; C, monobactam; D, carbapenem. The characteristic four-membered β-lactam ring is identified in red, the thiazolidine ring associated with penicillins and carbapenems is in green and the dihydrothiazine ring associated with cephalosporins is in blue. Adapted from Essack (2001) (94).

__________________________________________________________________________________________________________________________________________


1.2 β-lactam Antibiotics

1.2.1 Penicillins

Benzylpenicillin was the first β-lactam antibiotic to be used clinically, successfully

treating nosocomial staphylococcal and streptococcal infections in the 1940’s. The

emergence of penicillin-resistant Staphylococcus aureus strains not long after the

introduction of benzylpenicillin lead to nosocomially-acquired S. aureus infections of

pandemic proportions by the end of the 1940’s (94). The dissemination of clonal S.

aureus strains harbouring plasmids encoding an inducible class A penicillinase was

implicated in these pandemics (214). To combat nosocomial infections,

isoxazolylpenicillins (e.g. methicillin and flucloxacillin) were created by adding specific

side chains to the (+)-6-aminopenicillanic acid nucleus of benzylpenicillin, resulting in

β-lactamse resistant to staphylococcal penicillinases. These were, and still are, used to

treat Staphylococcus spp. Infections (199). Aminopenicillins were created shortly after

and contain an amino group at the α-position of the β-lactam side chain. This

modification conferred a broader spectrum of antibacterial activity that included Gram

negative bacteria (148).

Soon after the introduction of aminopenicillins, it was observed that susceptible

bacteria (e.g. Escherichia coli) had acquired mobile plasmids harbouring genes

encoding β-lactamase enzymes with ampicillin activity. A gene encoding the TEM-1

enzyme was identified as the cause of ampicillin resistance in an E. coli isolate, isolated

in Greece, 1963 (78). TEM-1 and the structurally-related enzyme SHV-1 are the most

prevalent of the ampicillin resistance enzymes (48) and will be discussed later.

Numerous other chemical groups have also been added to the α-position of the β-

lactam side chain, increasing the antimicrobial activity against specific groups of Gram

negative bacteria.

1.2.2 Cephalosporins

Cephalosporins were developed to combat extant resistance to penicillin antibiotics.

Cephalosporins are defined by a dihydrothiazine ring attached to a β-lactam ring and

two side chain attachment sites (Figure 1.1b), as opposed to a thiazolidine ring and a

single side chain attachment site as seen in the penicillins (Figure 1.1a) (199). The first

generation cephalosporins were introduced in the 1960’s, and were able to permeate


the Gram negative outer membrane faster than penicillins and were stable against the

known β-lactamases of that time (94). Clinical isolates soon emerged with decreased

permeability, thus Gram negative bacilli became the predominant nosocomially-

acquired pathogens. Klebsiella pneumoniae isolates harbouring multiple antibiotic

resistance genes including plasmids harbouring blaTEM-1, and hyperproduction of class C

cephalosporinases (e.g. AmpC enzymes) by pathogens seldom implicated in clinical

resistance (e.g. Serratia marcescens) emerged as a serious problem in hospitals (214,

277).

Second generation cephalosporins were developed to overcome resistance to first-

generation cephalosporins, demonstrating increased activity against Gram negative

bacteria (197), stability against β-lactamases expressed by plasmid-borne bla genes,

and increased stability against class C cephalosporinases (e.g. AmpC enzymes) of

several clinical pathogenic Enterobacteriaceae (214). Resistance to second-generation

cephalosporins arose in the form of class A β-lactamase hyperproduction, conferred by

the chromosomal promoter (104, 130), gene regulator mutations and inducible

chromosomal β-lactamases (214, 295), or the hyperproduction of class C

cephalosporinases (273, 354).

Third generation cephalosporins were next developed, demonstrating increased

activity against Enterobacteriaceae, including β-lactamase-producers (206). Third

generation cephalosporins (e.g. cefotaxime (CTX)) contain aminothiazolyl and

iminomethoxy groups which accounts for their increased stability against

chromosomal Class C cephalosporinases (230). Different derivatives of third generation

cephalosporins were introduced to increase the spectrum of antimicrobial activity and

increase pharmacokinetic and pharmacodynamic properties (214). Hyperproduction of

class A β-lactamases allowed clinical resistance to these antibiotics and other classes of

antimicrobials (cephamycins and monobactams), as well as β-lactamase inhibitors

(354). Oxyiminocephalosporin-resistant Klebsiella isolates were discovered in 1983

(177), with a then unique mechanism of resistance – extended spectrum β-lactamases

(ESBLs). Mutations in the plasmid-borne blaTEM, blaSHV and blaOXA genes increase the

affinity of the enzymes for third generation cephalosporins and monobactams (265).

Fourth generation cephalosporins have increased activity against β-lactamase

derepressed mutants of Pseudomonas aeruginosa and other enteric bacteria, due to a

__________________________________________________________________________________________________________________________________________


charged quaternary nitrogen atom at C-3 (129). Fourth generation cephalosporins are

less susceptible to β-lactamases than third-generation cephalosporins; however,

hyperproduction of class C β-lactamases confers resistance to certain fourth-generation

cephalosporins (214). Cephamycins, otherwise known as α-methoxycephalosporins,

resemble cephalosporins structurally, due to the presence of a methoxy group at C-7 of

the β-lactam ring of the cephalosporin nucleus (94). The cephamycin cefoxitin has a

broad spectrum of activity, and is resistant to β-lactamase hydrolysis due to its 7-α-

methoxy group. The methoxy group and other groups on the 7-α position protect the β-

lactam ring from hydrolysis (148). Class C β-lactamases with cephamycinase activity

have now emerged on plasmids, which has lead to the dissemination of these genes

throughout Gram negative bacteria (27).

1.2.3 Monobactams

Monobactams differ from other β-lactam compounds because they are made up of a

single β-lactam ring that is not fused to another ring (Figure 1.1c). Aztreonam is

currently the only clinically used monobactam (199). Aztreonam harbours a side chain

identical to CAZ (a third generation cephalosporin) at C-3, which gives aztreonam

activity against Gram negative bacteria (46). Side chain substitutions produce

monobactam compounds with a broader spectrum of activity, including activity against

Gram positive organisms (46). Class C β-lactamases and ESBLs inactivate monobactams

(215).

1.2.4 Carbapenems

The carbapenems have the broadest spectrum of activity of all the β-lactam antibiotics.

With a 1-carbapen-2-em 3-carboxylic acid backbone, chemical substituents are added

on the C-2 and C-6 carbons (Figure 1.1d) (148). The carbapenems in current clinical

use – imipenem and meropenem – have 6-hydroxy ethyl groups in trans configuration,

whereas most other β-lactam antibiotics have aminoacyl groups in cis configuration

(94). This gives the carbapenems an increased stability to β-lactamases (230).

However, resistance has arisen in the form of carbapenem-hydrolysing metallo-β-

lactamases located on plasmids (299).


1.2.5 β-lactamase inhibitors

β-lactamase inhibitors are used in combination with β-lactam antibiotics to block the

action of β-lactamases, allowing the antibiotic to work more effectively. There are two

major groups of β-lactamase inhibitors: clavulanic acid, and the penicillanic acid

sulphones (199). Clavulanic acid inhibits many class A β-lactamases, including TEM-1

and ESBLs (343). The penicillinic sulphones encompass two β-lactamase inhibitors,

sulbactam and tazobactam. Although less efficient that clavulanic acid, sulbactam does

inhibit ESBLs and penicillinases (94). Tazobactam has a wide range of activity against

β-lactamases, and is as efficient as clavulanic acid (198); however its effectiveness

against SHV-derived ESBLs is unresolved, with reports that SHV enzymes are both

resistant (165) and susceptible (198) to tazobactam.

1.3 Bacterial Mobile Genetic Elements

Transposons are mobile segments of DNA that are able to translocate within a cell’s

genome. Transposons encode their own transport machinery, and depending on the

type of transposon either insert into random or specific target sites.

Insertion sequences (ISs) are perhaps the simplest transposons. An IS is made up of

one to two open reading frames that encode a transposase, the enzyme responsible for

the mobility of the insertion sequence (Figure 1.2) (205). Short inverted terminal

repeat sequences (10 – 40 bp) flank the transposase, creating the IS element. Terminal

repeat sequences are generally unique to a given family of ISs. When an IS element

inserts at a target site, the target sequence is duplicated so that short, direct repeats

flank the IS element’s terminal inverted repeats (205).

Two IS elements can flank a segment of DNA containing one or more genes, creating a

composite transposon. Often these genes encode for antibiotic resistance (e.g. plasmid-

borne blaSHV, discussed in section 1.4.3). The composite transposon structure is mobile,

with the IS elements providing the transposase necessary for insertion into and

excision from a location in the DNA sequence.

The Tn3 family of transposons are non-composite transposons, comprised of genes

encoding a resolvase and a β-lactamase in addition to a transposase, and inverted

__________________________________________________________________________________________________________________________________________


Figure 1.2. Bacterial mobile genetic elements

A, insertion sequence; B, composite transposon; C, Tn3 family transposase.

terminal repeats (Figure 1.2) (134). The resolvase binds to the res site between tnpA

and tnpR genes (Figure 1.2) to repress transcription and resolve cointegrates that are

formed during transposition (134).

Tranposition can be conservative or replicative. Conservative transposition is non-

replicative and involves excision of the transposon from the donor site and insertion

into the target site (32, 33). Excision is mediated by double-strand breaks at each end

of the transposon. Insertion requires staggered end cleavage of the donor site, from

which the extended strands of the donor replicon are joined to the transposon (31).

The DNA gaps are repaired, creating the target site duplication associated with

transposition of insertion sequences and their composite transposons.

Replicative transposition involves both recombination and replication processes. The 3’

ends of the transposon are cleaved at the donor site and are joined to staggered ends at


the cut in the target site. Replication from the free 3’ ends generates a cointegrate

structure. During this process the transposon is replicated and the donor replicon and

target replicon are joined by directly repeated copies of the element (17, 300).

Resolution of the cointegrate into two separate molecules again occurs via homologous

recombination. For Tn3 family transposons, the resolvase executes site-specific

recombination between the two replicons at the res site, resulting in the release of the

two replicons from the cointegrate structure.

1.4 β-lactamase-Mediated Antibiotic Resistance

1.4.1 β-lactamase classifications

Numerous β-lactamase classification systems have been suggested but the Ambler (7)

and Bush-Jacoby (55) classification schemes seem to be predominant. The Ambler

system classifies β-lactamases based on their amino acid sequence into four main

classes – A, B, C, and D (7). Class A, C, and D enzymes all harbour a serine residue at the

active site, whereas the active site of class B enzymes harbours a zinc residue. Class A

β-lactamases are chromosomal or plasmid-borne, and preferentially hydrolyse

penicillins (e.g. TEM-1, SHV-1, KPC). Class B encompasses the metallo-β-lactamases,

which hydrolyse carbapenems, penicillins and cephalosporins (e.g. IMP-1 and VIM-1).

Class C β-lactamases are the chromosomally-encoded AmpC enzymes, and class D β-

lactamases encompass the oxacillin-hydrolysing β-lactamases (e.g. OXA-1).

The Bush-Jacoby system correlates the β-lactamase molecular structure with the

substrate and inhibitory properties to create four major groups of β-lactamases (55).

Group 1 (Ambler class A) encompasses enzymes that are active against cephalosporins

and not inhibited by clavulanic acid (e.g. AmpC enzymes). Group2 β-lactamases are

inhibited by β-lactamase inhibitors. Metallo-β-lactamases impervious to β-lactamase

inhibitors make up group 3 (Ambler class D) (e.g. IMP-1, VIM-1). Group 4 (no Ambler

class) includes penicillinases that are not inhibited by clavulanic acid. Bush-Jacoby

group 2 is further divided into 8 sub-groups: 2a (Ambler class A) encompasses the

penicillinases (e.g. PC-1), 2b (Ambler class A) describes broad-spectrum β-lactamases

capable of hydrolysing both penicillins and cephalosporins (e.g. TEM-1, SHV-1), 2be

(Ambler class A) refers to ESBLs which hydrolyse third-generation cephalosporins and

monobactams (e.g. TEM-10, SHV-2), 2br (Ambler class A) encompasses inhibitor

__________________________________________________________________________________________________________________________________________


resistant enzymes (e.g. TEM-30, IRT-1), 2c (Ambler class A) includes carbenicillin-

hydrolysing enzymes (e.g. PSE-1), oxacillin-hydrolysing enzymes are located in group

2d (Ambler class D or A) (e.g. OXA-1), group 2e (Ambler class A) contains the

cephalosporinases (e.g. FEC-1), and in group 2f (Ambler class A) are the

carbapenemases (e.g. KPC-1). In this thesis I am focusing on the 2b and 2be classes of β-

lactamases, specifically SHV and TEM β-lactamases and ESBLs.

1.4.2 Ambler Class A β-lactamase numbering system

The Ambler numbering system was designed to standardise the amino acid positions in

Ambler Class A β-lactamases with different chain lengths (8). This allows for the direct

comparison of homologous residues between different Class A β-lactamases.

Homologous residues can differ in their ‘natural’ or ‘sequential’ numbers within a given

Class A β-lactamase, and the Ambler numbering system accommodates such variation.

For example, the active site of SHV β-lactamases include codons 238 and 240, yet codon

239 does not exist for this enzyme (http://www.lahey.org/Studies/).

1.4.3 SHV β-lactamases

The first described SHV enzyme was SHV-1, encoded by chromosomally-encoded

blaSHV-1 in isolates of the genus Klebsiella (259). SHV-1 was named after “sulphydryl

variable”, the proposed enzyme active site residue (213), which is now known to be

inaccurate (198). blaSHV-1 was later shown to be plasmid-borne, with the ability of

transferring the resistance phenotype to other bacterial strains (48). Its presence on

plasmids has lead to the world-wide dissemination of blaSHV genes, which can now be

found in many Enterobacteriaceae species.

The blaSHV-1 gene has undergone evolution since its discovery, to yield over a >170

enzyme variants (http://www.lahey.org/studies/inc_webt.asp), including extended-

spectrum enzymes. SHV β-lactamases are broad spectrum enzymes, conferring activity

against penicillins and narrow-spectrum cephalosporins (161). SHV-ESBLs arise

predominantly from a single nucleotide mutation in the blaSHV gene, resulting in a

glycine to serine amino acid substitution at codon 238 (G238S) (161) (Figure 1.3). This

substitution increases the size of the active site of the enzyme, allowing hydrolysis of

the third generation cephalosporin CTX. An additional glutamic acid to lysine amino

acid substitution at codon 240 (E240K) further increases the SHV-ESBL spectrum of


Figure 1.3. SHV extended spectrum β-lactamases (ESBLs) and their respective mutations relative to their progenitor β-lactamase.

Leucine to glutamine mutation at codon 35, (L35Q); glycine to serine mutation at codon 238, (G238S); glutamic acid to lysine mutation at codon 240, (E240K).

activity, allowing hydrolysis of the third-generation cephalosporin ceftazidime (CAZ)

(161) (Figure 1.3). The two main evolutionary lineages of SHV-ESBLs are discriminated

by a L35Q mutation (Figure 1.3) (240). This mutation is not located within the active

site of the SHV enzyme and is thought to not affect enzyme activity.

There is strong evidence to suggest that all existing plasmid-borne blaSHV genes have

culminated from one of two genome-to-plasmid mobilisation events, both of which

were mediated by the insertion sequence (IS) IS26 (103). Two distinct composite

transposons were formed, distinguishable by the positions of the flanking IS26

elements relative to blaSHV (Figure 1.4). One event resulted in IS26 insertion

approximately 2 Kbp upstream of the blaSHV gene (103). The other event saw the

insertion of IS26 in the blaSHV promoter, creating a new blaSHV promoter sequence

(pr::IS26-blaSHV) (260). These structures will be referred to as the ‘large’ and ‘small’

blaSHV transposon, respectively, throughout this thesis.

Podbielski et. al., (1991) reported that IS26 insertion into the blaSHV promoter region

increased the promoter strength by introduction of a new -35 site provided by the IS26

element (260). Until recently, it was thought that the plasmid-borne blaSHV promoter

associated with IS26 ~2 Kbp upstream of blaSHV was the same as the chromosomal

blaSHV promoter. Turner et. al., (2009) demonstrated that a single nucleotide

polymorphism in the -10 region of the plasmid-borne blaSHV promoter created a -10

__________________________________________________________________________________________________________________________________________


Figure 1.4. The two blaSHV composite transposon structures.

The two blaSHV composite transposon structures. Both structures consist of K. pneumoniae chromosomal DNA including blaSHV flanked by IS26 insertion sequences. A, blaSHV composite transposon identified by IS26 inserted into the promoter region of blaSHV-11 (small-blaSHV transposon); B, blaSHV composite transposon identified by insertion of IS26 ~2 Kbp upstream of blaSHV-1 (large-blaSHV transposon).

region closer to the consensus sequence, thereby increasing the promoter strength

(325). That SHV-ESBL expression is most commonly associated with plasmid-borne

blaSHV is likely due to increased promoter strength; weaker expression of chromosomal

blaSHV is not sufficient to express an ESBL phenotype (74, 127, 278).

Acquisition of an ESBL phenotype is thought to be associated with blaSHV copy number

expansion, and the relationship between blaSHV dosage and detectable ESBL expression

is almost certainly causal. Xiang et. al., (1997) identified an increase in blaSHV copy

number associated with K. pneumoniae harbouring the ESBL-encoding blaSHV-5 gene

(352). High-β-lactamase producers had an increased dosage of blaSHV-5 compared with

low-β-lactamase producers, although only a single copy of the plasmid harbouring

blaSHV-5 was present in both high- and low-producers. From this finding, Xiang et. al.,

(1997) suggested that amplification of the region on the plasmid harbouring blaSHV-5,

rather than whole plasmid amplification, was the reason for an increase in gene copy

numbers (352). This hypothesis correlates with recently described tandem

duplications of the plasmid-borne blaSHV-5 transposon (110, 356). Zienkiewicz et. al.,

(2007) observed that a greater dosage of blaSHV-5 conferred increased resistance to CAZ,

correlating with the hypothesis that blaSHV amplification and acquisition of an ESBL

phenotype are causal (356).


Correlation between tandem duplications of antibiotic resistance genes and

antimicrobial selective pressure, however, is not a new concept. This model was

extensively studied in the 1970’s and 80’s and has been termed “gene transition” by

certain research groups (67, 131, 353), but the mechanism remains to be fully

determined. Tandem repeats of antibiotic resistance genes have been observed for

plasmid-borne tetracycline resistance in Enterococcus faecalis (67, 353), and

chloramphenicol and streptomycin resistance genes in Proteus mirabilis (131). The

plasmid studied by Yagi and Clewell, (1977) (353) possessed DNA sequences termed

recombination sequences (RS) flanking the tetracycline resistance gene. These

homologous RS sequences were found to be an integral component for the three

recombination events proposed to result in the amplification of the tetracycline

resistance gene on a single plasmid. Similar models have been proposed by Ptashne

and Cohen, (1975) (270). Their model predicts that for the R-plasmid of P. mirabilis, the

IS1 sequences flanking the resistance-determinant (r-determinant) play a key role in

the creation of a “multiple r-determinant” plasmid via homologous recombination. It

was hypothesised that insertion sequences may play an important role in the evolution

of plasmid genomes via recombination. It is likely that plasmid-borne blaSHV

amplification occurs via homologous recombination events facilitated by flanking IS26

elements (Figure 1.4), resulting in tandemly-repeated blaSHV composite transposons

(110). Amplification of plasmid-borne blaSHV will be explored further in this study, by

describing the junction of blaSHV tandem-repeats for both the ‘small’ and ‘large’ blaSHV

composite transposon structures (Figure 1.4).

1.4.4 TEM β-lactamases

TEM-1 was the first described TEM β-lactamase, found in an Escherichia coli isolate

(78). The TEM β-lactamase obtained its name from Temoneira, the name of the patient

from whom the TEM-1-expressing E. coli was discovered in. TEM β-lactamases are most

commonly found in Enterobacteriaceae; however, TEM-β-lactamases have been

observed in other bacterial species, including P. aeruginosa (223) and Capnocytophaga

ochracea (304). To date, >200 unique TEM β-lactamases have been described, with the

majority of these being ESBL enzymes (http://www.lahey.org/studies/temtable.htm).

β-lactamase-inhibitor-resistant TEM (IRT) β-lactamases have also been described.

These enzymes generally have limited hydrolytic activity against third-generation

cephalosporins, thus they are not classed as ESBL enzymes (249). However, complex

__________________________________________________________________________________________________________________________________________


mutants of TEM β-lactamases (CMT) that are able to hydrolyse third-generation

cephalosporins and exhibit β-lactamase inhibitor resistance properties have been

described (100, 231, 262). The majority of TEM-ESBLs have evolved from TEM β-

lactamases as a result of substitutions at four key TEM amino acid positions – E104,

R164, G238, E240 (211). Different combinations of the aforementioned amino acid

substitutions, along with amino acid substitutions external to the active site of the

enzyme have given rise to the vast number of TEM-ESBLs observed today.

All blaTEM genes are found on complete or partial versions of Tn1, Tn2, Tn3 or their

variants (22). The chromosomal origin of blaTEM genes remains unknown, with blaTEM

predominantly observed as a plasmid-borne gene, although blaTEM has been found on

the chromosome of different bacterial species (65, 86). TEM-1 and TEM-2 are the

accepted parenteral TEM β-lactamase enzymes. TEM-2 is encoded by blaTEM-2 and TEM-

1 can be encoded by any of seven subtypes of blaTEM-1 (blaTEM-1A, blaTEM-1B, blaTEM-1C,

blaTEM-1D, blaTEM-1E, blaTEM-1F, blaTEM-1G) (190, 264). blaTEM-1 subtypes differ in their

nucleotide sequence at positions 32, 162 and 175 in the promoter, and nucleotides 226,

346, 436, 604, 682, 913 and 925 in the structural gene.

Expression of blaTEM is controlled by a variety of promoters (122, 190). Four blaTEM

promoter sequences are often observed, all differing by polymorphisms in the -35 or

-10 boxes of the promoter region. P3 was first described associated with the blaTEM-1a

gene, associated with Tn3 on the plasmid pBR322 (314). The Pa/Pb promoter is

comprised of two overlapping promoters Pa and Pb (62). The first two nucleotides of

the Pa -10 region correspond to the last two nucleotides of the Pb -35 region. A C�T

substitution in the Pa -10 region (Sutcliffe position 32 (314)) creates a sequence closer

to the consensus compared to the P3 -10 region, resulting in a stronger promoter (62,

184). It is thought that the cooperative activity of the overlapping promoters

contributes to it’s strength.The P4 promoter differs from P3 by a G�T base pair

substitution at Sutcliffe nucleotide position 162 (314), the first nucleotide of the P3 -10

box (122). The P4 promoter is stronger than both the P3 and Pa/Pb promoters (184).

blaTEM promoter P5 is the strongest promoter of those described and differs from P3 by

a C�G mutation in the -35 box of the P3 promoter, correlating with Sutcliffe position

141 (184, 190, 314).


The TEM enzyme family is well studied; however it is still unknown how these enzymes

mediate their extended-spectrum antibiotic resistance. Specific mutations are seen in

blaTEM genes encoding an ESBL, and isolates harbouring this gene present an ESBL

positive phenotype. Lartigue et. al., 2002 demonstrated that TEM expression directly

correlates with blaTEM promoter strength, thus it is likely that the blaTEM promoter

sequence participates in the acquisition of a TEM-ESBL phenotype (184). It is of

interest to determine what genetic determinants are required for TEM-ESBL

expression – is simply an ESBL-conferring blaTEM mutation enough, or are stronger

promoters required to enable sufficient enzyme expression for acquisition of an ESBL

phenotype. Amplification of blaTEM-1 has been shown to be a crucial step in resistance

acquisition to first- and second-generation cephalosporins (312). It is hypothesised

that blaTEM amplification will be a precursor to TEM-ESBL acquisition, by providing

multiple gene targets for point mutations to occur in. These knowledge gaps have

significant implications in improving clinical management of these resistant pathogens,

and patient outcomes. These knowledge gaps will be addressed in this thesis.

1.5 Antimicrobial Susceptibility Testing

The principle of phenotypic antimicrobial susceptibility testing is to determine the

susceptibility of pathogens based on their response to the presence of antimicrobials.

This is achieved by determining the minimum inhibitory concentration (MIC) of

individual antimicrobials towards an organism. MIC values are then compared to

antimicrobial susceptibility testing breakpoint values to determine the organisms

susceptibility to each antimicrobial tested. Three types of breakpoint values exist.

Epidemiological breakpoints refer to the MIC for a given antibiotic that discriminates

between wildtype populations and populations that harbour an acquired or selected

resistance mechanism (326). Clinical breakpoints are used to determine the treatment

success of a given antibiotic, and are generated from prospective human studies that

compare treatment outcomes with antibiotic MICs of infectious organisms.

Pharmacokinetic/pharmacodynamic breakpoints are also used to determine the

treatment success of a given antibiotic, but these are generated from animal models

and are extrapolated to humans. Pharmacokinetic/pharmacodynamic breakpoints

require the knowledge of pharmacodynamic properties and how they affect

antimicrobial efficacy in vivo (326).

__________________________________________________________________________________________________________________________________________


Breakpoint values are MIC cut-offs which allow infectious organisms to be categorised

as “susceptible”, “intermediate” or “resistant” to the antimicrobials being tested.

Susceptibility categories can refer to the interaction between the organism and the

antibiotic (determined in vitro), or the likelihood of treatment success (determined in

vivo). Two major organisations provide standards and guidelines for the

implementation and analysis of phenotypic antimicrobial susceptibility testing

methods and practices: the Clinical and Laboratory Standards Institute (CLSI)

(http://www.clsi.org/) and the European Committee on Antimicrobial Susceptibility

Testing (EUCAST) (http://www.eucast.org/). The CLSI provides the following

definitions for each susceptibility category: “susceptible” refers to isolates that are

inhibited by the usually achievable concentration of the antimicrobial agent when the

recommended dosage is used for that site of infection, “intermediate” includes isolates

with antimicrobial agent MICs that approach the usually attainable blood and tissue

levels and for which response rates may be lower than those for susceptible isolates,

and “resistant” implies that the isolates are not inhibited by the usully achievable

concentrations of the agent with normal dosing schedules and/or demonstrate MICs

that fall in the range where specific microbial resistance mechanisms are likely and that

clinical efficacy against the isolate has not been shown reliably in treatment studies

(73).

Discordance of susceptibility breakpoints between these two organisations means that

we have yet to see a universal system for determining clinical antimicrobial resistance.

1.6 β-lactamase-Mediated Resistance Detection in the Clinical

Laboratory

The increase in prevalence of ESBL-producing infectious clinical isolates creates a

greater need for efficient and accurate laboratory identification methods for the

presence of β-lactamase-mediated antimicrobial resistance. Predominantly,

antimicrobial susceptibility testing methods are phenotype-based, with very few

approved genotypic testing methods of antimicrobial resistance determination

currently in use (45, 136, 310, 340). The limitation of phenotypic antimicrobial

susceptibility testing is that the genetic resistance determinant cannot be directly

predicted.


The incorporation of genotypic antimicrobial resistance determination into standard

antimicrobial susceptibility testing is a contentious issue. It is argued that the presence

of a resistance gene does not always equate to phenotypic resistance, therefore the

reporting of genotypic resistance may unnecessarily limit available treatment options

(321). However, nucleic acid detection methods have the ability to provide results in a

matter of hours, compared to phenotypic methods which require isolating the

pathogen as a pure culture (18-48 hours) and performing antimicrobial susceptibility

testing (8-48 hours). Clinical studies have demonstrated that the administration of

appropriate antimicrobial therapy in the first 24 hours of disease is crucial to

favourable patient outcomes (26). Thus, detection of resistance determinants is

potentially favourable to optimising antimicrobial therapy and limiting resistance

emergence in a clinical setting.

Several hurdles need to be overcome before genotypic testing methods can

complement phenotypic antimicrobial susceptibility testing. Methods to detect genetic

resistance determinants are, in general, highly specific. Considering the sheer number

of β-lactamase-mediated resistance determinants, detection of individual genes and/or

point mutations conferring antimicrobial resistance would require extensive panels of

nuceic acid detection assays. Ideally, genotypic testing methods would have the ability

to detect numerous resistance determinants in a single assay. An additional challenge is

the detection of point mutations in β-lactamase-mediated genes that are associated

with an extended resistance spectrum. Point mutations that confer resistance arising

from in vitro selection can differ from those observed in clinical isolates (257). Thus

key point mutations associated with clinical resistance need to be studied in order to

direct nuceic acid detection assay development appropriately (186).

1.6.1 Phenotypic Methods

1.6.1.1 Broth dilution

Broth dilution methods are used to determine the MIC of antimicrobials specific to a

given microorganism. Traditionally performed in test tubes (93), broth dilution is now

commonly performed in a 96-well microtitre plate (broth microdilution). Plate wells

hold two-fold dilutions of antibiotic in a liquid growth medium (68, 168). Wells are

__________________________________________________________________________________________________________________________________________


inoculated with 1-5 X 105 CFU/mL, and the plate is incubated at 37°C/24 hours.

Following incubation, well turbidity is determined; the lowest concentration of

antibiotic that prevented growth of the bacteria is deemed the MIC of said antibiotic

against the organism studied. Broth microdilution is a popular antimicrobial

susceptibility testing method because an MIC can be determined, and the method can

be automated (279).

1.6.1.2 Disk diffusion

Disk diffusion is a standardised method for antimicrobial susceptibility testing (72, 96,

168). Commercially-made disks impregnated with fixed concentrations of antibiotics

are placed onto a Mueller-Hinton (MH) agar plate inoculated with approximately 1 X

108 CFU/mL. Following incubation at 37°C/24 hours, zones of growth inhibition

surrounding the antibiotic disks form due to antibiotic inhibition of the bacterial

inoculum. Each zone diameter is measured in millimetres, and the zone diameters are

interpreted using published zone diameter criteria (73, 98). Zone diameters allow

inference of the susceptibility of an isolate (i.e. sensitive, intermediate, resistant),

rather than providing a direct MIC value. Disk diffusion is relatively inexpensive, does

not require special equipment, and antibiograms can be tailored to suit the organism

being tested. This method is limited to bench top setup despite efforts to automate

analysis (233).

1.6.2 Commercial tests for β-lactamase detection

1.6.2.1 Etests®

Etests® (BioMérieux, Marcy l’Etoile, France) are plastic strips impregnated with a

concentration gradient of an antibiotic on the underside of the strip. Like the disk

diffusion test, a standardised density inoculum is used on the agar plate and an Etest®

strip is placed on top, antibiotic-side down. Similar to the disk diffusion method, a zone

of growth inhibition can form around the strip edge after 18-24 hours incubation at

35°C (Figure 1.5a). The concentration at which the edge of the zone of growth

inhibition intersects with the Etest® strip is the MIC. Although similar to the disk

diffusion method, an MIC can be determined using an Etest®. However, the cost of

Etest® strips, compared to the disk diffusion and broth microdilution methods, may

offset this advantage.


Figure 1.5. Minimum inhibitory concentration (MIC) determination and extended-spectrum β-lactamase (ESBL) detection using the Etest®.

A, cefotaxime Etest strip®; B, Etest® ESBL detection strip; C, Etest® ESBL detection strip - deformation of the zone of growth inhibition; E, Etest® ESBL detection strip - phantom zone of growth inhibition. CT, cefotaxime; CTL, cefotaxime + clavulanate; TZ, ceftazidime; TZL, ceftazidime + clavulanate. The numbers on the strip represent the concentration of cefotaxime. The cefotaxime concentration at which the zone of growth inhibition intersects with the Etest® strip is classified as the MIC.

__________________________________________________________________________________________________________________________________________


1.6.2.1 Automated systems

Instruments designed to perform broth microdilutions can offer a more rapid method

for determining MICs than bench top broth microdilution. Several instruments are

available, including the BD Phoenix Automated Microbiology System (BD Diagnostics,

Franklin Lakes, NJ, USA), MicroScan Walkaway (Siemens Healthcare Diagnostics,

Munich, Germany), Sensititre ARIS 2X (Thermo Scientific, Wilmington, USA), and the

Vitek 1 and 2 systems (BioMérieux, Marcy I’Etoile, France) (279). Test panels consist of

microtitre plates or test cards that need to be manually inoculated. Instruments then

incubate and periodically monitor growth using turbidimetric, colourimetric, and/or

fluorogenic detection. Simultaneous test capacity varies between instruments, ranging

from 30 to 240 parallel tests. Automated systems have been shown to decrease the

time to initiating appropriate antimicrobial therapy, and decrease the cost of

antimicrobial susceptibility testing through a reduced requirement for additional lab

testing, and shortened hospitalisation periods (23). Automated antimicrobial

susceptibility testing, in comparison to bench top methods, has been shown to have a

significant impact on the care and outcome of hospitalised patients (83).

1.6.3 ESBL confirmatory testing

In the past, a bacterial isolate would be classified as resistant to third-generation

cephalosporins if an ESBL was detected, irrespective of MIC (69). Recent changes to the

CLSI recommended antimicrobial susceptibility testing procedures have eliminated

ESBL confirmatory testing as standard practice (71). It has been demonstrated that MIC

alone is a sufficient predictor of antimicrobial efficacy, that ESBL status has no

significant impact on treatment outcomes (348). Some laboratories still choose to

perform ESBL confirmatory testing, as it provides useful epidemiological information

pertaining to tracking clinical resistance and the transmission of these enzymes.

β-lactamase enzyme inhibitors, such as clavulanate (clavulanic acid), sulbactam, and

tazobactam, can be incorporated into phenotypic antimicrobial susceptibility tests to

determine the presence of ESBL activity (55). The basic premise is that a lowered MIC

or an increase in diameter of the zone of growth inhibitionin the presence of a third-

generation cephalosporin + β-lactamase inhibitor will be observed relative to the

MIC/zone diameter in the presence of the third-generation cephalosporin alone. This is

typically indicative of the presence of an ESBL (48).


Double-disk synergy was one of the first phenotypic ESBL detection methods

developed (167). An amoxicillin plus clavulanate disk is placed in the centre of an

inoculated agar plate, and disks impregnated with other antimicrobials are placed 30 or

20 mm from the centres or edges of the disks. Extension of the edge of the zone of

growth inhibition surrounding the antimicrobial disk(s) towards the disk containing

clavulanate is a sign of synergy, interpreted as the presence of an ESBL (167). A disk

diffusion method utilises disks impregnated with a third-generation cephalosporin +

clavulanate. A difference of ≥5 mm between the diameters of the zones of growth

inhibition surrounding the disk containing a third-generation cephalosporin and the

disk containing a third-generation cephalosporin + clavulanate is phenotypic

confirmation of ESBL production (167). Broth microdilution detection of an ESBL is

determined by a ≥3-twofold-serial dilution decrease in MIC of a third-generation

cephalosporin + clavulanate compared to the MIC of the third-generation

cephalosporin alone. Etest® strips that determine the presence of an ESBL are also

available (BioMérieux, Marcy I’Etoile, France) (Figure 1.5b). Strips are impregnated

with a concentration gradient of CTX or CAZ at one end of the strip, and CTX or CAZ +

clavulanate at the other. An MIC ratio ≥8 (third-generation cephalosporin MIC / third-

generation cephalosporin + clavulanate MIC) in addition to an MIC ≥0.5 µg/mL (CTX) or

≥1.0 µg/mL (CAZ) is indicative of the presence of an ESBL (41). Deformation of the

zone of growth inhibition, or the appearance of a ‘phantom zone’ of growth inhibition,

is also indicative of the presence of an ESBL (Figure 1.5c, 1.5d).

1.6.4 Genotypic methods of β-lactamase detection

1.6.4.1 Isoelectric focusing

Isoelectric focusing is a method for discriminating proteins based on their relative

content of acidic and basic residues (281). Proteins are applied to a gel that contains a

pH gradient. Under an electric current, proteins will migrate towards the cathode or

anode end depending on their net charge. As the proteins migrate through an

increasing pH gradient, the protein loses its charge until it becomes immobilised. The

pH at which the protein is immobilised is termed the isoelectric point (pI). Isoelectric

focusing is often used in protein analysis, and has been previously used to discriminate

β-lactamases (24). However, due to the vast numbers of ESBLs present today, and

__________________________________________________________________________________________________________________________________________


members of specific ESBL families sharing the same isoelectric point, this method is no

longer of adequate resolution (203).

1.6.4.2 Oligotyping

Oligotyping uses oligonucleotide probes labelled with radioisotopes or biotin, designed

to detect point mutations under stringent hybridisation conditions. This technique was

initially developed to discriminate TEM-1 and TEM-2 enzymes (244). Malibat and

Courvalin, 1990 (203) extended this technique to include six additional polymorphic

sites in the blaTEM gene, resulting in the detection of 14 blaTEM variants, seven of which

were novel.

1.6.4.3 Polymerase chain reaction (PCR)

Polymerase chain reaction (PCR) can be used to detect β-lactamase genes that confer β-

lactam resistance. Primers are designed to anneal to sequences within, or surrounding,

the β-lactamase gene, preferably in a region free from ESBL-conferring point mutations.

The presence/absence of amplicons following PCR with gene-specific primers,

determined using gel electrophoresis, can indicate whether β-lactamase gene of

interest is present in an isolate. To discriminate between β-lactamase gene variants,

PCR amplicons need to be sequenced, which makes this method inefficient for clinical

microbiology laboratories.

PCR-based methods enabling discrimination of amplicons based on the presence of

mutations at particular nucleotide positions include PCR-restriction fragment length

polymorphism (PCR-RFLP) and PCR-single strand conformational polymorphism (PCR-

SSCP).

PCR-RFLP involves restriction endonuclease digestion of amplified PCR products to

determine the presence of point mutations in the amplicon (292). Amplicon fragments

are separated with electrophoresis, and the size and number of the fragments

generated indicates the presence/absence of point mutations. PCR-RFLP has been

shown to be an effective method for discrimination of bla genes (15, 58, 239), however

similar banding patterns for different bla genes can interfere with results

interpretation (301).


PCR-SSCP works on the principle that single nucleotide polymorphisms (SNPs) in a

sequence cannot be discriminated using electrophoresis. PCR amplicons are separated

into single-stranded DNA fragments by electrophoresis in a non-denaturing

polyacrylamide gel (243). Three-dimensional folding of the single-stranded DNA can

adopt unique confirmations, resulting in different migration patterns through the gel

(243). PCR-SSCP has been shown to successfully discriminate six blaSHV alleles (201,

202). When coupled with PCR-RFLP, 17 blaSHV alleles can be discriminated (58). PCR-

SSCP has also been successful in discriminating inhibitor-resistant β-lactamases (309).

1.6.4.4 Real-time PCR

Real-time PCR technology offers a platform to perform conventional PCR, with the

addition of monitoring the accumulation of amplicons (141). This negates the need for

end-point amplicon detection, creating a single-step closed-tube genotyping technology

(112). Monitoring of amplicon accumulation is achieved through the incorporation of a

fluorophore into the PCR mastermix, in the form of a labelled probe or dsDNA

intercalating dye. PCR amplification curves are generated during thermocycling, where

the amount of fluorescence is proportional to the amount of accumulated amplicon. A

predetermined threshold can be applied to the real-time PCR reaction, allowing a

‘cycles to threshold’ (CT) value to be generated when the PCR amplification curve

crosses the threshold. The CT can be used quantitatively, to determine the PCR

efficiency, and the starting concentration of the template DNA.

Allele-specific PCR (kinetic PCR) is an application of real-time PCR that is used to

discriminate amplicons with a SNP. Primers that contain a 3’ mismatch at the

polymorphic nucleotide amplify inefficiently, resulting in a higher CT than matched

primer-template complexes (116, 156). The difference in CT between matched and

mismatched amplification, the ΔCT, can be used to determine the polymorphism at the

SNP of interest (111). Hammond et. al., (2005) devised a kinetic PCR method to

discriminate variations in the blaSHV and blaTEM families (128). Primers were designed

to discriminate the mutations that occur at codons 238 and 240 within the blaSHV gene,

and codons 164, 238 and 240 within the blaTEM gene. This PCR accurately identifies

non-ESBL and ESBL genes within bacterial isolates.

__________________________________________________________________________________________________________________________________________


Multiplex real-time PCR is another application of real-time PCR that utilises the ability

of real-time PCR thermocyclers to acquire fluorescence data at multiple wavelengths.

Multiple primer sets can be used in a single reaction to amplify multiple gene targets,

and it is for this reason that multiplex real-time PCR is a popular format for amplicon

discrimination and SNP typing. Amplicons are discriminated based on their emission

wavelength, provided by fluorescent probes (e.g. TaqMan (196), molecular beacons

(196)), or fluorescently labelled primers (228). Whilst multiplexing has the benefit of

discrimination of multiple targets in a single reaction well, the cost of probe/labelled-

primer-based multiplex assay is high compared to real-time PCR assays utilising a

dsDNA intercalating dye (246). Nonetheless, multiplex real-time PCR has proven to be a

successful technology for the detection and discrimination of encoded β-lactamase

resistance (42, 61, 89, 113, 142, 158, 217, 219, 315, 335).

1.6.4.5 High resolution melt (HRM) analysis

The basis of high resolution melt (HRM) analysis is monitoring the dissociation of a

given DNA sequence. HRM involves precise monitoring of the change in fluorescence as

double-stranded DNA (dsDNA) intercalating dye is released from the amplicon during

denaturation (181). Small temperature increments (≥0.01°C) are utilised during

denaturation (341) to provide a more accurate melt curve compared to traditional

melting temperature (Tm) determination. The resulting melt curve is a function of the

amplicon DNA sequence, which allows discrimination of amplicons with different

nucleotide sequence based on melt curve shape, regardless of the amplicon Tm (269).

The choice of dsDNA intercalating dye can have a big impact on the discriminatory

powers of HRM. SYBR® Green I, traditionally used for real-time PCR applications,

cannot be used at saturating concentrations due to its PCR inhibitory properties. The

opportunity for SYBR® Green I molecules released during amplicon denaturation to

reintercalate into extant dsDNA is argued to decrease the discriminatory powers of

HRM curves. Therefore SYBR® Green I is not adequate for HRM applications. The

introduction of next-generation dyes including EvaGreen®, LC Green®, and LC Green®

Plus+ has overcome dye re-intercalation problems as such dyes can be used at

saturating concentrations. This enables discrimination of amplicons that differ by a

single base. The downside to HRM is that melt curve morphology is easily influenced by

template DNA quality, and changes to MgCl2, PCR buffer, intercalating dye, primer and


template DNA concentrations (341). Standardisation of HRM assay protocols can

overcome this, resulting in a highly-specific reproducible method for amplicon

discrimination (181). HRM also has the benefit of being less expensive than probe or

labelled-primer-based methodologies.

HRM has been shown to provide a successful platform for the identification of

microbial pathogens (92, 153, 207, 226, 318, 347), and for discriminating SNPs that

confer a decrease in susceptibility to antimicrobials (10, 108, 144, 258, 274, 324, 346).

HRM has the potential to be a powerful tool in the clinical microbiology laboratory,

providing rapid detection of genetic determinants conferring antibiotic resistance to

complement current phenotypic antimicrobial susceptibility testing methods.

1.6.4.6 Matrix-assisted laser desorption/ionization time-of-flight

mass spectrometry (MALDI-TOF MS)

Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-

TOF MS) was originally developed to characterise and identify large biomolecules

(169). A sample is embedded in a crystalline matrix attached to a support. A laser beam

is used to structurally decompose the sample, from which the ions are extracted. Ions

are accelerated through an electric field towards an endpoint detector. The time taken

for the ions to reach the detector is called the ‘time of flight’, and this is used to

calculate the mass-to-charge ratio of the ions (169).

MALDI-TOF MS is proving to be a broad scope technology that is potentially of great

value to the clinical microbiology laboratory. MALDI-TOF MS can be directly applied to

bacterial extracts and individual bacterial cells (66). The ability of MALDI-TOF MS to

identify microorganisms at a genus and species level (115) has proven to be

comparable, if not a superior method for phenotypic microorganism identification (43,

232, 331). MALDI-TOF MS is also capable of discriminating antibiotic susceptible, and

resistant organisms (224), and for detecting β-lactamase-mediated antibiotic

resistance activity (53, 147, 152, 308). MALDI-TOF MS is a rapid technology that can

provide interpretative results up to 20h earlier than phenotypic antimicrobial

susceptibility testing, if an O/N bacterial culture is available (232).

__________________________________________________________________________________________________________________________________________


1.7 Aims and Hypotheses

The overarching aim of the current project was to define the genetic events that take

place when resistance to third generation cephalosporins is selected in Klebsiella

pneumoniae.

The rationale for this project is the minimisation of antibiotic treatment failure,

addressing the more specific question of should routine screening for ESBL-expressing

bacteria be performed? If the MIC is able to determine antimicrobial efficacy, then ESBL

testing should be unnecessary. However, third-generation cephalosporin MICs below

the susceptibility breakpoint can be observed for ESBL-expressing cells, indicating that

the MIC is not a good predictor of antimicrobial efficacy. If isolates harbouring genes

that encode an ESBL differ in their abilities to evolve increased resistance in the

presence of selective pressure, then MIC determination may not be enough to detect

cells encoding antibiotic resistance or predict antimicrobial efficacy. This rationale

relates to the eternal question of whether the in vivo MIC is the same as the in vitro

MIC?

The current project aimed to elucidate the relationship between bla genotype and

phenotype in the context of genotypic predisposition to acquisition of an ESBL

phenotype. The preliminary model was that isolates harbouring plasmid-borne blaSHV

or blaTEM were primed for acquisition of a SHV- or TEM-ESBL in the presence of

selective pressure.

The first aim of this project was to determine the basis of amplification of plasmid-

borne blaSHV on the small- and large-blaSHV composite transposons in K. pneumoniae

isolates.

The second aim was to obtain insights into the conditions required for an ESBL-

conferring point mutation in blaSHV or blaTEM to confer an MIC above third-generation

cephalosporin susceptibility breakpoints.

The third aim of this project was to determine if ESBL-expressing cells are

heteroresistant to third-generation cephalosporins.


The fourth aim was to develop a HRM assay to discriminate P3, Pa/Pb and P4 blaTEM

promoter variants. The discriminatory power of the blaTEM promoter HRM assay was

further tested by discriminating samples harbouring stronger blaTEM promoter variants

in a background of weaker blaTEM promoter variants from samples harbouring pure

blaTEM promoter alleles.

__________________________________________________________________________________________________________________________________________


CHAPTER 2 General Methods

2.1 Bacterial Isolates

K. pneumoniae clinical isolates originating from the Asia-Pacific region, in addition to

part of the SENTRY Antimicrobial Surveillance Program collection (143), were obtained

from collaborators Jan Bell and John Turnidge at the Women’s and Children’s Hospital,

Adelaide, Australia (Table 2.1). Isolates had been genotyped by our collaborators.

Isolates supplied harboured plasmid-borne blaSHV or blaTEM. Isolates arrived as

inoculated BBLTM CultureSwabTM Plus swabs with charcoal (BD, Franklin Lakes, NJ,

USA). Each swab was used to create a lawn inoculum on one third of a Luria-Bertani

(LB) agar plate and samples were 16-streaked out on the remainder of the plate.

Inoculated LB agar plates were incubated O/N at 37°C. Glycerol stocks of each isolate

were prepared by inoculating 500 μL LB broth and 500 μL 80% glycerol (Merck,

Darmstadt, Germany) with a single isolated colony. Glycerol stocks were vortexed to

homogenise the contents, and stored at -80°C.

Six K. pneumoniae clinical isolates obtained from the Princess Alexandra Hospital

(PAH), Brisbane, Australia were included in this study (Table 2.1). These isolates have

been previously described (128, 150, 297). PAH isolates were obtained as glycerol

stocks (12% glycerol), stored at -80°C.

Bacteria were cultured using LB agar and broth, and MH agar and broth (Oxoid,

Cambridge, UK), further described in the text. When culture media containing

antibiotics was required, MH broth or agar was used.

2.2 Phenotypic Methods

2.2.1 Etest®

Cefotaxime and Cefotaxime + Clavulanic Acid (CT/CTL), and Ceftazidime and

Ceftazadime + Clavulanic Acid (TZ/TZL) resistance detection Etest® strips (BioMérieux,

Marcy I’Etoile, France) were used to determine the CTX or CAZ MIC of an isolate, and an


Table 2.1 SENTRY and PAH isolates used in this study

Origin and Isolatea bla geneb β-lactamasec ESBL phenotyped blaSHV transposone blaTEM promoterf aph(3’)-Iag MIC (µg/mL)h Reference

PAH

A1 blaSHV SHV-2a Positive Small - ND 1 (297)

B1 blaSHV SHV-2a Positive Small - ND 1 (297)

D1 blaSHV SHV-2a Positive Small - ND 4 (297)

E1 blaSHV SHV-2a Positive Small - ND 1 (297)

F1 blaSHV SHV-2a Positive Small - ND 1 (297)

F2 blaSHV SHV-2a Positive Small - ND 0.5 (297)

SENTRY

46 blaSHV, SHV-2a Positive Small - Absent ≥16 This thesis

89 blaSHV SHV-2a Positive Small - Present ≥16 This thesis

110 blaSHV SHV-1 Negative Large - Present <0.25 (127)

110-128 blaSHV SHV-2 Positive Large - Present ≥16 (127)

215-35-A blaSHV, blaTEM TEM-1 Negative - P4 ND <0.5 This thesis

219-08-D blaSHV, blaTEM TEM-1 Negative - P3 ND <0.5 This thesis

222-03-C blaSHV, blaTEM TEM-1 Negative - P3 ND <0.5 This thesis

231-22.2-D blaSHV, blaTEM TEM-1 Negative - P4 ND <0.5 This thesis

236-20-D blaSHV, blaTEM TEM-1 Negative - Pa/Pb ND <0.5 This thesis

238-02-A blaSHV, blaTEM TEM-1 Negative - P3 ND <0.5 This thesis

1 blaSHV, blaTEM ND ND - Pa/Pb ND ND This thesis 2 blaSHV, blaTEM ND ND - Pa/Pb ND ND This thesis 3 blaSHV, blaTEM ND ND - P3 ND ND This thesis 20 blaSHV, blaTEM ND ND - P3+Pa/Pbi ND ND This thesis 23 blaSHV, blaTEM ND ND - P3+Pa/Pbij ND ND This thesis 33 blaSHV, blaTEM ND ND - P3 ND ND This thesis 36 blaSHV, blaTEM ND ND - P3 ND ND This thesis 211-32-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 215-28-A blaSHV, blaTEM ND ND - P3 ND ND This thesis 219-07-A blaSHV, blaTEM ND ND - P3 ND ND This thesis 221-38-C blaSHV, blaTEM ND ND - Pa/Pb ND ND This thesis

__________________________________________________________________________________________________________________________________________


Origin and Isolatea bla geneb β-lactamasec ESBL phenotyped blaSHV transposone blaTEM promoterf aph(3’)-Iag MIC (µg/mL)h Reference

224-48-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 232-21-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 236-03-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 236-07-C blaSHV, blaTEM ND ND - P4 ND ND This thesis 237-21-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 237-24-C blaSHV, blaTEM ND ND - P3 ND ND This thesis 237-49-C blaSHV, blaTEM ND ND - P3 + insertionk ND ND This thesis 238-15-A blaSHV, blaTEM ND ND - P3+Pa/Pbi ND ND This thesis 252-19-A blaSHV, blaTEM ND ND - P3 ND ND This thesis 256-06-A blaSHV, blaTEM ND ND - Pa/Pb ND ND This thesis

ND, not determined. -, absent. a Isolates were obtained from the Princess Alexandra Hospital (PAH) and the SENTRY surveillance program South Africa and Asia-Pacific region. b Real-time PCR was used to detect the presence of blaSHV and blaTEM (Section 2.3.6.1). c blaSHV genotype was determined using allele-specific PCR (Section 2.3.9). blaTEM genotype was determined by blaTEM gene sequencing (Section 2.3.3.2). d ESBL phenotype was determined according to Etest® guidelines (BioMérieux, Marcy I’Etoile, France) (section 2.2.1). e blaSHV transposon type determined using real-time PCR detection of IS26 insertion positions relative to blaSHV (Section 2.3.6.1). f blaTEM promoter sequence determined by sequencing the blaTEM promoter-specific TEM_Pr amplicon (Section 2.3.3.1). g Determined by real-time PCR detection of the aph(3’)-Ia gene (Section 2.3.6.1). h Determined by Etest® (BioMérieux) (section 2.2.1). i Mixed P3 and Pa/Pb blaTEM promoter alleles are recorded as P3+Pa/Pb. j A second mixed C/T allele at bp 54 of the TEM_Pr amplicon was identified on the sequencing traces. k P3 promoter + 227 bp insertion


ESBL phenotype. The CTX or CAZ MIC in the absence and presence of clavulanic acid

were recorded. The presence of an ESBL was determined by the relationship between

MIC values and zone deformations. An ESBL is indicated by a CT MIC ≥0.5 and a CT

MIC/CTL MIC value ≥8, or a TZ MIC ≥1 and a TZ MIC/TZL MIC value ≥8. Deformations

of the CT or TZ zones and/or the presence of phantom zones were also indicative of the

presence of an ESBL enzyme (41).

Etests® were used as per the Etest® guidelines (41). Briefly, liquid bacterial culture or a

single isolated colony was mixed with saline (0.9% NaOH) to create a 0.5 McFarland

standard inoculum density using a Vitek colourimeter (product no. 52-1210,

BioMérieux, Marcy I’Etoile, France). A sterile swab was used to create a lawn inoculum

on a fresh MH agar plate. The Etest® strip was placed onto the dried surface of the

inoculated MH plate, ensuring no air bubbles were present between the Etest® strip

and the surface of the agar. Plates were incubated at 37°C for 20 hours. The

concentration of antibiotic where the zone of growth inhibition intersected the Etest®

strip was recorded for each plate. If the zone intersected between two labelled

antibiotic concentrations, the greater concentration was recorded as the MIC.

2.3 Genotypic Methods

2.3.1 Preparation of Genomic DNA

Two methods were used for DNA extraction. A boil method was used whereby a single

colony was homogenised with 100 μL ddH2O in a 1.5 mL microcentrifuge tube. The

tube contents were heated at 95°C for 10 min then placed on ice. Tubes were spun for 3

min at 13,000 rpm to pellet the cell debris. The supernatant was transferred to a fresh

microcentrifuge tube and stored at 4°C. The QIAGEN Blood and Tissue DNA Extraction

Kit (QIAGEN, Hilden, Germany) is a column-based technique used as an alternative DNA

extraction method. A single isolated colony from a solid culture was resuspended in

180 μL of a tissue lysis (ATL) buffer and 20 μL proteinase K. DNA extraction continued

as per manufacturer’s instructions. When liquid culture was used for DNA extraction,

1 mL of liquid bacterial culture was centrifuged at 8,000 rpm for 5 min to pellet the

cells. The supernatant was discarded, and the pellet was resuspended in 180 μL ATL

__________________________________________________________________________________________________________________________________________


buffer and 20 μL proteinase K. DNA extraction continued as per manufacturer’s

instructions.

2.3.2 Primer Design

DNA sequences were obtained from GenBank and uploaded into the Primer3 primer

design program (291). General primer selection parameters were set as follows:

minimum Tm - 57°C, maximum Tm - 61°C, optimum Tm - 59°C, minimum GC content –

20%, maximum GC content – 80%, minimum primer length – 18 base pairs (bp),

maximum primer length – 25 bp, optimum primer length – 20 bp, minimum amplicon

Tm - 75°C, maximum amplicon Tm - 90°C. The amplicon size range was dependent upon

each specific amplicon, and is listed in the text. General primer selection parameters

were entered into the software prior to selection of primer sets by the Primer3

program. Primer sets selected by the Primer3 software were screened for primer-

dimer, cross-dimer, hairpins, and loops using the NetPrimer software (PremierBiosoft,

Palo Alto, CA, USA). Primer sets with primer- and cross-dimers with a Gibbs free energy

(∆G) value <-9 were avoided. The Basic Local Alignment Software Tool (BLAST) (6) was

used to check primer binding specificity to each of the DNA sequences of interest. All

PCR primers were synthesised by Sigma-Aldrich (Castle Hill, NSW, Australia).

2.3.3 Polymerase Chain Reaction (PCR)

Primer sequences and Polymerase Chain Reaction (PCR) conditions are described in

the text. In general, PCR reactions contained 1 X PCR buffer without MgCl2, 1.5 mM

MgCl2, 0.2 mM dNTPs (Roche, Basel, Switzerland), 0.25 μM of each primer, and 1.0 U

Platinum® Taq DNA polymerase (Invitrogen, Carlsbad, California, USA). Each reaction

contained 1 μL template DNA, and was made up to a final volume of 40 μL using ddH2O.

PCR products were visualised on 0.5-2% TAE agarose gels and viewed on a Molecular

Imager® Gel Doc™ XR System UV transilluminator (Bio-Rad, Hercules, California, USA).

SYBR® safe DNA gel stain (Invitrogen) was used to visualise PCR amplicons in the

agarose gels. SYBR® safe DNA gel stain was added to the gel (0.5X) prior to

electrophoresis. DNA Molecular Weight Marker VIII (Roche) or the GeneRuler™ 1Kbp

Plus DNA Ladder (Fermentas, Ontario, Canada) was used to determine the amount of

PCR amplicon present.


2.3.3.1 Characterisation of blaTEM promoter types

Primers were designed to amplify a 227 bp DNA fragment that includes the entire

blaTEM promoter region and encompassed known polymorphic sites (184). The primers

used were TEM_PrF and TEM_PrR (Table 2.2).

PCR reactions were prepared as described in 2.3.3. Cycling conditions were: an initial

denaturation at 95°C for 2 min, followed by 40 cycles of 95°C/10s, 60°C/10s, 72°C/30s;

followed by a 2 minute hold at 72°C. Amplicons were visualised on 2% TAE agarose

gels containing 0.5X SYBR® safe dye (Invitrogen, Carlsbad, California, USA) as further

described in section 2.3.3. TEM_Pr amplicons were purified and sequenced at

Bioscience North Australia and Macrogen Inc. as described in Section 2.3.5.

2.3.3.2 blaTEM genotype determination

To determine the blaTEM genotype of each isolate, primers were designed to amplify a

1061 bp DNA fragment that included the majority of the blaTEM gene sequence and

encompassed known ESBL-conferring polymorphic sites

(http://www.lahey.org/studies/temtable.asp). Primer design principals and software

are described in section 2.3.2. Determined primer sequences were blaTEMfor and

blaTEMrev (Table 2.2). PCR reactions were prepared as described in 2.3.3. Cycling

conditions were: an initial denaturation at 95°C for 2 min, followed by 40 cycles of

95°C/30s, 60°C/30s, 72°C/60s; followed by a 2 minute hold at 72°C. Amplicons were

visualised on 1% TAE agarose gels containing 0.5X SYBR® safe dye (Invitrogen) as

further described in section 2.3.3. Amplicons were purified and sequenced at Macrogen

Inc. (Seoul, Korea) as described in section 2.3.5.

2.3.4 DNA Quantification

The quantitative DNA molecular weight markers VIII (Roche) or the GeneRuler™ 1 Kbp

Plus DNA Ladder (Fermentas) were used to estimate the amount of PCR product. This

allowed quantification of DNA between 18 - 138 ng, and 20 - 80 ng respectively.

Alternatively, either the NanoDrop 2000 (Thermo Scientific, Wilmington, USA) or the

GeneQuant Pro™ (Biochrom, Cambridge, UK) spectrophotometers were used to

determine DNA concentration and purity using the 260/280 absorbance ratios.

__________________________________________________________________________________________________________________________________________


2.3.5 Sequencing

PCR amplicons were purified using the QIAquick PCR purification kit (QIAGEN)

according to the manufacturer’s instructions. Briefly, the PCR sample is mixed with five

volumes of PB Buffer and applied to a QIAquick spin column. PCR amplicon is bound to

the spin column through centrifugation of the sample. The column is washed with PE

Buffer, and then the PCR amplicon is eluted using EB Buffer. All PCR amplicons were

quantified prior to sequencing. Sequencing reactions were performed by multiple

sequencing facilities over the course of the project. These included the Australian

Genome Research Facility (University of Queensland, St. Lucia, Australia), Bioscience

North Australia (Charles Darwin University, Darwin, Australia), and Macrogen Inc.

(Seoul, Korea). Chromatograms were viewed using the ChromasPro program available

at: http://www.technelysium.com.au/chromas.html. Further sequence analysis is

described in the text.

2.3.6 Real-Time PCR

Primer sequences and real-time PCR conditions are described in the relevant chapter.

In general, real-time PCR reactions contained 1 X SensiMix™ NoRef (Bioline, London,

UK), 1 X SYBR® Green I solution, 0.5 μM of each primer, 1 μL template, and made up to a

final volume of 10 μL using ddH2O. Real-time PCR reactions were performed on the

Rotor Gene 6000 real-time thermocycler (QIAGEN). An arbitrary threshold value of

0.0396 was set for all real-time PCR reactions. This value conferred a threshold that

crossed the real-time PCR amplification curves during the exponential phase of

amplification, enabling the determination of a cycle time (CT) value for each reaction.

2.3.6.1 Detection of genotypic determinants

Real-time PCR was used to detect blaSHV (SHVquantF and SHVquantR primer set), blaTEM

(TEMintF and TEMintR), aph(3’)-Ia (AphAIfor and AphAIrev primer set), IS26 upstream

of the small-blaSHV transposon (Pr::IS26for and Pr::IS26rev primer set) and IS26

downstream of the large-blaSHV transposon (SHV5_IS26for and SHV_IS26rev primer set)

in isolates listed in Table 2.1. Primer sequences are shown in Table 2.2. Real-time PCR

reactions were performed as described in section 2.3.6. Reactions were performed in

duplicate. Individual positive control, negative control, and NTC wells were included for

each primer set. Cycling conditions were as follows: 50°C/2min, 95°C/10min, 45 cycles


of: 95°C/5s, 60°C/10s, 72°C/10s; followed by followed by 95°C/2min, 50°C/30s, and a

melt step (70-90°C). Fluorescence was acquired to channel green during the extension

step of real-time PCR cycling.

2.3.7 blaSHV Quantitative Real-Time PCR

blaSHV copy numbers relative to a progenitor were determined using real-time PCR.

This method was adapted from Hammond et. al., (2005) (128). Briefly, real-time PCR

reactions to detect blaSHV and 16S rDNA were performed using genomic DNA extracted

from the isolates of interest. Real-time PCR reactions for the previously described

SHVquant primer set – SHVquantF (5’-TGCTTGGCCCGAATAACAA-3’) and SHVquantR

(5’-GCGTATCCCGCAGATAAATCA-3’) – and 16S rDNA primer set - 16SAllBactF (5’-

TCCATGAAGTCGGAATCGCTAG-3’) and 16SAllBactR (5’- CACTCCCATGGTGTGACGG-3’)

– were prepared as described in section 2.3.6. Real-time PCR reactions for each primer

set were performed in duplicate. Individual positive control and No Template Control

(NTC) wells were included for each primer set. Quantitative real-time PCR reactions

were performed on the Corbett RotorGene 6000 real-time thermocycler (QIAGEN).

Cycling conditions were as follows: 50°C/2min, 95°C/10min, 45 cycles of: 95°C/5s,

60°C/10s, 72°C/10s; followed by 95°C/2min, 50°C/30s, and a melt step (70-90°C).

Fluorescence was acquired to channel green during the extension step of real-time PCR

cycling.

The comparative CT method (13) was used to quantify blaSHV dosage. 16S rDNA was

used as the standard. The ΔCT value is defined as the blaSHV CT – 16S rDNA CT. The

relative copy number between isolates was calculated as 2-ΔΔCT (128).

2.3.7.1 Statistical comparison of blaSHV gene dosage using error

propagation

blaSHV dosages (as determined in section 2.3.7) of individual K. pneumoniae strains were

compared to determine if they were statistically significantly different. One thousand

iterations of the relative gene copy number calculation were performed for each strain.

Iterations were performed using error propagation to account for slight variations in

replicate CT values obtained in the quantitative real-time PCR experiments. Error

propagation was achieved by including the variance of the difference between CT

replicates (CTDiff) for each gene target (σ2(gene)) in the relative gene copy number

__________________________________________________________________________________________________________________________________________


calculation (Figure 2.1). The error propagation relative gene copy number calculation

assumes CTDiff values follow a normal distribution, and this was determined by

plotting CTDiff values as a histogram with a normal distribution curve overlay, and a

probability of a normal distribution plot was generated for each gene target

individually (i.e. 16S rDNA, blaSHV). Visual inspection of the plots allowed for

determination of the data distribution (i.e. normal). One thousand iterations of the

relative gene copy number calculation were performed for each strain using the mean

CT duplicate value (CTAv) for each gene target. The relative gene copy number

determined without error propagation (section 2.3.7) was plotted along with the

empirical confidence intervals derived from error propagation (iterations 25 and 975)

(section 2.3.7.1). Relative gene copy numbers were categorised as statistically

significantly different if confidence intervals were not overlapping.

2.3.8 blaTEM Quantitative Real-Time PCR

The blaTEM quantitative real-time PCR assay was adapted from the blaSHV quantitative

real-time PCR protocol (section 2.3.7) (128).

A primer set to detect the blaTEM-1 gene was designed using the primer design protocol

described in Section 2.3.2. The 861 bp blaTEM-1 gene sequence (GenBank accession:

DQ873693) was uploaded into Primer3 (291) as the template sequence for generating

blaTEM-specific primers. The amplicon size range was set as 150-250 bp. Primer sets

determined by the Primer3 software were analysed using the NetPrimer software

(PremierBiosoft). The primer set with the best score out of 100, and dimer and cross-

dimer ΔG values closest to zero were chosen. The primers were named TEMintF (5’-

ACGGATGGCATGACAGTAAG-3’) and TEMintR (5’- TCGTTTGGTATGGCTTCATT -3’), and

amplify a 188 bp amplicon.

Real-time PCR reactions to detect blaTEM and the 16S rDNA were designed as described

in section 2.3.7. Quantitative real-time PCR reactions were performed as described in

section 2.3.7.

The comparative CT method (13) was used to quantify blaTEM dosage as described for

blaSHV in section 2.3.7. blaTEM gene dosage was statistically compared between strains


Figure 2.1 STATA code for the calculation of error propagation relative gene copy numbers.

The average CT (CTAv) for each gene target for each strain is generated and 1000 copies of each CTAv are created. Set seed specifies the initial value of a random number seed and was arbitrary. The standard deviation of the difference of duplicate CTs of a given gene target is calculated (sqrt(σ2)/sqrt(2)) and multiplied by an inverse cumulative standard normal distribution random number related to the seed (invnorm). This value is added to the progenitor and derivative strains 16S and bla CTAv values, resulting in CTAv values that include error correlating with the difference observed between duplicate CT values for a given gene target. The relative gene copy number calculation(13) is then performed, resulting in 1000 iterations of the relative gene copy number calculation (including error propagation) per gene target per derivative strain. 16S, 16S rDNA gene target standard; bla, bla gene target; p_, progenitor; d_, derivative; gen, generate.

as per the method described in section 2.3.7.1. In this context, 16S rDNA and blaTEM

were the gene targets of interest.

2.3.9 Allele-specific PCR to detect the blaSHV codon 238 polymorphism

Allele-specific real-time PCR (kinetic PCR) was used to detect the G238S mutation

(128). Real-time PCR reactions contained 1 X SensiMix™ NoRef (Bioline), 1 X SYBR®

Green I solution, 0.5 μM of common primer (SHV238reverse [5’-

CGGCGTATCCCGCAGATAA-3’]), 0.5 μM of either the wildtype allele primer (SHV238wt

[5’-CGCCGATAAGACCGGAGCTG-3’]) or the mutant allele primer (SHV238mt [5’-

CGCCGATAAGACCGGAGCTA-3’]), 1 μL template, and made up to a final volume of 10 μL

using ddH2O. Real-time PCR reactions for each primer set were performed in duplicate.

Individual positive control, negative control, and NTC wells were included for each

primer set. Quantitative real-time PCR reactions were performed on the Corbett

__________________________________________________________________________________________________________________________________________


RotorGene 6000 real-time thermocycler (QIAGEN). Cycling conditions were as follows:

50°C/2min, 95°C/10min, 45 cycles of: 95°C/5s, 60°C/10s, 72°C/10s; followed by

followed by 95°C/2min, 50°C/30s, and a melt step (70-90°C). Fluorescence was

acquired to channel green during the extension step of real-time PCR cycling.

Mutant allele dosage relative to wildtype allele dosage was calculated using 2∆CT, where

∆CT = wildtype allele CT – mutant allele CT.

__________________________________________________________________________________________________________________________________________


CHAPTER 3 Structure of the blaSHV Tandem Repeating Unit

and its Response to CTX Selective Pressure

3.1 Introduction

blaSHV genes are native to the K. pneumoniae chromosome (20, 60). blaSHV is also

plasmid-borne, detected in many Enterobacteriaceae, Pseudomonas aeruginosa, and

Acinetobacter spp. (159, 249, 262). Extant plasmid-borne blaSHV is likely a result of two

independent mobilisation events mediated by the insertion sequence IS26 (103). The

resultant blaSHV composite transposons are discriminated by size and the position of

IS26 elements relative to blaSHV. Here, these are referred to as the small- and large-

blaSHV transposons (Figure 3.1). A characteristic feature of the small-blaSHV transposon

is an IS26 insertion directly upstream of blaSHV, which has created a new blaSHV

promoter region (260).

Hammond and co-workers demonstrated that an SHV-dependent ESBL phenotype was

only acquired in K. pneumoniae isolates harbouring plasmid-borne blaSHV (127), despite

the presence of a chromosomal copy of blaSHV in almost all K. pneumoniae strains. This

is almost certainly due to a much higher expression of plasmid-borne blaSHV in

comparison with chromosomal blaSHV. This in turn is due to the presence of stronger

blaSHV promoters in both the small- and large-blaSHV transposons. In the case of the

small-blaSHV transposon, IS26 insertion upstream of blaSHV occurred in the blaSHV

promoter region. The resultant new blaSHV promoter consisted of the native blaSHV

promoter -10 region, and a new -35 region donated by the IS26 element. In the case of

the large-blaSHV transposon, a SNP in the -10 region increases the promoter strength

(260, 325). blaSHV amplification is also associated with a β-lactam resistance phenotype,

and is primarily observed for plasmid-borne blaSHV. Recently, Zienkiewicz et. al., (2007)

reported evidence suggesting homologous recombination events facilitated by IS26

resulted in tandem genetic repeats of the blaSHV-5 transposon on plasmid p1658/97

(356). A higher dosage of the p1658/97 blaSHV-5 transposon was observed in CAZ

‘resistant’ Escherichia coli strains compared to ‘susceptible’ strains. Garza-Ramos et. al.,

(2009) also described a tandem duplication of the blaSHV-5 transposon on plasmid

pHNMI, isolated from a clinical Enterobacter cloacae strain (110).


Fig

ure

3.1

Th

e sm

all-

an

d l

arge

-bla

SHV t

ran

spo

son

str

uct

ure

s, a

nd

th

e ap

pro

xim

ate

ann

eali

ng

po

siti

on

s o

f th

e ta

nd

em r

epea

t b

rid

gin

g P

CR

am

pli

con

pri

mer

s.

A,

sma

ll-b

laS

HV t

ran

spo

son

; B

, la

rge

-bla

SH

V t

ran

spo

son

. T

he

sm

all

-bla

SH

V t

ran

spo

son

str

uct

ure

is

ba

sed

on

th

e d

ete

rmin

ed

se

qu

en

ce o

f p

lasm

id p

EC

-IM

PQ

(G

en

Ba

nk

acc

ess

ion

: E

U8

55

78

8.1

) (6

4)

an

d t

he

la

rge

-bla

SH

V t

ran

spo

son

str

uct

ure

is

ba

sed

on

th

e d

ete

rmin

ed

se

qu

en

ce o

f p

lasm

id p

16

58

/9

7 (

Ge

nB

an

k

acc

ess

ion

: A

F5

50

67

9.1

) (3

56

).

__________________________________________________________________________________________________________________________________________


The correlation between tandem duplications of antibiotic resistance genes and

antimicrobial selective pressure is not a new concept. Studied extensively in the 1970’s

and 1980’s, several models for the formation of tandem genetic repeats were proposed.

Ptashne and Cohen, (1975) demonstrated how insertion sequences flanking resistance

determinants facilitate homologous recombination events to create tandem repeats of

resistance determinants interspersed by insertion sequences (270). Transposon-

associated insertion sequences provide directly-repeated sequence of homology that is

required for homologous recombination-facilitated gene duplication and amplification

events (250).

Gene amplification can have three distinct consequences: a mechanism to overcome a

selective environment, facilitation of further genetic adaptations such as point

mutations, and allowing for acquisition of new gene functions (9). This is relevant to

blaSHV amplification in response to third-generation cephalosporin selective pressure.

Increased blaSHV dosage would provide a larger number of gene targets available to

acquire an ESBL-conferring point mutation. Upon acquisition a new gene function is

acquired, enabling hydrolysis of extant third-generation cephalosporins. Amplifcation

of ESBL-encoding blaSHV genes can further increase third-generation cephalosporin

MICs (127), thus it is likely that blaSHV gene amplification plays a crucial role in SHV β-

lactamase-mediated antibiotic resistance evolution.

In this chapter, the molecular basis for blaSHV amplification in K. pneumoniae was

determined. PCR and real-time PCR were used to delineate DNA sequences that

undergo copy number amplification in response to selective pressure from CTX. It was

observed that the small-blaSHV transposon forms tandem repeats, with a single IS26

element present at the tandem repeat junction. Amplification of the large-blaSHV

transposon was consistent with the findings for small-blaSHV transposon amplification,

and as previously described (356),(110). Analysis of the large-blaSHV transposon

tandem repeat region and surrounding sequence revealed a novel antibiotic resistance

genetic structure. The aph(3’)-Ia gene, which encodes a 3’-aminoglycoside

phosphotransferase, was located at both the 5’- and 3’-ends of the large-blaSHV

transposon tandem repeat region. aph(3’)-Ia is one of three aph(3’) allelic variants

encoding the APH(3’)-I subclass of enzymes (188, 241, 245). The spectrum of activity of

APH(3’)-I enzymes includes kanamycin, neomycin, paromomycin, ribostamycin,

lividomycin, and gentamycin B (302, 350). aph(3’)-Ia was part of a composite


transposon flanked by IS26 elements, which is common for aph(3’)-I genes (125, 248,

266, 351).

3.2 Methods

3.2.1 Bacterial Isolates

Clinical K. pneumoniae isolates used were from the SENTRY surveillance program Asia-

Pacific region and South Africa, and are listed in Table 3.1. Genotypic and phenotypic

characterisation of the progenitor isolates is outlined in sections 3.2.5 and 3.2.6. A 128

µg/mL CTX-derived strain of SENTRY isolate 110 was also included in this study (Table

3.1) (127). Isolates were cultured using MH broth or agar (BD Diagnostics, Franklin

Lakes, NJ, USA). CTX or CAZ was added where described.

3.2.2 Describing the blaSHV Tandem Repeating Unit

3.2.2.1 Design of a PCR amplicon bridging adjacent copies of the

large-blaSHV transposon

3.2.2.1.1 The small-blaSHV transposon

pEC-IMPQ (GenBank accession: EU855788.1) was used as a reference sequence for the

small-blaSHV transposon structure. Single primers in the fuculose phosphate aldolase

(fucA) and blaSHV genes (Pr::IS26junctF and Pr::IS26junctR) (Figure 3.1a) (Table 3.2)

were designed with 3’ ends directed away from blaSHV to promote amplicon formation

that bridges tandem repeats of the small-blaSHV transposon.

3.2.2.1.2 The large-blaSHV transposon

The p1658/97 plasmid sequence (GenBank accession: AF550679.1) (356) was used as

the reference sequence for the large-blaSHV transposon structure.

Single primers in the putative recF and fucA genes (FucAfor and FucArev) that flank

blaSHV and are part of the large-blaSHV transposon (Figure 3.1a) (Table 3.2). Primers

__________________________________________________________________________________________________________________________________________


Table 3.1 Bacterial isolates used in Chapter 3.

Isolate Origin blaSHV transposona

aph(3’)-Iab CTX MIC (µg/mL)c

ESBLc Reference

46 Progenitor Small Absent ≥16 Positive This thesis 89 Progenitor Small Present ≥16 Positive This thesis 110 Progenitor Large Present <0.25 Negative (127) 110-128 128 µg/mL

CTX-derived

Large Present ≥16 Positive (127)

a Determined by real-time PCR detection of the IS26 elements upstream or downstream of blaSHV. b Determined by real-time PCR detection of the aph(3’)-Ia gene. c Determined by Etest® (BioMérieux) (section 2.2.1).

Table 3.2 Primer sequences.

Primer name Primer Sequence (5’ – 3’) Targeta

16sAllBactF TCCATGAAGTCGGAATCGCTAG 16Sr RNA

16sAllBactR CACTCCCATGGTGTGACGG 16Sr RNA

Pr::IS26for CCGGCCTTTGAATGGGTT IS26

Pr::IS26rev TAATACACAGGCGAATATAACGCATAAC blaSHV

U/S_IS26for TGACGTTGAACACCGACAGATT IS26

U/S_IS26rev AGTATCGCCATATTCAGATTGCC ygbM∆

FucAfor GCAGATAGGCTTCCCTGAAA recF

FucArev CTGACCGCTGACGAAGTAAA fucA

CHPfor GGCGGTCTGGAGAATATGAT recF

CHPrev GGATTTGAAGCCGTTGAGTT ygbM∆

AphAIfor ATAATGTCGGGCAATCAGGT aph(3’)-Ia

AphAIrev GAGGCATAAATTCCGTCAGC aph(3’)-Ia

Pr::IS26junctF ACAAACCGTCGAAAGAGGTC fucA

Pr::IS26junctR GGGTGGCTAACAGGGAGATA blaSHV

tnpAIS26for TGTCGATCACTCCACGATTT IS26

tnpAIS26rev ATGCCGTATTTGCAGTACCA IS26

IS26intF CTGCCACTTCTTCACGTTGT IS26

IS26intR GCACATGGATGAAACCTACG IS26

SHVquantF TGCTTGGCCCGAATAACAA blaSHV

SHVquantR GCGTATCCCGCAGATAAATCA blaSHV a Specific gene target that each primer was designed to anneal to.



that bridges tandem repeats of the large-blaSHV transposon.

To confirm the presence of a single IS26 element at the junction of two adjacent

large-blaSHV transposons, primers were designed to produce an amplicon bridging two

adjacent IS26 elements. The tnpAIS26for and tnpAIS26rev primer set (Figure 3.1b)

(Table 3.2) were designed with their 3’ ends directed away from each other so that an

amplicon internal to a single IS26 element would not be produced.

3.2.2.2 PCR cycling conditions for the amplification of PCR

amplicons bridging adjacent copies of the large-blaSHV

transposon

PCR reactions were prepared as described in section 2.3.3. Cycling conditions are

summarised in Table 3.3. An initial denaturation of 95°C for 2 min, and a 10 minute

hold at 72°C post-cycling was included in all PCRs.

PCR reactions to detect an IS26::IS26 structure at the junction of large-blaSHV

transposon tandem repeats were performed as a nested PCR reaction. Purified

amplicons that bridged adjacent copies of the large-blaSHV transposon generated from

isolate 110-128 (Table 3.1) were used as template for this reaction.

All amplicons were visualised on 0.5-2% TAE agarose gels containing 0.5X SYBR® safe

dye (Invitrogen, Carlsbad, California, USA) as further described in section 2.3.3.

Amplicons were purified and sequenced at Bioscience North Australia and Macrogen

Inc. as described in section 2.3.5.

3.2.3 Determining the location of aph(3’)-Ia in relation to the blaSHV

transposon

The orientation of aph(3’)-Ia and its position in relation to the small- and large-blaSHV

transposon structures was determined by PCR. In order to determine if aph(3’)-Ia was

present at the 3’ or 5’ end of the blaSHV transposon tandem repeat region, amplicons

bridging the blaSHV and aph(3’)-Ia transposons were required. The aph(3’)-Ia primer set

__________________________________________________________________________________________________________________________________________


Table 3.3 PCR primer sets and PCR conditions.

blaSHV transposona

Ampliconb Primers Predicted amplicon size (bp)c

PCR cycling conditionsd Denaturation Annealing Elongation

Small Bridging Pr::IS26junctF 1058 95°C 30 sec 59°C 30 sec 72°C 90 sec

Pr::IS26junctR

Small Flanking aph(3’)-Ia

Pr::IS26junctF 1753 95°C 20 sec 59°C 20 sec 72°C 120 sec

AphAIfor


Pr::IS26junctF 1200 95°C 20 sec 59°C 20 sec 72°C 120 sec

AphAIrev


Pr::IS26junctR 1750 95°C 20 sec 59°C 20 sec 72°C 120 sec

AphAIfor


Pr::IS26junctR 1197 95°C 20 sec 59°C 20 sec 72°C 120 sec

AphAIrev

Large Bridging FucAfor 3335 95°C 20 sec 59°C 20 sec 72°C 240 sec

FucArev

Large Flanking aph(3’)-Ia

CHPfor 3502 95°C 20 sec 59°C 20 sec 72°C 120 sec

AphAIfor


CHPfor 3018 95°C 20 sec 59°C 20 sec 72°C 240 sec

AphAIrev


CHPrev 2343 95°C 20 sec 59°C 20 sec 72°C 90 sec

AphAIfor


CHPrev 1859 95°C 20 sec 59°C 20 sec 72°C 90 sec

AphAIrev

Large Bridging-IS26

tnpAIS26for 774 95°C 20 sec 59°C 30 sec 72°C 120 sec

tnpAIS26rev

N/A blaSHV-specific

SHVquantF 57 95°C 15 sec 59°C 15 sec 72°C 30 sec

SHVquantR

N/A aph(3’)-Ia -specific

AphAIfor 150 95°C 15 sec 59°C 15 sec 72°C 30 sec

AphAIrev

N/A IS26 specific

IS26intF 166 95°C 15 sec 59°C 15 sec 72°C 30 sec

IS26intR a blaSHV transposon structure that a given PCR reaction is specific to. b Description of amplicon a given primer combination was designed to amplify. c Amplicon size prediction based on the compilation of GenBank sequences to create theoretical amplicon structures. d All PCR cycling conditions described in the table are preceded by a 95°C for 2 min hold, followed by a 72°C for 10 minute hold.

was not compatible with the large-blaSHV transposon bridging amplicon primer set

(FucAfor + FucArev) according to NetPrimer analysis. A primer set compatible with the

AphAIfor and AphAIrev primers was designed to anneal to the large-blaSHV transposons

putative recF and ygbM∆ genes (CHPfor + CHPrev) (Figure 3.1b) (Table 3.2). Primers



that bridges adjacent aph(3’)-Ia and large-blaSHV transposon structures.

The aph(3’)-Ia-specific primers AphAIfor and AphAIrev were used in combination with

the CHPfor and CHPrev, or the small-blaSHV bridging primer set primers (Pr::IS26junctF

and Pr::IS26junctR) to create aph(3’)-Ia::blaSHV transposon bridging amplicons. PCR

reactions were prepared as described in section 2.3.3. Cycling conditions are

summarised in Table 3.3. All PCRs included an initial denaturation of 95°C for 2 min,

and a 10 minute hold at 72°C post-cycling. Amplicons were visualised on 0.5-2% TAE

agarose gels containing 0.5X SYBR® safe dye (Invitrogen) as described in section 2.3.3.

Amplicons were purified and sequenced at Bioscience North Australia and Macrogen

Inc. (section 2.3.5).

3.2.4 Digoxigenin (DIG) Southern Hybridisation

The digoxigenin (DIG)-High Prime DNA Labeling and Detection Starter Kit I (Roche,

Basel, Switzerland) was used for probe generation, prehybridisation, hybridisation, and

colour detection with nitroblue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl

phosphate (NBT/BCIP) as per manufacturer’s instructions.

3.2.4.1 Probe design

Individual primer sets were created to amplify a DNA fragment internal to the IS26

element and aph(3’)-Ia gene. The reference sequence for IS26 was obtained from the

p1658/97 plasmid sequence (GenBank accession: AF550679.1). The reference

sequence for aph(3’)-Ia was obstained from the pRMH760 plasmid sequence (GenBank

Accession: AY123253). The IS26-specific primer set is named IS26intF and IS26intR,

and the aph(3’)-Ia specific primer set is named AphAIfor and AphAIrev (Table 3.2).

Amplicons specific to blaSHV, IS26, and aph(3’)-Ia were created using the previously

described SHVquantF + SHVquantR primer set (127), and the IS26intF + IS26intR, and

AphAIfor + AphAIrev primer sets (Table 3.2). PCR reactions were prepared as

described in section 2.3.3. Isolate 110 template DNA was used in all reactions. Cycling

conditions are summarised in Table 3.3. All PCRs included an initial denaturation of

95°C for 2 min, and a 10 min hold at 72°C post-cycling.

__________________________________________________________________________________________________________________________________________


3.2.4.2 Probe creation

One µg of each amplicon (section 3.2.4.1) was made up to 16 µL of solution through the

addition of ddH2O. Amplicon solutions were boiled on a heat block for 10 min to ensure

denaturation. DIG-High Prime (4 µL) (Roche) was added to the denatured amplicon

solutions, and solutions were mixed. Solutions were incubated O/N at 37°C to enable

sufficient labelling of the single-stranded amplicons. Labelling reactions were stopped

by adding 2 µL 0.2M EDTA (pH 8.0) to the amplicon solutions, and heating at 65°C for

10 min. Amplicons and derived probes were visualised on a 2% TAE agarose gel

containing 0.5X SYBR® safe dye (Invitrogen) as further described in section 2.3.3.

Probe labelling reactions were checked by creating a dilution series (1 ng/µL, 10 pg/µL,

3 pg/µL, and 1 pg/µL) of each labelled probe, and the DIG-labelled control DNA

(Roche). One µL spots of each dilution were applied to a Hybond™-N+ nylon membrane

(Amersham Biosciences, GE Healthcare, Buckinghamshire, England). Labelled DNA was

fixed to the nylon membrane by placing the membrane face-down on a UV light box for

5 min (UV-crosslinking). The membrane was incubated (with shaking) in 20 mL Maleic

acid buffer (0.1M Maleic acid, 0.15M NaCl; pH 7.5) for 2 min, followed by a 30 min

incubation in 10 mL Blocking solution (1:10 dilution of 10X Blocking solution (Roche)

in Maleic acid buffer). The membrane was then transferred into 10 mL Antibody

solution (1:5000 dilution of Anti-Digoxygenin-AP (Roche) in Blocking solution) and

incubated for 30 min, followed by incubation (with shaking) in 10 mL Washing buffer

(0.1M Maleic acid, 0.15M NaCl; pH 7.5; 0.3% (v/v) Tween 20) for 2 X 15 min. The

membrane was equilibrated in 10 mL Detection buffer (0.1M Tris-HCl, 0.1M NaCl; pH

9.5) for 5 min, and then incubated in 2 mL freshly prepared colour substrate solution

(40 µL NBT/BCIP stock solution (Roche), 2 mL Detection buffer) in the dark for 10 min.

The colour reaction was stopped by incubating (with shaking) the membrane in 50 mL

ddH2O for 5 min.

3.2.4.3 Probe hybridisation

Amplicons bridging adjacent copies of the large-blaSHV transposon generated for the

isolates 110 and 110-128 (Table 3.1) were visualised on 0.8% TAE agarose gels

containing 0.5 X SYBR® safe DNA gel stain. Gels were run at 100V for 70 min to ensure

separation of the higher molecular weight amplicons from the predominant 3.5 Kbp

amplicon bridging adjacent copies of the large-blaSHV transposon. IS26, blaSHV, and


aph(3’)-Ia control amplicons were loaded onto the gel after 50 min, and electrophoresis

was continued for the remaining 20 min. The agarose gel was soaked in at least two gel

volumes of denaturation buffer (1.5M NaCl / 0.5 N NaOH) for 2 X 15 min. Hybond™-N+

nylon membrane (Amersham Biosciences) was cut to the size of the gel, and prior to

transfer was floated in ddH2O. DNA was transferred from the gel to the nylon

membrane O/N using capillary transfer (51). The following day, blotting material was

removed and the well positions were marked on the nylon membrane with a soft-lead

pencil. The transfer gel was rinsed in ddH2O, and viewed on a UV transilluminator to

verify DNA transfer was successful. The nylon membrane was soaked in 5X SSC

(350mM NaCl + 75mM sodium citrate in 1L ddH2O) for 5 minutes, followed by UV-

crosslinking the DNA to the nylon membrane.

Optimal hybridisation temperatures for the blaSHV, IS26 and aph(3’)-Ia probes were

calculated by using the following formulae (Roche):

Tm = 49.82 + 0.41(%G+C) – (600/length of the probe)

Topt = Tm – 20-25°C

A Topt was determined for each DIG-labelled probe: blaSHV – 40.2-35.2°C; IS26 – 48.7-

43.7°C; aph(3’)-Ia – 45.1 40.1°C. DIG Easy Hyb solution was prepared according to the

manufacturer’s instructions (Easy Hyb granules (Roche) dissolved in 64 mL ddH2O),

and pre-warmed to the Topt for a given probe. The UV-crosslinked membrane was pre-

hybridised in 10 mL/100 cm2 pre-heated Easy Hyb solution for 30 min with gentle

agitation at Topt. The DIG-labelled probe was denatured by boiling for 5 min on a heat

block, then rapid cooling on ice. The denatured probe was added to pre-heated Easy

Hyb solution (3.5 mL/100 cm2 membrane), and mixed gently to avoid bubble and foam

formation. Pre-hybridisation solution was discarded and replaced with the

hybridisation solution containing the denatured probe. Membranes were hybridised

O/N in a Micro Hybridization Incubator (Model 2000, Robbins Scientific, Sunnyvale

California, U.S.A) at Topt. Post-hybridisation stringency washes were performed as

follows: membranes were washed (with agitation) for 2X 5 min in 2X SSC (2:5 dilution

of 5X SSC in ddH2O) + 0.1% SDS, then 2X 15 min in 0.5X SSC (1:10 dilution of 5X SSC in

ddH2O) + 0.1% SDS at 65°C with agitation.

__________________________________________________________________________________________________________________________________________


After hybridisation and stringency washes were performed, the membrane was rinsed

in Washing buffer, followed by a 30 min incubation in 100 mL Blocking Solution. The

membrane was transferred into 20 mL Antibody solution and incubated for 30 min,

followed by 2X 15 min washes in 100 mL Washing buffer. The membrane was

equilibrated in 20 mL Detection buffer for 5 min prior to incubation in 10 mL freshly-

prepared colour substrate solution. Colour reactions were stopped by incubating (with

shaking) the membrane in 50 mL ddH2O for 5 min.

3.2.5 Stepwise Selection to CTX Resistance

Stepwise selection to CTX resistance was performed for isolates 46, 89, and 110 as

previously described (127, 128). A loopful of glycerol stock for each isolate was 16-

streaked onto MH agar plates and incubated O/N at 37°C. Single colonies were used to

inoculate 3 mL MH broth in the absence of antibiotics – 3 parallel culture tubes were

created per isolate. Inoculated culture tubes were incubated for 20 hours at 37°C, with

agitation at 200 rpm (Bioline incubated shaker, Bioline, London, UK). Fresh MH broth

(3 mL) containing 0.015 µg/mL CTX was inoculated with 10 µL of O/N culture. Cultures

were incubated for 20h at 37°C with 200 rpm agitation. A 10 µL aliquot of the O/N

culture was used to inoculate MH broth containing double the CTX concentration

compared to the previous O/N culture. Serial passage was continued until growth at

128 µg/mL CTX was reached, or no growth was observed.

Glycerol stocks of each progenitor, and derivative at each CTX culture concentration

were created by inoculating 500 μL 80% glycerol with 500 μL O/N culture. Cryovials

were vortexed to homogenise the contents, and stored at -80°C.

3.2.6 Phenotypic Analysis

The CTX MIC for each isolate was determined using cefotaxime/cefotaxime + clavulanic

acid resistance detection Etest® strips (BioMérieux, Marcy I’Etoile, France). The

cefotaxime/cefotaxime + clavulanic acid resistance detection Etest® strips enabled the

determination of CTX MICs up to and including 16 µg/mL CTX. CTX MICs below and

surrounding the CTX susceptibility and resistant breakpoints (73) were of interest in

this chapter, therefore specific CTX MICs to isolates resistant to ≥16 µg/mL CTX were

not determined. Cefotaxime/cefotaxime + clavulanic acid resistance detection Etest®

strips were also used to determine phenotypic ESBL expression in isolate 46, 89, and


110 progenitors and strains resistant to 128 µg/mL CTX selected for during stepwise

selection to CTX resistance.

3.2.7 Genotypic Analysis

3.2.7.1 Real-time PCR detection of genotypic determinants

Real-time PCR was used to detect the 16S rDNA fragment (16sAllBactF and 16sAllBactR

primer set), IS26 upstream of the small-blaSHV transposon (Pr::IS26for and Pr::IS26rev

primer set), IS26 downstream of the large-blaSHV transposon (SHV5_IS26for and

SHV_IS26rev primer set), blaSHV (SHVquantF and SHVquantR primer set), and aph(3’)-Ia

(AphAIfor and AphAIrev primer set) in isolate 46, 89, and 110 progenitors and strains

selected to be resistant to 128 µg/mL CTX during stepwise selection to CTX resistance.

Primer sequences are shown in Table 3.2. blaSHV, IS26, and aph(3’)-Ia CT values were

used for quantitative real-time PCR analysis described below (Section 3.2.8). The

presence/absence of the genotypic determinants was used to genotype the progenitor

isolates and to confirm genotypes in the strains resistant to 128 µg/mL CTX relative to

progenitors. Real-time PCR reactions were performed as described in section 2.3.6.

Reactions were performed in duplicate. Individual positive control, negative control,

and NTC wells were included for each primer set. Cycling conditions were as follows:

50°C/2min, 95°C/10min, 45 cycles of: 95°C/5s, 60°C/10s, 72°C/10s; followed by

followed by 95°C/2min, 50°C/30s, and a melt step (70-90°C). Fluorescence was

acquired to channel green during the extension step of real-time PCR cycling.

3.2.7.2 ESBL-Conferring blaSHV gene point mutation detection

Kinetic PCR to detect the ESBL-conferring blaSHV codon 238 polymorphism was

performed for isolate 46, 89, and 110 progenitors and strains selected to be resistant to

128 µg/mL CTX selected for during stepwise selection to CTX resistance (section 2.3.9).

3.2.8 Quantitative Real-time PCR

3.2.8.1 blaSHV

blaSHV was quantified for the isolate 46, 89, and 110 strains selected to be resistant to

128 µg/mL CTX selected for during stepwise selection to CTX resistance relative to

__________________________________________________________________________________________________________________________________________


progenitors. blaSHV quantitative real-time PCR was performed as described in section

2.3.7.

The dosage of blaSHV in strains selected to be resistant to 128 µg/mL CTX were

statistically compared using the methodology described in section 2.3.7.1.

3.2.8.2 aph(3’)-Ia

The aph(3’)-Ia gene was quantified for the strains selected to be resistant to 128 µg/mL

CTX relative to their respective progenitor isolates. The aph(3’)-Ia quantitative real-

time PCR methodology was analogous to the blaSHV quantitative real-time PCR method

(section 2.3.7), except the AphAIfor and AphAIrev primer set (Table 3.2) was used for

aph(3’)-Ia gene detection in place of the SHVquantF and SHVquantR primer set for

blaSHV detection.

The aph(3’)-Ia dosages in strains selected to be resistant to 128 µg/mL CTX were

statistically compared using a methodology analogous to that described in section

2.3.7.1. In this context, 16S rDNA and aph(3’)-Ia were the gene targets of interest.


3.3 Results

3.3.1 The small-blaSHV transposon forms tandem repeats interspersed with

a single IS26

Tandem repeats of the large-blaSHV transposon harbouring blaSHV-5 have previously

been described (110, 356). It was of interest to determine if the small-blaSHV transposon

formed similar tandem repeats. This was explored using K. pneumoniae isolates 46 and

89, which harbour the small-blaSHV transposon, encode a SHV-ESBL as determined by

kinetic PCR, and express an ESBL as determined by Etest®, with CTX MIC values

≥16 µg/mL according to the Etest® (Table 3.1). A PCR was designed to produce an

amplicon that bridges adjacent small-blaSHV transposons (Table 3.3). Amplicons were

generated from both isolates 46 and 89 (Figure 3.2). The amplicon size of 1.1 Kbp

indicated that adjacent repeating units are separated by a single copy of IS26 (Table

3.3), and this was confirmed by sequencing of the amplicons (Figure 3.2). An additional

13 nucleotides are present at the IS26::fucA boundary of the amplicon compared to

pEC-IMPQ (GenBank accession: EU855788.1) (64). A similar IS26::fucA boundary can

be found in GenBank entries X53817.1 (261) and X84314.1 (238), however it seems

that the IS26::fucA boundary represented by pEC-IMPQ is a lot more common in

GenBank sequence entries. IS26::fucA boundary could therefore be a potential

epidemiological marker for the dissemination and evolution of plasmid-borne blaSHV. It

was concluded that the small-blaSHV transposon forms tandem repeats separated by

single IS26 elements – in other words, the transposons are in effect overlapping. This is

consistent with what has been found with the large-blaSHV transposon (110, 356).

As a control, formation of tandem repeas of the large-blaSHV transposon was explored in

isolates 110 and 110-128 (Table 3.1). In essence this was very similar to experiments

previously described (110, 356). A PCR reaction to produce an amplicon bridging

tandem repeats of the large-blaSHV transposon was performed (Table 3.3). Gel

electrophoresis revealed a predominant amplicon ~3.5 Kbp in size, and a faint ladder of

larger amplicons (Figure 3.3). A 3.5 Kbp amplicon is consistent with the previous

findings that a single IS26 element is shared between adjacent large-blaSHV transposon

units (110, 356). This was confirmed by partial sequencing of the amplicons (Figure

3.3).

__________________________________________________________________________________________________________________________________________


Fig

ure

3.2

Am

pli

con

bri

dgi

ng

adja

cen

t co

pie

s o

f th

e s

mal

l-b

laSH

V t

ran

spo

son

.

A,

Sm

all

-bla

SH

V t

ran

spo

son

ta

nd

em

re

pe

at

ma

p,

ide

nti

fyin

g t

he

bri

dg

ing

am

pli

con

po

siti

on

an

d t

he

pri

me

rs u

sed

(T

ab

le 3

.2);

B,

vis

ua

lisa

tio

n o

f th

e

am

pli

con

bri

dg

ing

ad

jace

nt

cop

ies

of

the

sm

all

-bla

SH

V t

ran

spo

son

on

a 1

.0%

ag

aro

se g

el.

La

ne

s o

n a

ga

rose

ge

l: M

, G

en

eR

ule

r™ 1

Kb

DN

A L

ad

de

r P

lus

(Fe

rme

nta

s);

46

, is

ola

te 4

6 (

Ta

ble

3.1

); 8

9,

iso

late

89

(T

ab

le 3

.1);

N, N

TC

. M

ap

co

lou

rs c

orr

ela

te w

ith

th

e p

art

ial

seq

ue

nce

ali

gn

me

nt

ob

serv

ed

in

Fig

ure

3

.2C

(o

ve

rpa

ge

).


Figure 3.2 (cont.) Amplicon bridging adjacent copies of the small-blaSHV transposon.

C, partial sequence of the amplicon bridging adjacent copies of the small-blaSHV transposon. The partial sequence was aligned to pEC-IMPQ sequence (GenBank accession: EU855788.1) (64). Numbers on the alignment refer to pEC-IMPQ nucleotide positions. Primer responsible for derived sequence is listed at the left of each alignment row. Coloured boxes indicate positions as described for pEC-IMPQ: orange, IS26; brown, blaSHV. Purple boxes indicate the position of fucA. The fucA gene is not annotated in the GenBank entry for pEC-IMPQ. The position of fucA was determined by comparing the pEC-IMPQ and p1658/97 (GenBank accession: AF550679.1) (356). Primer sequences are shown in grey boxes.

__________________________________________________________________________________________________________________________________________


Fig

ure

3.3

Am

pli

con

bri

dgi

ng

adja

cen

t co

pie

s o

f th

e la

rge-

bla

SHV t

ran

spo

son

.

A, L

arg

e-b

laS

HV t

ran

spo

son

ta

nd

em

re

pe

at

ma

p, i

de

nti

fyin

g t

he

bri

dg

ing

am

pli

con

po

siti

on

an

d t

he

pri

me

rs u

sed

(T

ab

le 3

.2);

B, v

isu

alis

ati

on

of

am

pli

con

s

bri

dg

ing

ad

jace

nt

cop

ies

of

the

la

rge

-bla

SH

V t

ran

spo

son

on

a 0

.5%

ag

aro

se g

el.

La

ne

s o

n a

ga

rose

ge

l: M

, G

en

eR

ule

r™ 1

Kb

DN

A L

ad

de

r P

lus

(Fe

rme

nta

s);

11

0, i

sola

te 1

10

(T

ab

le 3

.1);

11

0-1

28

, iso

late

11

0-1

28

(T

ab

le 3

.1);

N, N

TC

. Ma

p c

olo

urs

co

rre

late

wit

h t

he

pa

rtia

l se

qu

en

ce a

lig

nm

en

t o

bse

rve

d i

n F

igu

re

3.3

C (

ov

er

pa

ge

).


Figure 3.3 (cont.) Amplicon bridging adjacent copies of the large-blaSHV transposon.

C, partial sequence of the amplicon bridging adjacent copies of the large-blaSHV transposon. Partial sequence was aligned to p1658/97 sequence (GenBank accession: AF550679.1) (356). Numbers on the alignment refer to p1658/97 nucleotide positions. Primer responsible for derived sequence is listed at the left of each alignment row. Coloured boxes indicate positions as described for p1658/97: orange, IS26; fuschia, ygbM∆; teal, fucA; red, recF; blue, lacY∆. Overlapping coding sequence is indicated by shaded boxes of corresponding colour. Primer sequences are shown in grey boxes.

__________________________________________________________________________________________________________________________________________


To confirm the presence of a single IS26 element at the junction of large-blaSHV

transposon tandem repeats, the amplicons were subjected to a second PCR designed to

detect adjacent IS26 elements. An ~2 Kbp amplicon was generated (Figure 3.4).

Sequencing of the nested PCR amplicon demonstrated the presence of aph(3’)-Ia, an

aminoglycoside resistance determinant, flanked by IS26 (Figure 3.4). The aph(3’)-Ia

gene is frequently encountered on transposons flanked by IS26 (125, 248, 266, 351).

This suggested that aph(3’)-Ia was interspersed between tandem repeats of the large-

blaSHV transposon. It was hypothesised that aph(3’)-Ia was included in homologous

recombination events that facilitated the formation of tandem repeats of the large-

blaSHV transposon. PCR amplification of the hypothesised novel tandem repeat structure

may have resulted in the faint higher molecular weight amplicons that bridge adjacent

copies of the large-blaSHV transposon observed in Figure 3.3.

In order to test this hypothesis, a Southern hybridisation was performed to determine

if aph(3’)-Ia was present within the amplicon that bridges adjacent copies of the large-

blaSHV transposon. Specifically it was predicted that aph(3’)-Ia would be present within

the higher molecular weight bands visible in the electropherogram of the products

from the PCR (Figure 3.3). No hybridisation between the aph(3’)-Ia probe and the

higher molecular weight bands was observed, indicating that, contrary to the

prediction, aph(3’)-Ia was not present within the higher molecular weight products

(Figure 3.5). Hybridisation between the aph(3’)-Ia probe and ~3.5 Kbp product was

observed. However, there was a very large amount of this fragment in the gel, similar

hybridisation was observed with a similar amount of IS26-derived control fragment,

and the signal was weak, so it was concluded that hybridisation was non-specific. In

support of this conclusion, hybridisation between the aph(3’)-Ia probe and the

homologous aph(3’)-Ia control fragment was very strong.

The nature of these amplicons was explored more fully by probing the same reaction

products with an IS26-derived fragment (Figure 3.5). Hybridisation between the IS26

probe and the ~3.5 Kbp amplicon bridging adjacent copies of the large-blaSHV

transposon was observed. This correlated with the presence of IS26 at the junction of

tandem repeats of the large-blaSHV transposon. Hybridisation of the IS26 probe to the

aph(3’)-Ia control amplicon was also observed (Figure 3.5). However, the reduced

signal of this hybridisation, the strong IS26 probe hybridisation to the IS26 control

fragment, and the similar amount of aph(3’)-Ia and IS26 control fragments in the gel


Figure 3.4 Amplicon bridging adjacent copies of IS26.

A, gene map of the aph(3’)-Ia transposon Tn4352 described for plasmid pRMH760 (GenBank accession: AY123253.3) (248) and predicted IS26::IS26 bridging amplicon position noting primers used (Table 3.2); B, 1% TAE agarose gel demonstrating the IS26::IS26 bridging PCR amplicon. Lanes on gel: M, GeneRuler™ 1Kb DNA Ladder Plus (Fermentas); 110-128, isolate 110-128 (Table 3.1); N, NTC. Map colours correlate with the partial sequence alignment observed in Figure 3.4C (over page).

__________________________________________________________________________________________________________________________________________


Figure 3.4 (cont.) Amplicon bridging adjacent copies of IS26.

C, partial sequencing traces of the IS26::IS26 bridging PCR amplicon aligned to pRMH760 sequence. Numbers on the alignment refer to pRMH760 nucleotide positions. Primer responsible for derived sequence is listed to the left of each alignment row. Coloured boxes indicate positions as described for pRMH760: orange, IS26; green, aph(3’)-Ia. Primer sequences are shown in grey boxes.


Fig

ure

3.5

So

uth

ern

hyb

rid

isat

ion

s to

th

e am

pli

con

bri

dgi

ng

adja

cen

t co

pie

s o

f th

e la

rge-

bla

SHV t

ran

spo

son

.

A,

0.8

% T

AE

ag

aro

se t

ran

sfe

r g

el;

B,

ap

h(3

’)-I

a p

rob

e h

yb

rid

isa

tio

n;

C,

IS2

6 p

rob

e h

yb

rid

isa

tio

n.

Ho

rizo

nta

l li

ne

s a

bo

ve

th

e b

lot

ima

ge

s in

dic

ate

th

e

po

siti

ve

co

ntr

ol

am

pli

con

la

ne

s a

nd

bri

dg

ing

am

pli

con

la

ne

s. I

sola

te 1

10

(T

ab

le 3

.1)

tem

pla

te w

as

use

d t

o c

rea

te t

he

ap

h(3

’)-I

a, I

S2

6 a

nd

bla

SH

V p

osi

tiv

e

con

tro

l a

mp

lico

ns.

Te

mp

late

DN

A f

or

the

am

pli

con

bri

dg

ing

ad

jace

nt

cop

ies

of

the

la

rge

-bla

SH

V t

ran

spo

son

is

ide

nti

fie

d b

elo

w t

he

so

uth

ern

blo

t im

ag

es

for

ea

ch h

yb

rid

isa

tio

n:

P, i

sola

te 1

10

(T

ab

le 3

.1);

D, i

sola

te 1

10

-12

8 (

Ta

ble

3.1

); M

, Ge

ne

Ru

ler™

1K

b D

NA

La

dd

er

Plu

s (F

erm

en

tas)

.

__________________________________________________________________________________________________________________________________________


suggests that hybridisation between the IS26 probe and aph(3’)-Ia control was non-

specific. It was concluded that the higher molecular weight large-blaSHV transposon

bridging amplicons were PCR artefacts, and so further investigation was not warranted.

3.3.2 aph(3’)-IA flanks the large-blaSHV transposon tandem repeat region

The next question to be investigated was the position of aph(3’)-Ia in relation to the

large-blaSHV tandem repeat region. PCR reactions were designed to create amplicons

that bridge aph(3’)-Ia and the large-blaSHV transposon. aph(3’)-Ia-specific PCR primers

were each used individually with primers internal to the large-blaSHV transposon

(CHPfor and CHPrev) to determine the orientation of the aph(3’)-Ia gene, and at which

end of the large-blaSHV transposon tandem repeat region aph(3’)-Ia is located (Table 3.3,

Figure 3.6). Gel electrophoresis and amplicon sequencing revealed that an aph(3’)-Ia

gene was present at both the 3’ and 5’ end of the large-blaSHV transposon (Figure 3.6).

Both aph(3’)-Ia genes were in a forward orientation relative to blaSHV. IS26 elements at

the junctions of aph(3’)-Ia and large-blaSHV transposons were directly repeated, and in

the same orientation as the remaining IS26 elements in the novel tandem repeat

structure, that are in effect nested IS26-based transposons. A careful GenBank search

revealed that this structure has not been described previously (Figure 3.6).

3.3.3 aph(3’)-Ia does not flank the small-blaSHV transposon tandem repeat

region

The position of aph(3’)-Ia relative to the small-blaSHV transposon tandem repeat region

in isolates 46 and 89 was investigated. Real-time PCR detection of aph(3’)-Ia

demonstrated the presence of the gene in isolate 89, but not in isolate 46 (Table 3.1).

PCR reactions to detect aph(3’)-Ia at the 3’ or 5’ ends of the small-blaSHV transposon

tandem repeat region were performed for isolate 89 (Table 3.3). An ~1.2 Kbp amplicon

was generated from primers Pr::IS26junctF and AphAIrev (Figure 3.7). The size of the

amplicon is consistent with the presence of aph(3’)-Ia in a forward orientation relative

to blaSHV at the 3’-end of the small-blaSHV transposon (Table 3.3). For isolate 89, this was

confirmed by sequencing the amplicon (Figure 3.7). Consistent with the small-blaSHV

transposon tandem repeat junction described in section 3.3.1, the additional 13

nucleotides was present in the amplicon at the IS26::fucA boundary. Similar to the PCR

reactions to detect aph(3’)-Ia at the 3’ or 5’ ends of the small-blaSHV transposon tandem

repeat region were also performed for isolate 46, to confirm that this isolate was


Fig

ure

3.6

. ap

h(3

’)-I

a is

ad

jace

nt

to t

he

5’ a

nd

3’ e

nd

s o

f th

e la

rge-

bla

SHV t

ran

spo

son

.

A, g

en

e m

ap

of

the

la

rge

-bla

SH

V t

ran

spo

son

an

d n

eig

hb

ou

rin

g a

ph

(3’)

-Ia

ge

ne

s, i

de

nti

fyin

g b

rid

gin

g a

mp

lico

n p

osi

tio

ns

an

d t

he

pri

me

rs u

sed

(T

ab

le 3

.2);

B,

1%

TA

E a

ga

rose

ge

l d

em

on

stra

tin

g t

he

ap

h(3

’)-I

a::

recF

bri

dg

ing

am

pli

con

; C

, 1%

TA

E a

ga

rose

ge

l d

em

on

stra

tin

g t

he

yg

bM

∆::

ap

h(3

’)-I

a

bri

dg

ing

am

pli

con

. L

an

es

on

ge

l: P

, is

ola

te 1

10

(T

ab

le 3

.1);

D,

iso

late

11

0-1

28

(T

ab

le 3

.1);

N,

NT

C;

M,

Ge

ne

Ru

ler™

1K

b D

NA

La

dd

er

Plu

s (F

erm

en

tas)

. .

Ma

p c

olo

urs

co

rre

late

w

ith

th

e p

art

ial

seq

ue

nce

ali

gn

me

nts

ob

serv

ed

in

Fig

ure

3.6

D-E

(o

ve

r p

ag

e).

__________________________________________________________________________________________________________________________________________


Figure 3.6 (cont.) aph(3’)-Ia is adjacent to the 5’ and 3’ ends of the large-blaSHV

transposon.

D, partial sequence of the aph(3’)-Ia::recF amplicon. Partial sequence was aligned to p1658/97 (GenBank accession: AF550679.1) (356) or pRMH760 (GenBank accession: AY123253.3) (248). Numbers on the alignment refer to nucleotide positions of the plasmid sequence listed for each row to the left of the alignment. Primer responsible for derived sequence is listed to the left of each alignment row. Coloured boxes indicate positions as described for p1658/97 - orange, IS26; red, recF; blue, lacY∆; and pRMH760 – orange, IS26; green, aph(3’)-Ia. Primer sequences are shown in grey boxes.


Figure 3.6 (cont.) aph(3’)-Ia is adjacent to the 5’ and 3’ ends of the large-blaSHV

transposon.

E, partial sequence of the ygbM∆::aph(3’)-Ia amplicon. Partial sequence was aligned to p1658/97 (GenBank accession: AF550679.1) (356) or pRMH760 (GenBank accession: AY123253.3) (248). Numbers on the alignment refer to nucleotide positions of the plasmid sequence listed for each row to the left of the alignment. Primer responsible for derived sequence is listed to the left of each alignment row. Coloured boxes indicate positions as described for p1658/97 - orange, IS26; fuschia, ygbM∆; and pRMH760 – orange, IS26; green, aph(3’)-Ia. Overlapping coding sequence is indicated by shaded boxes. Primer sequences are shown in grey boxes.

__________________________________________________________________________________________________________________________________________


Fig

ure

3.7

ap

h(3

’)-I

a n

eigh

bo

urs

th

e 3

’ en

d o

f th

e sm

all-

bla

SHV t

ran

spo

son

.

A,

ge

ne

ma

p o

f th

e s

mal

l-b

laS

HV t

ran

spo

son

an

d 3

’-n

eig

hb

ou

rin

g a

ph

(3’)

-Ia

tra

nsp

oso

n,

ide

nti

fyin

g t

he

bri

dg

ing

am

pli

con

po

siti

on

an

d p

rim

ers

use

d t

o

ge

ne

rate

th

e b

rid

gin

g a

mp

lico

n (

Ta

ble

3.2

). B

, 1

% T

AE

ag

aro

se g

el

de

mo

nst

rati

ng

th

e b

laS

HV::

ap

h(3

’)-I

a b

rid

gin

g a

mp

lico

ns;

Ag

aro

se g

el

lan

es:

M,

Ge

ne

Ru

ler™

1K

b D

NA

La

dd

er

Plu

s (F

erm

en

tas)

; 4

6,

iso

late

46

(T

ab

le 3

.1);

89

, is

ola

te 8

9 (

Ta

ble

3.1

); N

, N

TC

. M

ap

co

lou

rs c

orr

ela

te w

ith

th

e p

art

ial

seq

ue

nce

ali

gn

me

nts

ob

serv

ed

in

Fig

ure

3.6

D-E

(o

ve

r p

ag

e).


Figure 3.7 (cont.) aph(3’)-Ia neighbours the 3’ end of the small-blaSHV transposon.

C, partial sequence of the fucA::aph(3’)-Ia bridging amplicon. Partial sequence was aligned to pEC-IMPQ (GenBank accession: EU855788.1) (64) and pRMH760 (GenBank accession: AY123253.3) (248). Numbers on the alignment refer to nucleotide positions of pRMH760. Primer responsible for derived sequence is listed at the left of each alignment row. Coloured boxes indicate positions as described for pEC-IMPQ: orange, IS26; and pRMH760: orange, IS26; green, aph(3’)-Ia. Purple boxes indicate the position of fucA. The fucA gene is not annotated in the GenBank entry for pEC-IMPQ. The position of fucA was determined by comparing pEC-IMPQ and p1658/97 (GenBank accession: AF550679.1) (356) sequences. Primer sequences are shown in grey boxes.

__________________________________________________________________________________________________________________________________________


aph(3’)-Ia negative. The absence of amplicons confirmed that aph(3’)-Ia was not

associated with the small-blaSHV transposon in this isolate, consistent with the aph(3’)-

Ia negative genotype previously determined (Figure 3.7).

The response of the aph(3’)-Ia::small-blaSHV transposon structure to CTX selective

pressure was investigated next. Isolate 89 was subjected to stepwise selection to CTX

resistance. Isolate 46 was included as an aph(3’)-Ia negative control, and Isolate 110

was included to determine how the novel aph(3’)-Ia::large-blaSHV transposon::aph(3’)-Ia

structure responsed to selective pressure with CTX.

Three parallel cultures were created for each isolate. All three parallel cultures of each

isolate survived stepwise selection to CTX resistance, with liquid cultures growing at

the final CTX concentration of 128 µg/mL. Outlined in Figure 3.8 is the nomenclature

used from this point forward regarding the progenitor isolates and the strains resistant

to 128 µg/mL CTX selected for during stepwise selection to CTX resistance.

Tandem repeats of the small-blaSHV transposon were observed in isolate 46 and 89

progenitor isolates and strains resistant to 128 µg/mL CTX by the presence of the ~1.1

Kbp amplicon bridging adjacent copies of the small-blaSHV transposon. The presence of

aph(3’)-Ia at the 5’ and 3’ ends of the small-blaSHV transposon tandem repeat region was

tested using PCR and primers designed to create amplicons that bridge aph(3’)-Ia and

the small-blaSHV transposon (Figure 3.9) (Table 3.3). No bridging amplicons were

produced for the isolate 46 progenitor isolates and strains resistant to 128 µg/mL CTX,

consistent with the absence of aph(3’)-Ia. The ~1.2 Kbp amplicon indicating the

presence of aph(3’)-Ia in forward orientation at the 3’ end of the small-blaSHV

transposon was observed in the isolate 89 progenitors, and 89-D-1 (Figure 3.9). It was

concluded that aph(3’)-Ia 3’ to the small-blaSHV transposon tandem repeat region was

lost in a subset of the parallel cultures.

The dosage of blaSHV and aph(3’)-Ia in strains resistant to 128 µg/mL CTX relative to

their progenitors was determined using quantitative real-time PCR (Table 3.4). blaSHV

dosage was statistically significantly different between the isolate 46 and 89 strains

resistant to 128 µg/mL CTX (Figure 3.10) (Table 3.4). Relative to the progenitor, no

major increase in blaSHV dosage was observed for 46-D-1, 46-D-2, and 46-D-3 strains,


with blaSHV copy numbers of 0.78 (0.6, 1.02), 2.03 (1.56, 2.63), and 0.97 (0.74, 1.25),

respectively. blaSHV gene copy numbers of 21.86 (16.75, 28.79), 11.16 (8.55, 14.86), and

9.88 (7.59, 12.72) were observed for the isolate 89 strains resistant to 128 µg/mL CTX,

relative to the progenitor. The difference in relative blaSHV copy numbers when

comparing strains of isolates 46 and 89 resistant to 128 µg/mL CTX likely stems from a

difference in the dosage of ESBL-encoding blaSHV prior to commencement of the

stepwise selection to cefotaxime experiment. The change in ESBL-encoding blaSHV allele

dosage relative to Wt blaSHV dosage from the commencement to the conclusion of the

stepwise selection to cefotaxime resistance methodology supports this (Table 3.4).

Little change to the aph(3’)-Ia dosage in the isolate 89 derivatives relative to the

progenitor was also observed, with gene copy numbers of 1.36 (0.96, 1.96), 1.39 (0.98,

1.99), and 0.80 (0.56, 1.16), respectively (Figure 3.10) (Table 3.4). CTX is not a

Figure 3.8 Stepwise selection to cefotaxime (CTX) resistance flow diagram.

For each isolate, three parallel cultures were subjected to stepwise selection to CTX resistance (Section 2.3.5). Parallel cultures of progenitor isolates 46, 89, and 110 are denoted by a ‘-P’ suffix. Strains derived from 128 µg/mL CTX during the stepwise selection to CTX resistance experiment are denoted by a ‘-D’ suffix. The additional ‘-1’, ‘-2’, and ‘-3’ suffixes denote the arbitrary numbers used to demarcate individual parallel cultures of each isolate.

__________________________________________________________________________________________________________________________________________


substrate for the aph(3’)-Ia-encoded enzyme, therefore the absence of aph(3’)-Ia

amplification after stepwise selection to CTX resistance was expected.

The novel aph(3’)-Ia::large-blaSHV transposon::aph(3’)-Ia structure described in section

3.3.1 was observed for the isolate 110 progenitor and 2/3 derivatives (Figure 3.11).

The bridging amplicon specific to aph(3’)-Ia located at the 5’-end of the large-blaSHV

transposon could not be amplified in 110-D1, and a reduced concentration of the

amplicon bridging aph(3’)-Ia and the 3’ end of the large-blaSHV transposon was

observed (Figure 3.11). blaSHV gene copy numbers of the isolate 110 derivatives were

Figure 3.9 aph(3’)-Ia adjacent to the 5’ end of the small-blaSHV transposon tandem repeat region can be lost during stepwise selection to cefotaxime (CTX).

A, gene map of the small-blaSHV transposon and adjacent 5’-aph(3’)-Ia transposon, identifying the bridging amplicon position and primers used (Table 3.2). B, 1% TAE agarose gel demonstrating the blaSHV::aph(3’)-Ia bridging amplicons. Agarose gel lanes: M, GeneRuler™ 1Kb DNA Ladder Plus (Fermentas); P, progenitor isolates; D, 128 µg/mL-derived strains; N, NTC. Numbers 1, 2, and 3, denote individual parallel cultures for isolates 46 and 89, as indicated in B.


12.95 (9.96, 16.52), 4.27 (3.25, 5.63), and 6.48 (4.98, 8.36), respectively, relative to

isolate 110 (Table 3.4). No change to the aph(3’)-Ia dosage was observed, with aph(3’)-

Ia copy numbers of 1.39 (0.97, 2.00), 0.66 (0.46, 0.92), and 0.82 (0.57, 1.17) relative to

the progenitor. The results demonstrate that extensive selective pressure with CTX can

result in the loss of aph(3’)-Ia adjacent to the large-blaSHV transposon tandem repeat

region, similar to the aph(3’)-Ia loss observed in 89-D-2 and 89-D-3. aph(3’)-Ia dosage

did not significantly change over the course of stepwise selection to CTX resistance

despite blaSHV dosage increases, supporting the hypothesis that aph(3’)-Ia does not

participate in tandem repeat formation of the large-blaSHV transposon.

Overall, it was concluded that aph(3’)-Ia was not interspersed between blaSHV

transposon tandem repeats after selective pressure with CTX. aph(3’)-Ia is commonly

described as being flanked by IS26 elements that create a composite transposon

structure. Despite sharing IS26 elements with the neighbouring blaSHV transposon

tandem repeat region, aph(3’)-Ia was not incorporated into the blaSHV transposon

repeating unit during tandem repeat formation.

__________________________________________________________________________________________________________________________________________


Table 3.4 Phenotypic and genotypic analysis of the progenitor and 128 µg/mL CTX-derived K. pneumoniae strains from the stepwise

selection to cefotaxime (CTX) resistance experiment.

Strain Culture [CTX] (µg/mL)

MIC (µg/mL) ESBL phenotype

Relative Gene Copy Number Expansiond

ESBL-conferring blaSHV mutationf

CT / TZ CTL / TZL blaSHV aph(3’)-Ia

46-P-1 0 ≥16a 0.064b Positive 1e N/A 1.14 46-P-2 0 ≥16a 0.064b Positive 1e N/A 1.52 46-P-3 0 ≥16a 0.064b Positive 1e N/A 1.58 46-D-1 128 ≥16 0.064c Positive 0.78 (0.6,1.02) N/A 1.68 46-D-2 128 ≥16 0.094c Positive 2.03 (1.56,2.63) N/A 2.79 46-D-3 128 ≥16 ≥1.0 ND 0.97 (0.74,1.25) N/A 1.68

89-P-1 0 ≥16a 0.047 Positive 1e 1e 0.4 89-P-2 0 ≥16a 0.047 Positive 1e 1e 0.34 89-P-3 0 ≥16a 0.047 Positive 1e 1e 0.40 89-D-1 128 ≥16 0.19c Positive 21.86 (16.75,28.79) 1.36 (0.96,1.96) 7.06 89-D-2 128 ≥16 0.19c Positive 11.16 (8.55, 14.86) 1.39 (0.98,1.99) 6.15 89-D-3 128 ≥16 0.19c Positive 9.88 (7.59,12.72) 0.80 (0.56,1.16) 4.69

110-P-1 0 <0.25 0.19 Negative 1e 1e 0.07 110-P-2 0 <0.25 0.19 Negative 1e 1e 0.05 110-P-3 0 <0.25 0.19 Negative 1e 1e 0.04 110-D-1 128 ≥16 ≥1.0 ND 12.95 (9.96,16.52) 1.39 (0.97,2.00) 1.96 110-D-2 128 ≥16 0.125c Positive 4.27 (3.25,5.63) 0.66 (0.46,0.92) 2.93 110-D-3 128 ≥16 0.19c Positive 6.48 (4.98,8.36) 0.82 (0.57,1.17) 2.35 a Phantom zone of growth inhibition. b Satellite colonies present at the edge of the zone of growth inhibition. c Satellite colonies present within the zone of growth inhibition. d blaSHV copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of bla copy numbers of the progenitor isolate and the mutation rate derived colonies; empirical 95% confidence intervals determined using error propagation are listed in brackets (section 2.3.7). e blaSHV copy number normalised to 1.0. f Mutant allele dosage relative to wildtype allele dosage was calculated using 2∆CT, where ∆CT = CT(Wildtype allele) – CT(Mutant allele) (section 2.3.9).


Figure 3.10 blaSHV and aph(3’)-Ia relative gene copy numbers of the stepwise selection to cefotaxime (CTX) resistance-derived strains.

Dots represent the gene dosage of each strain selected to be resistant to 128 µg/mL CTX during stepwise selection to CTX resistance, relative to the isolate progenitors, as calculated from quantitative real-time PCR data (section 3.2.8). Empirical 95% confidence intervals are depicted by a vertical line crossing through each data point, terminating with a horizontal line. Empirical confidence intervals are determined using error propagation (Section 2.3.7.1). A red line indicates a relative gene copy number of 1.0.

__________________________________________________________________________________________________________________________________________


Fig

ure

3.1

1 a

ph

(3’)

-Ia

ad

jace

nt

to t

he

5’ a

nd

3’ e

nd

s o

f th

e la

rge-

bla

SHV t

ran

spo

son

can

be

lost

du

rin

g st

epw

ise

sele

ctio

n t

o C

TX

res

ista

nce

.

A, g

en

e m

ap

of

the

la

rge

-bla

SH

V t

ran

spo

son

an

d f

lan

kin

g a

ph

(3’)

-Ia

ge

ne

s; B

, 1%

TA

E a

ga

rose

ge

l d

em

on

stra

tin

g t

he

ap

h(3

’)-I

a::

recF

bri

dg

ing

am

pli

con

s;

C,

1%

TA

E a

ga

rose

ge

l d

em

on

stra

tin

g t

he

yg

bM

∆::

ap

h(3

’)-I

a b

rid

gin

g a

mp

lico

ns.

Ag

aro

se g

el

lan

es:

P,

iso

late

11

0 p

rog

en

ito

r; D

, is

ola

te 1

10

str

ain

s se

lect

ed

to

be

re

sist

an

t to

12

8 µ

g/

mL

CT

X d

uri

ng

ste

pw

ise

se

lect

ion

to

CT

X r

esi

sta

nce

; N

, N

TC

; M

, G

en

eR

ule

r™ 1

Kb

DN

A L

ad

de

r P

lus

(Fe

rme

nta

s).

Nu

mb

ers

1, 2

, an

d 3

, de

no

te i

nd

ivid

ua

l p

ara

lle

l cu

ltu

res.


3.4 DISCUSSION

In this chapter, tandem repeat formation of the blaSHV transposons was identified as the

mechanism responsible for observed blaSHV amplification in K. pneumoniae. blaSHV

transposon tandem repeat structures were investigated through the determination of

tandem repeat junction sequences. For those isolates harbouring the small-blaSHV

transposon, amplicons bridging adjacent copies harboured a single IS26 element at the

junction, and partial sequences matched the 3’ and 5’ ends of the small-blaSHV

transposon on pEC-IMPQ (GenBank accession: EU855788), indicating that the small-

blaSHV transposon forms tandem repeats. Tandem repeats of the small-blaSHV

transposon have not been described previously. Large-blaSHV transposon tandem

repeats were observed in isolate 110, an isolate characterised previously as harbouring

the large-blaSHV transposon. Amplicons bridging adjacent copies of the large-blaSHV

transposon harboured a single IS26 element, and partial sequences match previously

described large-blaSHV transposon tandem repeat structures (110, 356).

Analysis of the large-blaSHV transposon tandem repeat region and surrounding

sequence revealed a novel antibiotic resistance genetic structure in isolate 110. The

aph(3’)-Ia gene, which encodes a 3’-aminoglycoside phosphotransferase, was located at

both the 5’- and 3’-ends of the large-blaSHV transposon tandem repeat region. aph(3’)-Ia

is one of three aph(3’) allelic variants encoding the APH(3’)-I subclass of enzymes (188,

241, 245). The spectrum of activity of APH(3’)-I enzymes includes kanamycin,

neomycin, paromomycin, ribostamycin, lividomycin, and gentamycin B (302, 350).

aph(3’)-I genes are commonly described as being flanked by IS26 elements that create

composite transposon structures (125, 248, 266, 351). The aph(3’)-I allele, flanking

IS26 element orientation (direct or indirect), and non-coding sequence length

surrounding aph(3’)-I all contribute to the variety of transposon structures harbouring

aph(3’)-I.

There are several interesting observations regarding the novel aph(3’)-Ia::large-blaSHV

transposon::aph(3’)-Ia structure described in this study. The first is the overall

structure itself. It has been suggested that composite transposons sharing an IS26

element at their boundaries are the outcome of IS26-mediated recombination events

(247). Recombination events include the integration of circular molecules that contain

resistance genes into an IS26 element of a composite transposon, or recombination

__________________________________________________________________________________________________________________________________________


between two IS26 elements from two discrete composite transposons. Examples of

adjacent composite transposons that harbour diverse resistance genes that share a

single IS26 element are found in plasmids pAKU_1 (146) (GenBank accession:

AM412236), pRSB107 (317) (GenBank accession: AJ851089), and pTN48(40)

(GenBank accession: FQ482074). Single IS26 elements at the junction of adjacent

aph(3’)-Ia and large-blaSHV composite transposons suggests that the aph(3’)-Ia::large-

blaSHV transposon::aph(3’)-Ia structure was formed by IS26-mediated recombination

events. Adjacent blaSHV and aph(3’)-Ia composite transposon structures were identified

in two of the three K. pneumoniae isolates used in this study. Considering both isolates

possessed different blaSHV-transposon structures, recombination events facilitating the

adjacent aph(3’)-Ia and blaSHV transposon structure formation were independent.

The second interesting feature of the aph(3’)-Ia::large-blaSHV transposon::aph(3’)-Ia

structure was the presence of multiple aph(3’)-Ia genes. aph(3’)-Ia genes are thought to

be poorly regulated, hence APH(3’)-Ia is continually expressed even in the absence of

selective pressure (19, 302). Multiple aph(3’)-Ia genes would not only be costly to cell

fitness, but also unnecessary in the absence of selective pressure with an APH(3’)-Ia-

specific substrate (i.e. Kanamycin). aph(3)-Ia adjacent to the blaSHV transposon was lost

in a subset of strains selected to be resistant to 128 µg/mL CTX during stepwise

selection to CTX resistance. One possible explanation is that aph(3’)-Ia loss was

mediated by IS26 excision of the entire composite transposon. That an approximately

equivalent aph(3’)-Ia dosage in progenitor isolates and strains selected to be resistant

to 128 µg/mL CTX was maintained despite the loss of aph(3’)-Ia flanking the large-

blaSHV transposon suggests that the aph(3’)-Ia transposon was translocated rather than

lost from the genome entirely. aph(3’)-Ia loss was not consistent for all isolate 110 and

89 strains, indicating aph(3’)-Ia transposition may have been stochastic in nature. An

alterantive hypothesis is that the aph(3’)-Ia::large-blaSHV transposon::aph(3’)-Ia array

does not exist; instead aph(3’)-Ia::large-blaSHV transposon and large-blaSHV

transposon::aph(3’)-Ia structures could each exist in an independent subpopulation of

cells. This would account for the complete loss of the aph(3’)-Ia::recF bridging

amplicon, and partial loss of the ygbMΔ::aph(3’)-Ia amplicon in one of the stepwise

selection to CTX resistance parallel cultures (Figure 3.11).

The initial prediction that aph(3’)-Ia was interspersed between copies of the large-

blaSHV transposon was a plausible outcome of large-blaSHV transposon tandem repeat


formation. It was hypothesised that homologous recombination events would utilise

IS26 elements adjacent to aph(3’)-Ia as well as IS26 elements adjacent to the large-

blaSHV transposon, resulting in large-blaSHV transposon::aph(3’)-Ia or aph(3’)-Ia::large-

blaSHV transposon tandem repeating units. The outcome of these homologous

recombination events is resistance to two classes of antibiotics in the presence of

selective pressure with a single antibiotic. However, formation of large-blaSHV

transposon tandem repeats in response to selective pressure with CTX was observed to

be independent of aph(3’)-Ia. That the large-blaSHV transposon and aph(3’)-Ia

transposon structures remained independent during tandem repeat formation does not

make sense. One possible explanation is that homologous recombination events that

generate tandem arrays of the blaSHV transposon are specific to the IS26 elements

associated with the blaSHV transposon, and aph(3’)-Ia and blaSHV transposons amplify as

separate entities. A more likely scenario is that the increase in metabolic load resulting

from increased aph(3’)-Ia dosage results in cells less fit compared to cells harbouring

amplified blaSHV only. Thus only the latter population was observed.

In conclusion, tandem repeat formation of the blaSHV composite transposons was

consistent with results from previous studies (110, 356), demonstrating that blaSHV

dosage fluctuations are dependent upon being present on a composite transposon

structure harboured on a plasmid. A novel tandem composite transposon structure was

identified, harbouring β-lactam and aminoglycoside resistance determinants. Despite

blaSHV transposon tandem repeat formation occurring independently of the aph(3’)-Ia

transposon, this structure has the potential to act as a larger composite transposon,

utilising outer flanking IS26 elements. Transposition of the larger transposon structure

could occur, disseminating a mechanism for resistance to multiple antibiotics in a

single structure.

__________________________________________________________________________________________________________________________________________


CHAPTER 4 A blaTEM or blaSHV Extended-Spectrum β-

lactamase Genotype is not always associated

with an Extended-Spectrum β-Lactamase

phenotype

4.1 Introduction

Accumulation of mutations in DNA coding sequences contribute to the evolution of

bacteria (119). Spontaneously acquired mutations can have detrimental, neutral, or

beneficial effects to the encoded product of the gene they occur in. Loss-of-function

mutations confer reduction or loss of protein activity. Gain-of-function mutations

confer an enhanced function for the pre-existing protein, or acquisition of a new

activity. Often, mutations confer both loss- and gain-of-function by trade-offs between

the pre-existing and newly acquired function (28). When an environmental stress is

introduced, selective pressure directs evolution of the bacterial population by selecting

for bacterial cells harbouring mutations that provide improved cell fitness in the new

environment (214). Mutations can provide either a specific or general resistance

mechanism to environmental stress.

Adaptation to selective pressure can also involve gene duplication and amplification

events. Gene duplication and amplification events occur at a rate of approximately 10-4

and 10-2/cell/division, respectively (253). Gene duplication and amplification events

therefore provide a readily accessible component of evolutionary space that increases

gene expression. This is especially relevant to the evolution of resistance to some

classes of antibiotics. Resistance to β-lactam antibiotics is directly proportional to the

amount of β-lactamase expressed. Unsurprisingly, bla gene amplification in response to

β-lactam selective pressure has been reported (Chapter 3) (312).

SHV and TEM β-lactamases have been intensively studied due to their clinical

significance. These enzymes hydrolyse penicillins, ampicillin, and cephalosporin C and

are most frequently observed in Enterobacteriaceae (215, 255). Point mutations in the

blaSHV and blaTEM coding sequences expand the activity spectra of these enzymes to


include third-generation cephalosporins, or provide resistance to β-lactamase

inhibitors such as clavulanic acid (166) (http://www.lahey.org/studies).

There has been a recent paradigm shift for reporting of resistance to third-generation

cephalosporins. In 2010, CLSI Enterobacteriaceae breakpoint values for the

cephalosporins cefazolin, CTX, ceftizoxime, ceftriaxone, CAZ, and aztreonam were

revised and lowered to better reflect extant resistance mechanisms and phenotypes in

current bacterial populations (71, 97). Coinciding with the cephalosporin breakpoint

revision came the recommendation that the testing for and reporting of the presence of

an ESBL phenotype is no longer required. Originally, if an ESBL phenotype was

detected in a strain with a third generation cephalosporin MIC below the susceptibility

breakpoint, the strain would be classified as resistant to reflect the presence of the

ESBL enzyme. However, recent emergence of new ESBLs and AmpC-type enzymes, and

the prevalence of bacterial strains harbouring multiple resistance enzymes, can

confound ESBL determination (47, 90, 218, 284). MIC is now considered to be a better

predictor of treatment efficacy than determining the resistance mechanisms present,

including ESBLs, thus MICs should be used to direct empirical antibiotic therapy (348).

However, retrospective MIC analysis comparing previous to revised cut-offs has shown

conflicting results (155, 332).

In this chapter, it was of interest to determine if a bla mutation in the absence of gene

amplification confers a third-generation cephalosporin MIC greater than the current

susceptibility breakpoint. If it does not, it means that the acquisition of ESBL mutations

yields a strain that expresses an ESBL yet is phenotypically sensitive to third-

generation cephalosporins. Such strains have the potential to evolve a resistant

phenotype as a consequence of gene amplification, resulting in possible treatment

failure. The objective was to determine the phenotype of strains harbouring plasmid-

borne blaSHV and blaTEM that were selected to acquire ESBL-conferring mutations using

the minimum possible concentration of third-generation cephalosporin, the premise

being that selected mutants will have phenotypes representing the effect of the ESBL

mutation in the absence of bla gene amplification. blaTEM is associated with a number of

promoter sequence variants that impact on the expression of the TEM enzyme. blaTEM

phenotypes were explored in clinical K. pneumoniae isolates harbouring the previously

described P3, Pa/Pb, and P4 blaTEM promoters (184). The rate of mutation to third-

generation cephalosporin resistance, through the acquisition of ESBL-conferring point

__________________________________________________________________________________________________________________________________________


mutations, was also determined for these isolates to provide further insight as to

whether a single genetic event can confer resistance to a third generation

cephalosporin.

4.2 Methods


Clinical K. pneumoniae isolates used were available from the SENTRY surveillance

program Asia-Pacific region and South Africa, and are listed in Table 4.1. Isolates were

cultured using MH broth or agar (Oxoid, Cambridge, UK). CTX, CAZ, or rifampicin (Rif)

was added where described.

4.2.2 Characterisation of blaTEM promoter types for individual isolates

Primers were designed to amplify a 227 bp DNA fragment that includes the entire

blaTEM promoter region (Figure 4.1) and encompassed known polymorphic sites (184).

Primer design principals and software are described in 2.3.2. The primer sequences

used were TEM_PrF (5’-TGCTCATCAGCTCAGTATTGC-3’) and TEM_PrR

(5’-TGAAGCATTTATCAGGGTTATTG-3’) and their positions are shown in Figure 4.1.

PCR reactions were prepared as described in 2.3.3. Cycling conditions were: an initial

denaturation at 95°C for 2 min, followed by 40 cycles of 95°C/10s, 60°C/10s, 72°C/30s;

followed by a 2 minute hold at 72°C. Amplicons were visualised on 2% TAE agarose

gels containing 0.5X SYBR® safe dye (Invitrogen, Carlsbad, California, USA) as further

described in section 2.3.3. TEM_Pr amplicons were purified and sequenced at

Bioscience North Australia and Macrogen Inc. as described in Section 2.3.5.

4.2.3 Mutation Rate Determination

A single colony was used to create a 0.5 McFarland suspension in physiological saline

(0.9% NaCl). The 0.5 McFarland suspension was further diluted 1:150, 5 μL of which

(approximately 10,000 cells) was used to inoculate each of five (blaSHV isolate 110) or

20 (blaTEM isolates) individual 15 mL falcon tubes containing 3 mL MH broth. Parallel

cultures were incubated for 20 hours at 37°C, with agitation at 225 RPM (Bioline


Table 4.1 K. pneumoniae isolates used in Chapter 4.

Isolate bla gene bla promoter b,c ESBL Phenotypea

110 blaSHV U/S IS26 Negative

215-35-A blaTEM P4 Negative

219-08-D blaTEM P3 Negative

231-22.2-D blaTEM P3 Negative

236-20-D blaTEM P4 Negative

222-03-C blaTEM Pa/Pb Negative

238-02-A blaTEM P3 Negative a ESBL phenotype determined using Etests® (BioMérieux) (section 2.2.1). b blaSHV promoter associated with the large-blaSHV transposon (figure 3.1). c blaTEM promoter as described in Figure 4.1, determined by TEM_Pr PCR and amplicon sequencing (Section 4.2.2).

incubated shaker, Bioline, London, UK). Fifty μL from each blaSHV parallel culture tube

was spread-plated onto individual MH agar plates containing 0.2, 0.4, 0.6, 0.8, and

1.0 μg/mL of CTX (MH-CTX). Fifty μL aliquots of each blaTEM parallel culture were

spread-plated onto MH agar plates containing 1.0 μg/mL of CAZ (MH-CAZ) and MH agar

plates containing 150 μg/mL Rif (MH-Rif). Resistance to Rif is conferred by several

mutations in the chromosomally encoded rpoB gene. The mutation rate of resistance to

150 μg/mL Rif was used for mutation rate comparisons.

Viable cell counts were prepared by diluting two of the five parallel cultures (blaSHV

isolate 110) or five of the 20 parallel cultures (blaTEM isolates) 1:10-6 using physiological

saline, and spread-plating a 50 μL aliquot of each diluted suspension onto MH agar

plates not containing antibiotics. After 24 hours incubation at 37°C, the number of

colonies on the MH-CAZ, MH-CTX, and MH-Rif plates were recorded. The colonies were

counted on each viable cell count plate, multiplied by 106, and the mean of the two

values (blaSHV isolate 110), or the five values (blaTEM isolates) was calculated. This was

regarded as the number of viable cells plated (Nt).

Mutation rates to CTX or CAZ, and Rif resistance for each individual isolate were

calculated using the MSS-maximum likelihood method (289). A computer-based

program previously designed to assist in mutation rate calculations was used to

calculate m (the number of mutations per culture) and generate 95% confidence

interval values

__________________________________________________________________________________________________________________________________________


Figu

re 4.1

bla

TE

M p

rom

oter varian

ts.

Gre

y b

ars in

dica

te th

e -3

5 an

d -1

0 b

oxe

s of th

e P

a/

Pb

and

P3

pro

mo

ter re

gio

ns, a

nd

the

bla

TE

M sta

rt cod

on

. Ma

tche

d se

qu

en

ce is d

en

ote

d b

y d

ots (.).

Alte

rna

te se

qu

en

ce is m

ark

ed

by

a n

ucle

otid

e le

tter in

the

rele

va

nt p

ositio

n.T

he

nu

mb

ers u

nd

er th

e se

qu

en

ces in

dica

te S

utcliffe

nu

mb

erin

g p

ositio

ns

(31

4). T

EM

_Pr p

rime

r seq

ue

nce

s are

en

close

d in

ora

ng

e b

oxe

s. bla

TE

M p

rom

ote

r seq

ue

nce

s we

re o

bta

ine

d fro

m th

e fo

llow

ing

: P3

(Ge

nB

an

k a

ccessio

n:

FJ7

90

88

6), P

a/

Pb

(Ge

nB

an

k a

ccessio

n: E

U5

27

18

9), P

4 (G

en

Ba

nk

acce

ssion

: AM

94

11

59

).

Met

-35

Pa

-10

Pb

-35

P3

-10

P3

-35

Pb

-10

Pa

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

P3

TGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATTTTT

Pa/Pb

........................................................................T.......

P4

................................................................................

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

P3

ATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTT

Pa/Pb

................................................................................

P4

................................................................................

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

P3

GTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAA

Pa/Pb

................................................................................

P4

..........................................T.....................................

....|....|..

P3

AGGAAGAGTATG

Pa/Pb

............

P4

............

13

2

16

2


(Appendices A and B) (77). The mutation rate per cell per generation and the 95%

confidence intervals were then calculated using the formula:

μ = m/Nt

where μ is the mutation rate and Nt is the average number of viable cells calculated per

isolate.


4.2.4.1 Brilliance™ ESBL agar plates

Brilliance™ ESBL agar plates (Oxoid) were formulated as a presumptive identification

method for ESBL-expressing Escherichia coli, and Klebsiella, Enterobacter, Serratia, and

Citrobacter (KESC) group bacteria. Brilliance™ ESBL media contains cefpodoxime, along

with other antibiotics, which is used to inhibit non-ESBL Enterobacteriaceae growth

and supress the growth of organisms expressing AmpC enzymes. Two chromagens are

included in the media to differentiate between KESC group organisms, E. coli, and other

growth. KESC group organisms express galactosidase, resulting in green colonies. E. coli

that express galactosidase and gucuronidase appear as blue colonies, whereas β-

galactosidase negative E. coli appears as pink colonies.

Colonies arising on the MH-CTX and MH-CAZ plates were subbed onto Brilliance™ ESBL

agar plates using one of two methods. The first involved directly picking colonies and

inoculating marked sections of a Brilliance™ ESBL agar plate. The second method

required inoculating a Hybond™-N+ (Amersham Biosciences, GE Healthcare,

Buckinghamshire, England) circle (cut to fit within the inner circumference of the Petri

dish) with the contents of a MH-CAZ plate. This was achieved by gently running a

spreader over the membrane circle after placing the membrane onto the MH-CAZ plate

surface. Forceps were used to transfer the membrane onto the Brilliance™ ESBL agar

plate and the spreader was employed again to ensure all colonies on the membrane

were inoculated onto the surface of the plate. This was performed once for each plate.

Brilliance™ ESBL plates were then incubated for 24 hours at 37°C. Green colonies on

the Brilliance™ ESBL agar plates were denoted as ESBL-expressing K. pneumoniae and

the number of green colonies were recorded for each isolate.

__________________________________________________________________________________________________________________________________________


Several colonies per isolate were replated from the Brilliance™ ESBL plates onto fresh

MH-CTX plates or MH-CAZ plates containing the concentration of third-generation

cephalosporin that the colonies were originally cultured at. Inoculated MH-CTX or MH-

CAZ plates were incubated at 37°C for 24 hours. Glycerol stocks of each plated colony

were prepared by inoculating 500 μL MH broth and 500 μL 80% glycerol with a single

isolated colony. Glycerol stocks were vortexed to homogenise the contents, and stored

at -80°C.

4.2.4.2 Etest®

Cefotaxime/cefotaxime + clavulanic acid or ceftazidime/ceftazidime + clavulanic acid

resistance detection Etest® (BioMérieux, Marcy I’Etoile, France) strips were used to

detect an ESBL phenotype and to determine the MIC of CTX or CAZ, respectively, for

selected colonies of a given isolate as described in section 2.2.1.

4.2.5 Genotypic analysis

4.2.5.1 Relative bla gene dosage determination

DNA was isolated from single bacterial colonies using the boil method described in

section 2.3.1. Quantitative real-time PCR was use to determine the blaSHV or blaTEM

dosage of a subset of strains cultured during the mutation rate determination

experiments, relative to their respective progenitor. blaSHV and blaTEM quantitative real-

time PCR was performed as described in sections 2.3.7 and 2.3.8, respectively.

For strains harbouring a plasmid-borne blaSHV, relative blaSHV dosages were compared

statistically using the methodology described in section 2.3.7.1. For strains harbouring

blaTEM, relative blaTEM dosages were compared statistically using a methodology

analogous to that described in section 2.3.7.1. In this context, 16S rDNA and blaTEM were

the gene targets of interest.

Error propagation was incorporated into the relative gene copy number calculations to

determine empirical 95% confidence intervals. Relative gene copy numbers were

determined to be statistically significantly different if confidence intervals were not

overlapping.


4.2.5.2 Detection of point mutations in bla genes

Kinetic PCR to detect the ESBL-conferring blaSHV codon 238 polymorphism was

performed for strains harbouring plasmid-borne blaSHV (section 2.3.9).

To determine the presence of blaTEM point mutations conferring ESBL-expression,

blaTEM nucleotide sequence was determined for selected strains. Primers were designed

to amplify a 1061 bp DNA fragment that included the majority of the blaTEM gene

sequence and encompassed known ESBL-conferring polymorphic sites

(http://www.lahey.org/studies/temtable.asp). Primer design principals and software

are described in section 2.3.2. Determined primer sequences were blaTEMfor

(5’-GCGGAACCCCTATTTGTTT-3’) and blaTEMrev

(5’-GAGATTATCAAAAAGGATCTTCACC -3’). PCR reactions were prepared as described

in 2.3.3. Cycling conditions were: an initial denaturation at 95°C for 2 min, followed by

40 cycles of 95°C/30s, 60°C/30s, 72°C/60s; followed by a 2 minute hold at 72°C.

Amplicons were visualised on 1% TAE agarose gels containing 0.5X SYBR® safe dye

(Invitrogen) as further described in section 2.3.3. Amplicons were purified and

sequenced at Macrogen Inc. (Seoul, Korea) as described in section 2.3.5.

4.3 Results

4.3.1 A SHV-ESBL genotype in the absence of blaSHV amplification confers

phenotypic resistance to CTX

The minimum CTX concentration that can select for ESBL-conferring blaSHV point

mutants in the absence of gene amplification and the CTX resistance conferred by this

mutation were determined. Five parallel cultures of isolate 110 were plated onto each

of 0.2, 0.4, 0.6, 0.8, and 1.0 μg/mL MH-CTX agar plates. Colony counts post-incubation

are summarised in Table 4.2. Countable colonies were present on the 0.4 μg/mL MH-

CTX plates with a range of 25 to 56 colonies per plate. No growth was observed on the

0.6 μg/mL MH-CTX plates. A single colony was observed on the 0.8 μg/mL and 1.0

μg/mL MH-CTX plates (Table 4.2). Colonies cultured at 0.8 and 1.0 μg/mL CTX arose

__________________________________________________________________________________________________________________________________________


Table 4.2 blaSHV mutation rate determination for isolate 110 at different cefotaxime (CTX) concentrations.

CTX μg/mL

110#1 110#2 110#3 110#4 110#5 m - CTXb CTX Mutation Ratec Confidence Intervals (95%)d

1.0 0 0 0 0 1 0.2 1.38 X 10-9 6.06 X 10-11, 3.81 X 10-9 0.8 0 1 0 0 0 0.2 1.38 X 10-9 6.06 X 10-11, 3.81 X 10-9 0.6 0 0 0 0 0 - - - 0.4 31 50 39 56 25 - - - 0.2 >200 >200 >200 >200 >200 - - -

Nta 7.25X107 - - -

The G238S blaSHV mutation conferring a SHV-ESBL genotype was only observed in the colonies cultured at 0.8 and 1.0 µg/mL CTX, therefore mutation rates to CTX concentrations of 0.2-0.6 µg/mL were not determined. a Number of viable cells. b The number of mutations per culture (m) was calculated determined using previously designed software (section 4.2.3) (Appendix A). c The mutation rate per cell per generation was calculated using the formula: μ = m/Nt where µ is the mutation rate, and Nt is the number of viable cells. d 95% confidence interval values of m were generated using previously designed software (section 4.2.3) (Appendix B). 95% confidence intervals of the mutation rate were then calculated using the formula: μ = m/Nt.


from different parallel cultures. The resulting mutation rate of blaSHV to each of 0.8 and

1.0 μg/mL CTX in this experimental system was 1.39 X 10-9.

The single colonies from the 0.8 and 1.0 μg/mL MH-CTX colonies and 54 colonies from

the five 0.4 μg/mL MH-CTX plates were screened for ESBL expression using BrillianceTM

ESBL chromogenic media. All produced green colonies on the chromogenic media,

which was indicative of ESBL expression in K. pneumoniae (Figure 4.2). However, only

colonies from the 0.8 and 1.0 µg/mL CTX plates were ESBL positive according to the

Etest® (Table 4.3). Consistent with this result, kinetic PCR revealed that these isolates

had acquired the G238S blaSHV mutation that confers an SHV-ESBL genotype, whereas

the nine 0.4 μg/mL CTX derivatives tested in this assay had not (Table 4.3).

Etests® revealed that acquisition of the G238S mutation conferred an increase in MIC

above the current CTX ‘sensitive’ breakpoint (71) for both strains derived from the 0.8

and 1.0 μg/mL MH-CTX agar plates (Table 4.3). In contradiction to previous blaSHV

mutation rate determinations, blaSHV point mutants free of gene amplification were

generated, and the mutation rate was higher than the 10-10 - <10-11 mutation rate

previously described (77). It was concluded that the G238S blaSHV mutation can confer

resistance to >1.0 µg/mL CTX. In this system, resistance to 0.4 μg/mL CTX does not

require G238S blaSHV mutation. It needs to be noted that ‘false-positives’ can occur on

the Brilliance™ ESBL chromogenic media as demonstrated by the growth of non-ESBL

strains derived from the 0.4 μg/mL MH-CTX plates. Caution should be taken when

interpreting bacterial growth on this media.

The blaSHV dosages of the mutant strains (Table 4.3) were compared using real time

PCR to determine if the blaSHV dosage observed for the non-ESBL and ESBL-encoding

strains were significantly different. Overlapping confidence intervals were observed

between all isolate 110 strains cultured during the mutation rate experiments (Figure

4.3). Based on confidence interval overlap, the following observations were made:

derivative 14 had a statistically significantly different blaSHV dosage compared to all

other derivatives except for derivative 38; derivative 38 harboured a statistically

significantly different blaSHV relative copy number compared to derivatives 1, 2, 22, 26,

35, and 41. Therefore, in most instances the blaSHV dosage in SHV-ESBL-expressing

strains was not significantly different from the non-ESBL-expressing strains. The

__________________________________________________________________________________________________________________________________________


results of this experiment indicate that gene amplification is not required for

acquisition of an SHV-dependent ESBL positive phenotype.

4.3.2 A TEM-ESBL genotype does not always confer a CAZ resistant

phenotype

The evolution of a TEM-ESBL-genotype from a non-ESBL-encoding blaTEM involves

similar molecular mechanisms to those associated with SHV-ESBL evolution.

Acquisition of specific, non-synonymous point mutations in the blaTEM gene increases

the activity spectrum of the encoded β-lactamase. blaTEM amplification provides an

intermediate form of resistance to third-generation cephalosporins prior to acquisition

of more stable point mutations (312), and further decreases the susceptibility to third-

generation cephalosporins after the acquisition of said mutations. TEM β-lactamase

expression is also influenced by the promoter variant upstream of the blaTEM gene

(184). In this section I describe the determination of the rate and phenotypic impact of

Figure 4.2 Isolate 110 strains cultured during mutation rate determination subcultured onto the Brilliance™ extended-spectrum β-lactamase (ESBL) chromogenic media (Oxoid).

Single colonies derived from the 1.0 and 0.8 µg/mL MH-CTX agar plates are denoted with the relevant MH-CTX concentration in the figure. The red square surrounds subcultured colonies derived from the 0.4 µg/mL MH-CTX agar plates.


Table 4.3 Phenotypic and genotypic analysis of isolate 110 strains cultured during the mutation rate experiments.

CTX concentration (µg/mL) Colony No. bla copy numbera

E-test® Codon 238 mutationb Enzyme

CTX MIC (µg/mL) ESBL-expression

0.8 1 0.77 (0.61, 0.97) 8c, e Positive G238S SHV-2 1.0 2 0.90 (0.70, 1.12) ≥8c, d Positive G238S SHV-2 0.4 8 1.21 (0.96, 1.53) - - None SHV-1 0.4 14 2.20 (1.73, 2.81) 0.5 Negative None SHV-1 0.4 18 1.07 (0.85, 1.36) - - None SHV-1 0.4 22 0.82 (0.63, 1.05) - - None SHV-1 0.4 26 0.82 (0.65, 1.05) - - None SHV-1 0.4 35 0.74 (0.58, 0.95) - - None SHV-1 0.4 38 1.55 (1.22, 1.96) 0.38 Negative None SHV-1 0.4 41 0.82 (0.64, 1.04) - - None SHV-1 0.4 50 1.02 (0.80, 1.33) 0.5 Negative None SHV-1

a blaSHV copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of the blaSHV copy number of the progenitor isolate 110 and strains derived from mutation rate experiments; empirical 95% confidence intervals determined using error propagation are listed in brackets (section 2.3.7). b Kinetic PCR was used to determine the presence of the G238S ESBL-conferring blaSHV mutation (Section 2.3.9). c Phantom zone of growth inhibition. d Satellite colonies present at the edge of the zone of growth inhibition. e Satellite colonies present within the zone of growth inhibition.

__________________________________________________________________________________________________________________________________________


the acquisition of ESBL point mutations in the blaTEM gene, selected using 1.0 μg/mL

CAZ, a concentration lower than the current susceptibility breakpoint value of 4.0

μg/mL (71).

The mutation rate of resistance to 1.0 μg/mL CAZ was determined for six clinical K.

pneumoniae isolates containing blaTEM-1. In these isolates, blaTEM-1 was associated with

the P3, Pa/Pb, or P4 promoter variant (Table 4.1). The rate of mutation to resistance to

150 μg/mL Rif, conferred by several mutations in the chromosomally encoded rpoB

gene, was used for mutation rate comparisons. CAZ MIC, ESBL expression, and the

blaTEM allele were determined for selected strains cultured during the mutation rate

experiments.

The number of colonies observed on parallel culture MH-CAZ and MH-Rif plates are

summarised in Table 4.4. The calculated mutation rates to 1.0 μg/mL CAZ and

Figure 4.3 Relative blaSHV copy number iterations derived from error propagation calculations.

Dots represent the blaSHV dosage of each isolate 110 strain relative to the progenitor, as calculated from quantitative real-time PCR data (section 2.3.7). Empirical 95% confidence intervals are depicted by a vertical line crossing through each data point, terminating with a horizontal line. Empirical confidence intervals are determined using error propagation (section 2.3.7.1).The red line indicates a relative gene copy number of 1.0.


Table 4.4 blaTEM mutation rate colony counts for the 20 parallel cultures of each isolate.

Plate No.

215-35-A 219-08-D 222-03-C 231-22.2-D 231-22.2-D-2 236-20-D 238-02-A CAZa Rifb ESBLc CAZ Rif ESBL CAZ Rif ESBL CAZ Rif ESBL CAZ Rif ESBL CAZ Rif ESBL CAZ Rif ESBL

1 1 CGd 1 0 2 0 1 17 0 45 1 35 19 2 5 0 CG 0 0 4 0 2 2 CG 2 0 0 0 1 1 1 22 0 22 60 1 2 0 CG 0 0 6 0 3 6 CG 6 0 1 0 1 8 1 89 1 75 50 1 16 2 CG 0 0 0 0 4 4 CG 4 0 16 0 1 0 1 200 0 169 40 23 4 3 CG 0 0 1 0 5 7 CG 7 0 0 0 1 0 1 55 9 52 25 0 2 10 CG 8 0 0 0 6 6 CG 6 0 1 0 5 CG 5 119 0 106 31 1 13 0 CG 0 0 0 0 7 4 CG 4 0 6 0 1 0 1 17 28 15 24 0 16 0 CG 0 0 0 0 8 2 CG 2 0 5 0 0 0 0 71 1 52 21 0 3 0 CG 0 0 0 0 9 7 CG 7 0 2 0 0 16 0 20 1 11 40 0 5 4 CG 3 0 0 0

10 6 CG 6 0 35 0 0 0 0 23 4 26 11 20 5 8 CG 2 0 0 0 11 1 CG 1 0 0 0 0 0 0 119 0 84 56 8 9 5 CG 5 0 0 0 12 6 CG 6 0 4 0 0 0 0 67 4 56 30 0 14 2 CG 1 0 0 0 13 2 CG 2 0 4 0 >200 0 >200 54 0 44 >200 6 7 0 CG 0 0 0 0 14 5 CG 5 0 1 0 0 49 0 >200 10 >200 27 0 6 2 CG 0 0 2 0 15 9 CG 9 0 5 0 1 0 1 106 0 72 24 0 6 0 CG 0 0 0 0 16 10 CG 10 0 0 0 1 0 1 67 1 28 37 1 5 0 CG 0 0 0 0 17 4 CG 4 0 1 0 1 0 1 53 4 34 16 3 10 5 CG 1 0 1 0 18 5 CG 5 0 14 0 8 1 8 210 1 210 25 0 15 0 CG 0 0 0 0 19 2 CG 2 1 34 1 1 0 1 280 2 251 28 12 16 0 CG 0 0 0 0 20 1 CG 1 0 1 0 4 1 4 40 2 28 80 3 6 0 CG 0 1 0 0

Nt e 7.07X108 1.21X108 1.02X108 1.54X108 1.11X108 6.58X107 1.03X108 a Number of colonies resistant to 1.0 μg/mL CAZ per plate. b Number of colonies resistant to 150 μg/mL Rif per plate. c Number of ESBL-expressing colonies, defined by the presence of green colonies on the Brilliance ESBL chromogenic media (section 4.2.4.1). d Confluent growth (CG). e Number of viable cells (Nt).

__________________________________________________________________________________________________________________________________________


150 μg/mL Rif are listed in Table 4.5. Mutation rates to Rif resistance ranged from 1.41

X 10-9 to 6.1 X 10-9, but could not be determined for isolates 215-35-A and 236-20-D

due to confluent growth on all 20 MH-Rif plates for each isolate (Table 4.4). It is likely

that isolates 215-35-A and 236-20-D harboured rpoB mutations conferring resistance

to Rif. The rate of mutation to resistance to 1.0 μg/mL CAZ ranged between 4.38 X 10-8

to 2.07 X 10-10 (Table 4.5). It was interesting to note that the highest observed rate of

mutation to CAZ resistance, 4.37 X 10-8, was observed for the P3 promoter isolate 231-

22.2-D. It was hypothesised that this isolate would have a lower mutation rate

compared to other isolates due to the presence of a weaker blaTEM promoter and

consequently additional genetic mutation events would be required for resistance to

emerge. A similar mutation rate (4.38 X 10-8) was observed when the experiment was

repeated (isolate 231-22.2-D-2). It is unlikely that a mutator population is responsible

for the elevated mutation rate to 1.0 μg/mL CAZ. The rate of mutation to Rif resistance

for this isolate was approximately 10-fold lower than the rate of mutation to 1.0 μg/mL

CAZ, and was comparable to the rate of mutation to Rif resistance for isolates 219-08-D,

222-03-C, and 238-02-A (Table 4.5). Non-β-lactamase-mediated resistance mechanisms

such as a down-regulation of porins, or a pre-existing blaTEM amplification event prior

to the mutation rate determination experiments may have contributed to the increased

mutation rate. Overall, the mutation rates to CAZ and Rif resistance observed here are

comparable with the mutation rate for a specific base change in a non-mutator bacterial

cell (10-9) (49, 160).

The described mutation rates of resistance to 1.0 μg/mL CAZ were based on the total

number of colonies observed on the parallel culture MH-CAZ plates for each progenitor.

To determine if ESBL-encoding blaTEM mutants were selected for and the rate of said

TEM-ESBL mutant selection, strains cultured during the mutation rate determination

experiments were further analysed for the presence of an ESBL-conferring blaTEM point

mutation, and expression of TEM-ESBL. Where several colony morphologies were

observed on the MH-CAZ parallel culture plates (i.e. isolates 215-35-A, 231-22.2-D,

236-20-D, and 222-03-C) (Figure 4.4), representative colonies of each morphology

were selected for further analysis.

According to Etest® guidelines, an ESBL phenotype is identified by a CAZ MIC ≥1 µg/mL

and a CAZ MIC/CAZ + clavulanic acid MIC ratio ≥8, and/or the presence of phantom

zones of growth inhibition zones or deformation of the CAZ zone of growth inhibition


Table 4.5 MSS-Maximum Likelihood Estimates of the blaTEM mutation rate to 1.0 µg/mL ceftazadime (CAZ).

Isolate ESBL Phenotype m - CAZa CAZ Mutation

Rateb Confidence Intervals

(95%)c m – Rifa

Rif Mutation Rateb

Confidence Intervals (95%)c

215-35-A Negative 2.2573 1.6 X 10-9 9.9 X 10-10, 2.3 X 10-9 - - - 219-08-D Negative 0.05 2.07 X 10-10 2.5 X 10-11, 5.0 X 10-10 1.4773 6.1 X 10-9 3.5 X 10-9, 9.2 X 10-9 222-03-C Negative 0.8074 3.96 X 10-9 1.95 X 10-9, 6.48 X 10-9 0.48612 2.38 X 10-9 1.0 X 10-9, 4.2 X 10-9 231-22.2-D Negative 13.45 4.37 X 10-8 3.38 X 10-8, 5.44 X 10-8 1.0427 3.39 X 10-9 1.8 X 10-9, 5.3 X 10-9 231-22.2-D v2 Negative 9.7219 4.38 X 10-8 3.29 X 10-8, 5.58 X 10-8 0.94374 4.25 X 10-9 2.2 X 10-9, 6.7 X 10-9 236-20-D Negative 0.7076 5.38 X 10-9 2.62 X 10-9, 8.85 X 10-9 - - - 238-02-A Negative 0.05 2.43 X 10-10 2.9 X 10-11, 5.9 X 10-10 0.2898 1.41 X 10-9 5.1 X 10-10, 2.6 X 10-9

a The number of mutations per culture (m) was calculated determined using previously designed software (section 4.2.3) (Appendix A). b The mutation rate per cell per generation was calculated using the formula: μ = m/Nt where µ is the mutation rate, and Nt is the number of viable cells. c 95% confidence interval values of m were generated using previously designed software (section 4.2.3) (Appendix B). 95% confidence intervals of the mutation rate were then calculated using the formula: μ = m/Nt.

__________________________________________________________________________________________________________________________________________


(41). Ten of the 15 mutants selected for genotypic analysis were classified as ESBL-

positive according to Etest® guidelines, but only five of these 10 ESBL-positive mutants

were shown to harbour a previously described ESBL-conferring blaTEM point mutation.

In summary the mutants may be divided into three classes: 1. ESBL-negative according

to the Etest® and unmutated blaTEM-1, 2. ESBL positive according to the Etest® and

unmutated blaTEM-1, and 3. ESBL positive according to the Etest® and mutated blaTEM.

All class 1 mutants harboured blaTEM-1, and were sensitive to CAZ, with MICs below the

4.0 µg/mL CAZ susceptibility breakpoint (Figure 4.5) (Table 4.6) (71).

Figure 4.4 Colony morphologies of strains cultured during mutation rate determination experiments selected for phenotypic and genotypic analysis.

The red boxes enclose selected colonies. The colony number is listed within the red box, and correlates with colony numbers listed in Table 4.6.


Class 2 mutants harboured blaTEM-1 and were CAZ sensitive, with an MIC range of 1.0 –

1.5 µg/mL (Figure 4.5) (Table 4.6) (71). According to the Etest®, class 2 mutants

expressed an ESBL as indicated by a CAZ MIC ≥1 µg/mL and a CAZ MIC/CAZ +

clavulanic acid MIC ratio ≥8. A chromosomally-encoded SHV-ESBL did not contribute to

the phenotype of these mutants, as demonstrated by kinetic PCR. It may be significant

that phantom zones of growth inhibition or deformations of the CAZ zone of growth

inhibition were not observed for the class 2 mutants (Table 4.6). These Etest® features,

arising from clavulanic inhibition of an ESBL enzyme, were observed for three of the

five class 3 mutants (Table 4.6).

A larger range of CAZ MICs were observed for the class 3 mutants, ranging from CAZ

sensitive (1.0 µg/mL) to CAZ intermediate (8 µg/mL) (Figure 4.5) (Table 4.6).

Acquisition of a CAZ resistant phenotype after an ESBL-conferring blaTEM mutation was

Figure 4.5 Ceftazidime (CAZ) minimum inhibitory concentration (MIC) distributions of Class 1, 2, and 3 mutants.

Data points represent the CAZ MIC for each isolate that had both the CAZ MIC and blaTEM allele determined. MICs determined for each isolate are grouped by their mutant class. The dashed line indicates the CAZ susceptibility breakpoint according to current CLSI criteria (71). The expressed TEM enzyme is noted to the right of each MIC data point.

__________________________________________________________________________________________________________________________________________


Table 4.6 Phenotypic and genotypic analysis of strains harbouring blaTEM cultured during the mutation rate experiments.

Progenitor Promoter variant Colony No. blaTEM copy numbera E-test®

blaTEM mutationb Enzyme Class CAZ MIC (µg/mL) ESBL phenotype

215-35-A P4 1 2.69 (2.05, 3.51) 2 Positive D179G Newc 3 35 7.14 (5.51, 9.20) - - - 54 10.23 (7.76, 13.38) 1.0 Negative None TEM-1 1 86 2.68 (2.04, 3.47) - - -

219-08-D P3 1 10.16 (7.73, 13.45) 1.0 Positive None TEM-1 2

222-03-C Pa/Pb 2 1.69 (1.27, 2.15) - - - 14 20.61 (15.87, 27.00) 1.5 Negative None TEM-1 1 17 1.37 (1.02, 1.78) 4 Positive R164C TEM-143 3 23 1.51 (1.13, 2.01) - - -

231-22.2-D P3 1 2.12 (1.62, 2.79) 1.0 Positive None TEM-1 2 2 2.06 (1.61, 2.67) - - - 7 1.65 (1.27, 2.21) - - - 8 1.68 (1.30, 2.19) - - - 10 1.67 (1.28, 2.16) - - - 11 1.71 (1.30, 2.24) - - - 16 1.48 (1.12, 1.89) 0.5 Negative None TEM-1 1 17 1.61 (1.23, 2.08) 1.0 Positive None TEM-1 2

231-22.2-D v2 P3 1 1.72 (1.31, 2.27) 2 Negative None TEM-1 1 6 2.18 (1.69, 2.89) 1.0 Positive None TEM-1 2 15 1.69 (1.29, 2.28) 1.0e Positive R164S TEM-12 3 19 1.85 (1.46, 2.38) 1.0 Positive None TEM-1 2 20 1.72 (1.32, 2.21) 1.0 Negative None TEM-1 1

236-20-D P4 13 2.54 (1.94, 3.34) - - - 19 3.23 (2.46, 4.18) - - - 22 4.23 (3.21, 5.57) 6f Positive R164H TEM-29 3 30 2.65 (2.01, 3.39) 8f Positive R164S TEM-12 3

238-02-A P3 1 NDd ND ND ND ND ND a blaTEM copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of the blaTEM copy number of the progenitor isolate and strains derived from mutation rate experiments; empirical 95% confidence intervals determined using error propagation are listed in brackets (section 2.3.8). b Mutations in blaTEM genes were determined by sequencing the blaTEM gene and translating the coding sequence (section 4.2.5.2). c There is no recorded nomenclature for a D179G TEM enzyme (http://www.lahey.org/studies/temtable.asp). d Strain 238-02-A-1 was unable to be resuscitated after storing down as a glycerol stock. Phenotypic and genotypic analysis of this colony could not be performed. e Deformation of the zone of growth inhibition f Phantom zone of growth inhibition.


not observed. It seemed that the CAZ MIC was reflective of the catalytic efficiency of the

encoded TEM-ESBL, and the blaTEM promoter strength (Figure 4.5). Two class 3 mutants

expressed TEM-12, the most efficient TEM-ESBL of those expressed by all the class 3

mutants. A CAZ MIC of 1.0 µg/mL (CAZ sensitive) was observed for the mutant

harbouring the TEM-12 + P3 promoter combination, however in the presence of a

stronger promoter (P4), a CAZ MIC of 8.0 µg/mL (CAZ intermediate) was observed

(Table 4.6) (Figure 4.5). The remaining two class 3 mutants harbouring the P4

promoter encoded less efficient TEM-ESBL enzymes, and CAZ MICs lower than 8.0

µg/mL were observed (Table 4.6) (Figure 4.5). A novel D179G TEM allele was observed

in one class 3 mutant. There is no current enzyme nomenclature available for a D179G

TEM allele (http://lahey.org/studies/temtable.asp). Asp-179 TEM mutant alleles have

been shown to confer a decreased susceptibility to CAZ (79, 81, 329), which correlates

with the observed increase in CAZ MIC for this isolate relative to its progenitor isolate

(Table 4.6). It was concluded that 1.0 μg/mL CAZ provides sufficient selective pressure

to select TEM-ESBL-encoding mutants. Acquisition of an ESBL mutation was shown to

not confer a CAZ resistant phenotype; therefore the phenotype is not always indicative

of the blaTEM genotype. It was also demonstrated that the Etest® criteria used to detect

an ESBL phenotype is misrepresentative, classifying strains as ESBL-positive in the

absence of a mutatnt blaTEM or chromosomal blaSHV gene..

It was hypothesised that blaTEM amplification would be observed in strains cultured

during the determination of mutation rate experiments that did not acquire a TEM-

ESBL-conferring mutation. Conversely, for colonies harbouring ESBL-encoding blaTEM, it

was hypothesised that blaTEM amplification relative to the progenitor isolate would be

minimal. Quantitative real-time PCR was used to determine blaTEM dosage for strains

cultured during the determination of mutation rate experiments relative to their

progenitors (Table 4.6). Error propagation was incorporated into the relative gene

copy number calculation to determine empirical 95% confidence intervals. Relative

gene copy numbers were considered to be statistically significantly different if

confidence intervals did not overlap. Based on confidence interval overlap, isolate 215-

35-A derivatives 35 and 54 (class 1 mutant), isolate 219-08-D derivative 1 (class 2

mutant), and isolate 222-03-C derivative 14 (class 1 mutants) harboured a blaTEM

dosage that was statistically significantly higher compared to the remaining 22

derivatives (Figure 4.6). Class 3 mutants of isolates 215-35-A and 222-03-C harboured

a statistically significantly lower blaTEM dosage than class 2 and 1 mutants derived from

__________________________________________________________________________________________________________________________________________


the same progenitors, which supported the hypothesis that blaTEM amplification would

be observed in derivatives that did not acquire an ESBL-conferring blaTEM point

mutation. A statistically significant difference between class 3, and class 2 and 1

mutants of isolate 231-22.2-D was not observed. This adds further support to the

hypothesis that a non-β-lactamase antibiotic resistance mechanism has contributed to

the observed CAZ phenotypes in the isolate 231-22.2-D mutants. A statistically

significant increase in relative blaTEM dosage was observed for strains including the

class 2 and 1 mutants in comparison to the class 3 mutants for those isolates that were

not expressing a non-β-lactamase antibiotic resistance mechanism.

The rate of mutation to 1.0 µg/mL CAZ resistance determined in Table 4.5 encompass

non-ESBL- and ESBL-encoding blaTEM mutants. In order to determine the rate that an

ESBL-conferring blaTEM point mutation is acquired, colony counts were revised to

Figure 4.6 Relative blaTEM copy number iterations derived from error propagation calculations.

Dots represent the blaTEM dosage of each derivative strain relative to its respective mutation rate progenitor, as calculated from quantitative real-time PCR data (section 2.3.8). Empirical 95% confidence intervals are depicted by a vertical line crossing through each data point, terminating with a horizontal line. Empirical confidence intervals are determined using error propagation (section 2.3.8). A red line indicates a relative gene copy number of 1.0.


include only those colonies that shared a similar morphology to the class 3 mutants

identified in Table 4.6. The rates of mutation to 1.0 µg/mL CAZ resistance were then

recalculated (Table 4.7). Adjustment of colony counts resulted in an ~10-fold reduction

of the observed mutation rates to 1.0 µg/mL CAZ resistance for each isolate. For the

isolate 231-22.2-D replicates, the mutation rates to 1.0 µg/mL CAZ resistance remained

elevated after the recalculation (<3.54 X 10-8 and 6.33 X 10-9) compared to the

mutation rates of the remaining isolates. It can be concluded that 1.0 µg/mL CAZ

provides sufficient selective pressure for acquisition of a TEM-ESBL mutation.

However, cells that did not acquire a TEM-ESBL mutation were also observed. The 1.0

µg/mL CAZ resistant phenotype of these mutants was attributed to blaTEM-1 gene

amplification, and ultimately resulted in an initial over-estimation of the mutation rates

to 1.0 µg/mL CAZ resistance (Table 4.5).

4.4 Discussion

The findings presented here demonstrate that the SHV-ESBL G238S mutation was

acquired without associated amplification of blaSHV. The G238S mutation conferred

resistance to >1.0 µg/mL CTX, which is greater than the current CLSI susceptibility

breakpoint (71). Mutants were selected by 0.8 and 1.0 µg/mL CTX, at a rate of 10-9,

consistent with the spontaneous mutation rates of non-mutator bacterial cells (160).

Previous investigations of the rate of mutation to CTX resistance in blaSHV demonstrated

that an SHV-ESBL mutation was acquired at a rate of ≤10-11 (77), a rate much lower

than observed in this section. Dakh (2008) reported that acquisition of the G238S SHV

mutation was associated with blaSHV amplification in the experimental system, which

conflicts with findings reported here (77). The differences in the findings are intriguing,

considering isolate 110 was used in both studies. It is unlikely that a transient

hypermutator population was responsible for the elevation of blaSHV mutation rate

described in this section. Hypermutable K. pneumoniae strains are thought to be

uncommon (1), although they have been described previously (80). Hypermutable

bacterial strains demonstrate an elevated mutation rate compared to non-mutator

strains, generally in the order of 10-5 (242), a mutation rate much higher than

determined for isolate 110 in this section. blaSHV gene amplification may have facilitated

acquisition of an ESBL mutation by providing extra gene targets for mutations to occur.

__________________________________________________________________________________________________________________________________________


Table 4.7 MSS-Maximum Likelihood Estimates of the blaTEM mutation rate to 1.0 µg/mL cefotaxime (CTX) resistance – colonies

harbouring extended-spectrum β-lactamase (ESBL)-conferring mutations.

Isolate Promoter ESBL

Phenotype m - CAZa

CAZ Mutation Rateb

Confidence Intervals (95%)c

m - Rifa Rif Mutation

Rateb Confidence Intervals

(95%)c 215-35-A P4 Negative 1.4361 1.02 X 10-9 5.7 X 10-10, 1.5 X 10-9 - - - 219-08-D P3 Negative <0.05 <2.07 X 10-10 [2.5 X 10-11, 5.0 X 10-10] 1.4773 6.1 X 10-9 3.5 X 10-9, 9.2 X 10-9 222-03-C Pa/Pb Negative 0.11045 5.4 X 10-10 1.2 X 10-10, 1.2 X 10-9 0.48612 2.38 X 10-9 1.0 X 10-9, 4.2 X 10-9 231-22.2-D P3 Negative <7.8667 <3.54 X 10-8 [1.9 X 10-8, 3.3 X 10-8] 1.0427 3.39 X 10-9 1.8 X 10-9, 5.3 X 10-9 231-22.2-D v2

P3 Negative 1.4056 6.33 X 10-9 3.6 X 10-9, 9.6 X 10-9 0.94374 4.25 X 10-9 2.2 X 10-9, 6.7 X 10-9

236-20-D P4 Negative 0.37294 2.83 X 10-9 1.1 X 10-9, 5.0 X 10-9 - - - 238-02-A P3 Negative <0.05 <2.43 X 10-10 [2.9 X 10-11, 5.9 X 10-10] 0.2898 1.41 X 10-9 5.1 X 10-10, 2.6 X 10-9 a The number of mutations per culture (m) was determined using previously designed software (Section 4.2.3) (Appendix A). b The mutation rate per cell per generation was calculated using the formula: μ = m/Nt where µ is the mutation rate, and Nt is the number of viable cells. c 95% confidence interval values of m were generated using previously designed software (Section 4.2.3) (Appendix B). 95% confidence intervals of the mutation rate were then calculated using the formula: μ = m/Nt.


The inherent instability of gene amplifications and the more stable CTX resistance

mechanism bestowed by an ESBL-encoding blaSHV gene both favour the loss of blaSHV

copies after an SHV-ESBL is acquired (253, 254). Gene segregation following

acquisition of mutations could account for the absence of amplified blaSHV in the SHV-

ESBL-encoding colonies observed here.

The use of chromogenic media in determining the presence/absence of ESBL activity in

isolates harbouring blaSHV was unsuccessful in this study. Growth of non-ESBL-

expressing K. pneumoniae derivatives on Brilliance™ ESBL agar plates (OXOID) was

observed. “False-positive” growth has been previously reported for a range of ESBL-

selective chromogenic media. Penicillinase hyperproduction in K. oxytoca, and AmpC

enzyme hyperproduction in Enterobacter spp. and Citrobacter have been attributed to

the growth of non-ESBL strains on chromogenic media (118), (157), (276), (293).

Huang et. al., (2010) reported growth of E. coli expressing non-ESBL TEM- and SHV-β-

lactamases on Brilliance™ ESBL media (157). The “false-positive” growth observed in

this study may be attributed to increased expression of SHV β-lactamase through

increased dosage of blaSHV (Table 4.3). Alternatively isolates may have harboured a

non-ESBL cefodoxime resistance mechanism. In this section, Brilliance™ ESBL agar

plates were trialled as a less-intensive method for screening all mutation rate-derived

colonies for ESBL expression, and the SHV-ESBL kinetic PCR was used as an alternative

method for identifying the presence of SHV-ESBL alleles in these isolates.

The rate that an ESBL-conferring blaTEM point mutation was acquired ranged from

<3.54 X 10-8 to <2.07 X 10-10. This is consistent with the spontaneous mutation rates of

non-mutator bacterial cells (49, 160). R164S, R164H, and R164C TEM substitutions,

resulting in the TEM-12, TEM-29, and TEM-143 ESBLs, were acquired in the class 3

mutants. A D179G substitution was also observed in a class 3 mutant. A BLAST search

of this nucleotide sequence returned 99% homology matches and no TEM enzyme with

this sequence has been named (http://lahey.org/studies/temtable.asp), indicating that

it has not been detected as a naturally-occurring TEM enzyme. Despite not being a key

codon substitution associated with TEM-ESBL expression (294), D179 substitutions do

confer an increase in CAZ resistance (44, 106, 329). Despite this, all amino acid

substitutions at codon 179 result in a marked reduction of ampicillin MIC (329). The

ESBL-conferring R164S, R164H, and R164C mutations are also associated with a trade-

off for penicillinase activity (328), yet recorded ampicillin MICs would still confer

__________________________________________________________________________________________________________________________________________


resistance in vitro and in vivo (44, 329). It is likely that the increased enzymatic trade-

off between the original TEM β-lactamase activity and the acquired TEM-ESBL activity

could account for the lack of D179G TEM enzymes clinically(44).

The blaTEM mutation rates initially calculated (Table 4.5) provided an over-estimation of

the rate that TEM-ESBL mutations are acquired due to the presence of colonies

harbouring non-ESBL-encoding blaTEM. The majority of the mutants demonstrated

blaTEM amplification relative to their progenitors (Table 4.6). Amplification was in

general greater for colonies that did not acquire an ESBL-conferring mutation.

Expression of TEM-1 β-lactamase has been reported to confer a CAZ MIC of 0.25 µg/mL

(44, 328, 329). The increased blaTEM-1 dosage and resulting increased TEM-1 expression

is likely to have conferred resistance to 1.0 µg/mL CAZ in the class 1 and 2 mutants.

CAZ MICs observed for the non-ESBL colonies derived from the mutation rate

experiments ranged from 0.5-2.0 µg/mL (Table 4.6). Isolate 231-22.2-D was the

exception. All mutants analysed from this progenitor had a 1.48 (1.12-1.89) to 2.18

(1.69-2.89)-fold increase in blaTEM dosage irrespective of the presence of an ESBL-

encoding blaTEM gene. Calculated mutation rates for this isolate were higher in

comparison to other isolates tested, and it was hypothesised that a non-β-lactamase-

mediated resistance mechanism, such as porin loss or up-regulation of efflux pumps

(193, 209), or pre-existing blaTEM amplification may have contributed to the CAZ

phenotype of isolate 231-22.2-D mutants. It is likely that isolate 231-22.2-D harboured

the adaptation prior to the mutation rate experiment due to the large number of

colonies observed on all the MH-CAZ plates, and the consistency in phenotype between

mutation rate-derived colonies.

Porins are outer membrane proteins that allow non-specific diffusion of small

molecules into the bacterial cell (12). In K. pneumoniae, the outer membrane proteins

OmpK35 and OmpK36 have been described, along with the quiescent ompK37 (5, 84).

Porins provide a path through the bacterial cell outer membrane for small hydrophilic

antibiotics, such as β-lactams, fluroquinolones, and tetracycline (235). Down-regulation

or the loss of one or both OmpK35 and OmpK36 decreases susceptibility to

antimicrobials; this effect it greater when combined with enzymatic inactivation (234).

Down-regulation or loss of porins in K. pneumoniae strains expressing an ESBL is well

documented, and confers a greater decrease in susceptibility to third-generation

cephalosporins, along with other classes of antibiotics that utilise porins for entry into


the bacterial cell. The down-regulation or loss of porins was not determined in strains

derived from mutation rate culture, however, it cannot be ruled out that porins

contributed to the resistance phenotypes observed in this study. CAZ MICs correlated

well with the TEM-ESBL genotype and blaTEM dosage observed for class 3 mutants.

However the CAZ susceptibility of class 2 and 1 mutants may have in part have been

contributed to by the down-regulation or loss of porins as hypothesised above.

Recently, third-generation cephalosporin susceptibility cut-offs have been lowered, and

the reporting of the presence of an ESBL is no longer necessary (71, 97). The

justification is that the MIC alone is seen as a sufficient predictor of treatment

outcomes, and an ESBL phenotype does not necessarily correlate with treatment failure

(11). In this experimental system, acquisition of an ESBL-conferring blaTEM mutation

yielded phenotypically CAZ sensitive and intermediate mutants (71) (Figure 4.5). This

is consistent with reports that the MIC alone may not detect all ESBL-producers (249).

This is of potential concern because gene amplification may facilitate the high

frequency acquisition of much higher resistance levels when an ESBL-conferring

mutation is present (253). This notion is tested in the following chapter using the

population analysis profile (PAP) approach.

It would be expected that there would be an association between blaTEM promoter

sequence and CAZ MIC (184), particularly in mutants harbouring TEM substitutions

that confer ESBL activity. This was shown to be the case (Figure 4.5). It was observed

that the class 3 mutants demonstrated higher MICs in the presence of a stronger Pa/Pb

or P4 promoter compared to the weak P3 promoter. This finding suggests that the

discrimination of blaTEM promoter variants may be useful for assessing the likelihood of

the acquisition of a cryptic TEM-ESBL mutation. In Chapter 6, the development of a

rapid method for discriminating blaTEM promoters is described.

In conclusion, the rate of acquisition of point mutations giving ESBL variants of TEM

and SHV is in general comparable to the spontaneous mutation rate of a non-mutator

bacterial cell (49). Acquisition of an SHV-ESBL mutation resulted in a CTX-resistant

phenotype in the absence of blaSHV amplification. Acquisition of a TEM-ESBL mutation

did not yield a CAZ resistant phenotype in the isolates tested, demonstrating the

limitations of using just the MIC for determining the presence/absence of antimicrobial

resistance.

__________________________________________________________________________________________________________________________________________


CHAPTER 5 The Contribution of blaSHV and blaTEM Gene

Copy Number Expansion to the Resistance

Phenotype of K. pneumoniae Isolates

5.1 Introduction

The term heteroresistance is used to describe the presence of bacterial subpopulations

with increased antimicrobial resistance compared to the phenotype of the overall

bacterial population (349). Heteroresistance is postulated to be a mechanism which

allows bacterial subpopulations to explore antimicrobial resistance evolution, prior to

acquisition of an antibiotic resistance mechanism by the entire bacterial population

(221). A major research focus involving heteroresistance is the prevalence and

detection of heteroresistant vancomycin-intermediate Staphylococcus aureus (hVISA).

hVISA is believed to be a precursor to development of vancomycin-intermediate

Staphylococcus aureus (VISA) infections, and clinical failure to vancomycin treatment

(21, 59, 171, 220), although the clinical significance of hVISA is disputed (174).

Heteroresistance is not restricted to S. aureus. Vancomycin and teicoplanin

heteroresistance have been observed in Enterococcus faecium strains (4, 173, 271).

Carbapenem heteroresistance has been associated with Enterobacter aerogenes (121),

Acinetobacter baumannii (63, 164, 187, 313), and K. pneumoniae (268, 320). Colistin

heteroresistance was discovered in Enterobacter cloacae (200), A. baumannii (132, 138,

192, 287), and K. pneumoniae clinical isolates (216, 267). Mycobacterium tuberculosis

clinical isolates have demonstrated heteroresistance to fluoroquinolones (57, 327),

isoniazid and rifampicin (145). Helicobacter pylori isolates heteroresistant to

clarithromycin (18, 176), amoxicillin (212), and metronidazole (189), and penicillin

heteroresistance in Streptococcus pneumoniae (221) have also been identified.

The presence of heteroresistant populations is clinically significant, even if only as a

confounder to antimicrobial MIC measurements of a bacterial strain. The MIC profile

and antimicrobial susceptibility of an infectious organism help determine appropriate

antimicrobial therapy. However, the MIC and susceptibility measurements generally


encompass an assumption of population homogeneity. Heteroresistance can therefore

confound such measurements, and methods such as population analysis profile (PAP)

determination have been developed to overcome this.

It is difficult to accurately describe heteroresistance. Current methods to detect

heteroresistance simply identify the presence of a mixed population (195, 280, 334,

349, 355). However, some of the literature suggests an underlying mechanistic basis for

maintenance of a mixed population – that it is not simply a transitional state since a

resistant mutant population is displacing a susceptible precursor (221). Conceivable

mechanisms that could contribute to apparent heteroresistance include a high

frequency transition between susceptible and resistant states analogous to a phase

change, synergism in which resistant cells protect sensitive cells, and resistance

mutations that cause significant loss of fitness when the antibiotic is in low

concentrations or absent (216). Published mechanisms of heteroresistance have not

focussed on these phenomena systematically, but rather have simply sought to identify

heteroresistance-conferring mutations or genes. Reported mechanisms include

mutated penicillin-binding proteins that are responsible for penicillin and ampicillin

heteroresistance in S. pneumoniae and H. pylori, respectively (212, 221), promoter

mutations that result in carbapenem heteroresistance in Acinetobacter spp.(63),

increased KPC-2 expression which leads to meropenem heteroresistance in clinical K.

pneumoniae isolates (268), mixed mutant (Mt) and wildtype (Wt) alleles of the

quinolone resistance-determining region in the gyrA gene confers fluoroquinolone

heteroresistance in M. tuberculosis (57), and polymixin heteroresistance in A.

baumannii forms in response to sub-optimal treatment with polymixins (132).

It is notable that β-lactamase-mediated antibiotic resistance has never been reported

as a mechanism of heteroresistance. High frequency changes in dosage of β-lactamase-

encoding tandem repeats could result in a variable antibiotic resistance phenotype;

therefore genes encoding β-lactamases are likely candidates for heteroresistance. The

existence of low frequencies of resistant subpopulations (i.e. heteroresistance) in

bacterial populations that are genotypically ESBL but susceptible to third-generation

cephalosporins may not be detected in routine susceptibility tests, but would be

expected to facilitate the emergence of a highly resistant population as a response to

selective pressure. Selection of a highly resistant population could result in a number of

clinically significant outcomes including treatment failure resulting in prolonged

__________________________________________________________________________________________________________________________________________


antimicrobial therapy, limited alternative treatment options, and an increased potential

for the dissemination of resistance genes. The crux of this issue is whether ESBL-

expressing cells with relatively low resistance are particularly disposed to evolve into

highly resistant cells, and if so, would they represent a hazard greater than

genotypically ESBL-negative cells with a similar susceptibility?

PAP is often referred to as the ‘gold standard’ method for detecting heteroresistance, at

least in regards to glycopeptide susceptibility in Staphylococci(339). The principal of

PAP is straightforward; aliquots of liquid culture are spread on to agar containing

different concentrations of antibiotic, such that colony forming units can be

counted(35). This reveals whether a population encompasses sub-populations with

different MICs. To our knowledge, there are no published descriptions of PAP

associated with β-lactamase-dependent antimicrobial resistance. Here we explore the

PAP method using β-lactamase expressing cells. The model systems are plasmid-

encoded SHV and TEM enzymes in K. pneumoniae. A distinctive feature of β-lactamase-

mediated resistance is that the enzyme is released into the periplasm of the cell, and

often into the extra-cellular environment(316). Subsequent breakdown of antibiotics in

the culture media benefits cells in the population that are not expressing these enzymes

by providing protection. The well-known phenomenon of satellite colonies arise due to

such growth conditions. Satellite colony formation has the potential to confound PAP

plate counts, because truly resistant colonies can foster the growth of susceptible

colonies by removing the selective agent from the growth media. Our central

hypothesis is that the extracellular location of β-lactamase would cause technical

difficulties with PAP analyses and that once these difficulties were overcome, it would

be possible to demonstrate that ESBL-expressing cells are phenotypically

heteroresistant to third generation cephalosporins.


5.2 Methods


The K. pneumoniae isolates used in this section are listed in Table 5.1. Isolates were

obtained from the PAH, and the SENTRY surveillance program, in the South Africa and

Asia-Pacific regions. Strains cultured during the mutation rate experiments from the

SENTRY isolates (Section 4.3) were used here (Table 5.1). The PAH and SENTRY

isolates have been described previously (128, 150). Isolates and strains were cultured

from glycerol stocks using MH broth and agar. CTX or CAZ was added where described.

5.2.2 PAP Methodology Development

Cells were cultured overnight in 4 mL MH at 37°C with agitation (200 RPM). Ten μL of

culture was used to inoculate 4 mL fresh MH broth containing CTX at the same

concentration as the determined CTX MIC for a given isolate. The broth mixture was

incubated for 24 hours at 37°C with agitation (200 RPM). Following incubation the

culture was diluted 10-4 with physiological saline (0.9% NaCl) and 100 μL aliquots were

plated onto MH agar plates containing 1, 2, 4, 8, 16, 32, 64, and 128 μg/mL CTX. To

determine the number of viable cells, 50 μL of a 10-6 dilution of O/N culture was plated

onto a MH agar plate not containing antibiotics. Following 24 hours incubation at 37°C,

the numbers of colonies were counted on each plate. Only discreet colonies were

counted, and small colonies clumped together on the plates were ignored. CFU/mL at

each antibiotic concentration was calculated, and plotted on a LOG10 scale against

antibiotic concentration. The PAP methodology was further refined by creating a

dilution series (10-2, 10-4, and 10-6) of the O/N culture containing CTX, and plating out

each dilution onto MH agar plates containing 1, 2, 4, 8, 16, 32, 64, and 128 μg/mL CTX.

Further modifications to the PAP methodology included initial culturing at 0.5X MIC,

and plating dilutions on a linear scale of CTX concentration MH agar plates - 0.5 X MIC

and MIC through to 10 μg/mL CTX.

5.2.3 PAP Method Application

Cells were cultured overnight in 4 mL MH at 37°C with agitation (200 RPM). Ten μL of

culture was used to inoculate 4 mL fresh MH broth containing CTX or CAZ at 0.5X MIC.

The broth mixture was incubated for 24 hours at 37°C with agitation (200 RPM).

__________________________________________________________________________________________________________________________________________


Table 5.1 K. pneumoniae isolates and mutation rate-derived strains used for population analysis profile (PAP) analysis.

Studya Isolate Strain from

mutation rate experimentsb

bla gene CT/TZ MIC

(μg/mL) ESBL

phenotypec bla gene copy number

expansiond ESBL-conferring

bla mutatione β-lactamase

PAH A1 - blaSHV 1 Positive - G238S SHV-2a

PAH B1 - blaSHV 1 Positive - G238S SHV-2a

PAH D1 - blaSHV 4 Positive - G238S SHV-2a

PAH E1 - blaSHV 1 Positive - G238S SHV-2a

PAH F1 - blaSHV 1 Positive - G238S SHV-2a

PAH F2 - blaSHV 0.5 Positive - G238S SHV-2a

SENTRY 110 C1 blaSHV 8f,h Positive 0.77 (0.61, 0.97) G238S SHV-2

C2 ≥8f,g Positive 0.90 (0.70, 1.12) G238S SHV-2

C14 0.75 Negative 2.20 (1.73, 2.81) Absent SHV-1

C50 0.5 Negative 1.02 (0.80, 1.33) Absent SHV-1

SENTRY 215-35-A C1 blaTEM 2 Positive 2.69 (2.05, 3.51) D179G Undefined

C54 1 Negative 10.23 (7.76, 13.38) Absent TEM-1

SENTRY 219-08-D C1 blaTEM 1 Positive 10.16 (7.73, 13.45) Absent TEM-1

SENTRY 222-03-C C14 blaTEM 1.5 Negative 20.61 (15.87, 27.00) Absent TEM-1

C17 4 Positive 1.37 (1.02, 1.78) R164C TEM-143

SENTRY 231-22.2-D C17 blaTEM 1 Positive 1.61 (1.23, 2.08) Absent TEM-1

CR1 2 Negative 1.72 (1.31, 2.27) Absent TEM-1

CR15 1f Positive 1.69 (1.29, 2.28) R164S TEM-12

SENTRY 236-20-D C22 blaTEM 6e Positive 4.23 (3.21, 5.57) R164H TEM-29

C30 8e Positive 2.65 (2.01, 3.39) R164S TEM-12

a Isolates were obtained from the Princess Alexandra Hospital (PAH) and the SENTRY surveillance program South Africa and Asia-Pacific region. b SENTRY isolate strains were derived from the mutation rate experiments (sections 4.3.1 and 4.3.2). c ESBL phenotype was determined according to Etest® guidelines (BioMérieux, Marcy I’Etoile, France). d bla gene copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of bla copy numbers of the progenitors and the strains cultured during the mutation rate experiments; empirical 95% confidence intervals determined using error propagation are listed in brackets (blaSHV, section 2.3.7; blaTEM, section 2.3.8). e Kinetic PCR was used to determine the presence of the G238S ESBL-conferring blaSHV mutation (section 2.3.9). blaTEM mutations were identified by blaTEM gene sequencing (section 4.2.5.2) f Satellite colonies observed within the zone of growth inhibition. g Phantom growth inhibition zones observed. h Deformation of the zone of growth inhibition.


Following incubation each culture was diluted 10-3, 10-4, and 10-5 with physiological

saline (0.9% NaCl) and 100 μL aliquots of each dilution were plated onto MH agar

plates containing 0.5X MIC, and MIC through to 10 μg/mL CTX for isolates harbouring

plasmid-borne blaSHV, and 0.5X MIC, and MIC through to 20 μg/mL CAZ for isolates

harbouring blaTEM. To determine the number of viable cells, an aliquot of O/N culture

was diluted 10-6, 50 μL of which was plated onto a MH agar plate containing no

antibiotics. Following 24 hours incubation at 37°C, the numbers of isolated individual

colonies were counted on each plate. CFU/mL at each antibiotic concentration was

calculated, and plotted on a LOG10 scale against antibiotic concentration.

Colonies selected for phenotypic and genotypic analysis were stored as glycerol stocks

in LB broth containing 40% glycerol.

5.2.3.2 PAP area under the curve comparison

PAP area under the curve (PAP-AUC) values were compared to determine if the

population phenotype was statistically significantly different between PAP progenitors.

The number of CFU/mL was plotted against third generation cephalosporin

concentration using GraphPad Prism (La Jolla, CA, USA). A Log10 graph of CFU/mL

versus third generation cephalosporin concentration was generated, from which the

AUC was calculated. Medians of the PAP-AUC values for the non-ESBL- and ESBL-

encoding blaSHV strains, and the non-ESBL- and ESBL-encoding blaTEM strains were then

compared using the Mann-Whitney test. A p-value ≤0.05 was considered significant.


Cefotaxime/cefotaxime + clavulanic acid, or ceftazidime/ceftazidime + clavulanic acid

resistance detection Etest® strips were used to determine the CAZ MIC and ESBL

phenotype for single isolated colonies derived from PAP culture as described in section

2.2.1.

5.2.5 Genotypic Analysis

DNA was extracted from single isolated colonies derived from PAP culture using the

boil method (section 2.3.1). blaSHV or blaTEM dosage relative to the progenitor was

determined by performing blaSHV (section 2.3.7) or blaTEM (section 2.3.8) quantitative

real-time PCR. To determine if bla gene dosages were statistically significantly different

__________________________________________________________________________________________________________________________________________


between groups (as defined in the text), error propagation was used to create empirical

confidence intervals for the relative bla gene copy numbers for each colony derived

from PAP culture (section 2.3.7.1, 2.3.8). The difference between bla gene dosages was

considered statistically significantly different if the 95% empirical confidence intervals

were not overlapping. For isolates harbouring plasmid-borne blaSHV, kinetic PCR was

also performed to detect the blaSHV codon 238 polymorphism (section 2.3.9).

5.3 Results

5.3.1 Initial exploration of PAP methodology for β-lactamase expressing K.

pneumoniae

The experiments described in this section were conducted by Farshid Dakh and Patiyan

Andersson (unpublished data). The aim was to explore the role of blaSHV copy number

plasticity in the evolution of SHV-ESBL activity. It was hypothesised that copy number

heterogeneity of plasmid-encoded blaSHV would result in a heterogeneous CTX

resistance phenotype. This hypothesis was explored initially by analysing the

population structure of two previously described clinical K. pneumoniae isolates F1 and

B1 (128) using PAP. Both isolates harboured ESBL-encoding plasmid-borne blaSHV as

previously determined (150) and expressed an ESBL as determined by Etest® analysis,

yet were clinically sensitive to CTX according to current CLSI breakpoints (71) (Table

5.1). PAP was initially performed using an inoculum density of 106 CFU/mL, and a

logarithmic scale of CTX concentrations in the PAP plates. Two different colony types

were observed (Figure 5.1) - large, morphologically ‘normal’ colonies were scattered

over the PAP plates, and clusters of small, poorly growing colonies seemingly

dependent on the surrounding colonies for growth were also observed for isolate B1.

An elevated CTX MIC and blaSHV dosage relative to the progenitor was observed for the

large colonies derived from PAP culture (Table 5.2). The small clustered colonies did

not demonstrate a stable mechanism (i.e. elevated blaSHV dosage) for growth at elevated

CTX concentrations. It was concluded that the small clustered colonies survived due to

secreted and carry-over β-lactamase on a region of the plate where sufficient inocula

reduced the localised CTX concentration. The mechanism determining the differences

between isolates F1 and B1 resistance remains unknown.


In order to maximise the appearance of countable colonies, a dilution series of each

liquid culture (10-2, 10-4, and 10-6) was plated out at each CTX concentration. This

modified PAP methodology was performed for isolates A1, D1, E1, and F1. Each isolate

demonstrated populations of cells able to grow at CTX concentrations four times higher

than the recorded CTX MIC of the progenitor, and isolate F1 harboured subpopulations

capable of growth at CTX concentrations 16 times higher than the progenitor MIC

(Figure 5.2).

In the previously described experiments, isolates were initially cultured at a CTX

concentrations corresponding to their CTX MIC prior to PAP analysis. It was

hypothesised that culturing at the MIC introduces selective pressure, and therefore PAP

outcomes would be biased. To test this hypothesis, PAP analysis was repeated for

isolates A1 and F1 using culture media containing a CTX concentration of 0.5X the CTX

MIC for each isolate. A linear scale of CTX concentrations in the solid media phase of the

PAP was also introduced as this is the standard PAP methodology (35). PAP results

were consistent with the log scale plating experiments, confirming the presence of a

heteroresistant phenotype for isolates A1 and F1 (Figure 5.3). A reduction in the

number of colonies on the PAP solid media containing a CTX concentration equivalent

to the CTX MIC for each isolate was also observed. This confirms that liquid media

Figure 5.1 Isolate F1 and B1 colony morphology on Mueller Hinton agar plates containing cefotaxime (MH-CTX).

CTX concentrations are written above the plates.

__________________________________________________________________________________________________________________________________________


Table 5.2 Further characterisation of colonies derived from population analysis

profile (PAP) from K. pneumoniae isolates harbouring plasmid-borne blaSHV.

Isolate PAP plate [CTX]

(μg/mL) Colony

Etest® blaSHV copy numberc

CT CTL B1 1 1 4.0b 0.032 -

2 - - 1d

3 - - 1 d

2 1 12a,b 0.047a -

2 - - 1.3 3 - - 0.4

4 1 ≥16 0.19 - 2 - - 0.5 3 - - 0.1 8 1 ≥16a,b 0.047 -

2 - - 0.9 3 - - 0.6 16 1 12a,b 0.047 - 2 - - 1.3

3 - - 0.7

F1 1 1 3.0 0.023 - 2 - - 1 d

3 - - 1 d 2 1 ≥16 0.032 - 2 - - 0.8 3 - - 3.1

4 1 ≥16 0.19 - 2 - - 10.7 3 - - 4.5 8 1 ≥16 0.032 -

2 - - 7.2 3 - - 5.9 16 1 ≥16 0.032 - 2 - - 8.4

3 - - 10.1

a Satellite colonies observed within the zone of growth inhibition. b Phantom zones of growth inhibition observed. c blaSHV copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of blaSHV copy numbers of a colony isolated on the 1.0 μg/mL MH-CTX plate and colonies isolated on >1.0 μg/mL MH-CTX plates (section 2.3.7). d blaSHV copy number normalised to 1.0.

containing a CTX concentration corresponding to the CTX MIC of an isolate introduces

selective pressure, and subsequently bias, into PAP. These results demonstrate that

PAP analyses may be confounded by the appearance of small colonies, and background

growth that is likely due to released β-lactamase (i.e. satellite colonies). Colonies with

increased CTX resistance that are stable enough to be measured using the Etest®

demonstrated an increased blaSHV dosage, so the likely basis for increased CTX

resistance is higher SHV β-lactamase expression.


Figure 5.3 Population analysis profile (PAP) of K. pneumoniae isolates using a linear scale of cefotaxime (CTX) concentrations.

Figure 5.2 Population analysis profile (PAP) of K. pneumoniae isolates using a logarithmic scale of cefotaxime (CTX) concentrations.

__________________________________________________________________________________________________________________________________________


5.3.2 CTX-resistant subpopulations are observed for populations

harbouring plasmid-borne blaSHV

The previous section investigated the contribution of blaSHV copy number plasticity in

the evolution of SHV-ESBL activity in isolates that harbour a plasmid-borne ESBL-

encoding blaSHV gene. Next it was of interest to determine if blaSHV copy number

plasticity confers a heterogeneous CTX phenotype for isolates encoding non-ESBL SHV.

This was achieved by using a relatively isogenic system where PAPs of isolates derived

from isolate 110 expressing either the SHV-2 ESBL or wildtype SHV-1 were compared

(Table 5.1). All strains were derived from 1.0 µg/mL CTX selection during mutation

rate experiments (section 4.3.1). PAP was performed for each strain using 10-3, 10-4,

and 10-5 dilutions of O/N cultures plated onto MH agar containing a linear scale of CTX

concentrations (0.5X MIC, MIC to 10 µg/mL CTX). It was hypothesised that

amplification of ESBL-encoding blaSHV would increase CTX resistance to high levels

readily, whereas amplification of non-ESBL blaSHV genes would have minimal impact on

the CTX-resistance phenotype.

For the isolates derived form 110 encoding non-ESBL SHV, colonies were observed at

0.5, 1.0, 2.0, and 5 μg/mL CTX (Figure 5.4a). Growth at ≥2.0 μg/mL CTX was observed

only for the 110-C50 strain. A CTX MIC twice that of the CTX MIC for the overall

population was observed for a colony derived from PAP culture of strain 110-C14

(Table 5.3). Colonies derived from PAP culture of strain 110-C50 isolated on the

5 μg/mL and 2 µg/mL CTX plates demonstrated CTX MICs of ≥16 µg/mL, CTX MICs of

colonies isolate from the 2.0 µg/mL and 1.0 µg/mL CTX plates were between 1.0-

1.5 µg/mL (Table 5.3). Of the 11 characterised colonies derived during PAP culture

from isolate 110 strains encoding non-ESBL SHV, the two colonies with a ≥16 µg/mL


Figure 5.4 Population analysis profile (PAP) of K. pneumoniae isolate 110 strains harbouring plasmid-borne blaSHV.

A, non-ESBL-encoding strains; B, ESBL-encoding strains. Isolate 110 strains are represented as follows: 110-C14 (dark green), 110-C50 (light green), 110-C1 (purple), and 110-C2 (pink). Different symbols are used to discriminate between replicate PAPs for a given isolate.

__________________________________________________________________________________________________________________________________________


Table 5.3 Further characterisation of colonies derived from population analysis profile (PAP) culture from isolate 110 strains

encoding non-extended-spectrum β-lactamase (ESBL) SHV and SHV ESBL.

Isolate 110 strain derived from mutation

rate experiments

Colony derived from PAP culture

PAP plate [CTX] (μg/mL)

Etest® blaSHV copy numbera

Codon 238 Mutation c

PAP-AUC CT CTL

C1 8d,f 0.064 1b 0.94 67.92

5 2 ≥16e 0.094 9.78 (6.72, 14.03) 2

6 2 ≥16e 0.094 9.99 (6.85, 14.16) 2.19

7 1 ≥16e 0.094 9.48 (6.49, 13.98) 1.93

8 3 ≥16d,e 0.094 15.56 (10.89, 22.03) 1.95

9 3 ≥16e 0.094 5.66 (3.97, 8.22) 1.31

C2 ≥8d,e 0.064 1b 2.01 66.27

5 10 ≥16e 0.064 12.82 (8.95, 18.38) 3.92

6 10 ≥16e 0.064 22.01 (15.24, 31.42) 3.29

7 9 ≥16d,e 0.094 2.14 (1.52, 3.07) 1.83

8 9 ≥16d,e 0.064 11.63 (7.87, 16.36) 3.81

C14 0.75 ≥1 1b 0.02 11.61

1 1 1 ≥1 9.32 (6.46, 13.16) 0.03

2 1 1.5 ≥1 8.75 (6.14, 12.37) 0.04

3 0.5 1 ≥1 10.70 (7.52, 15.47) 0.03

4 0.5 0.75 ≥1 5.58 (3.84, 8.09) 0.03

5 0.5 0.75 0.75 2.62 (1.83, 3.74) 0.03

C50 0.5 0.25 1b 0.04 16.39

1 5 ≥16 0.38 2.37 (1.69, 3.41) 2.11

2 2 ≥16 0.38 1.75 (1.19, 2.47) 2.08

3 1 1.5 ≥1 17.81 (12.28, 25.22) 0.03

4 1 1 ≥1 10.63 (7.59, 15.32) 0.03

5 1 1.5 ≥1 18.77 (12.91, 27.39) 0.04

6 2 1.5 ≥1 9.42 (6.52, 13.92) 0.04

a blaSHV copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of blaSHV copy numbers of the progenitor strains and strains derived from PAP culture; empirical 95% confidence intervals determined using error propagation are listed in brackets (section 2.3.7). b blaSHV copy number normalised to 1.0. c Mutant alleles were quantified using 2ΔCT, where ΔCT = CT(Mutant allele) – CT(Wildtype allele) (section 2.3.9). d Satellite colonies observed within the zone of growth inhibition. e Phantom growth inhibition zones observed. f Deformation of the zone of growth inhibition.


CTX MIC had acquired the G238S mutation (Table 5.3). It is likely that the mutation was

acquired during the solid media phase of PAP as colonies with the same phenotype and

genotype were not observed on the 0.5 and 1.0 µg/mL CTX plates, and no growth was

observed at 3.0 and 4.0 μg/mL CTX. Subpopulations identified at CTX concentrations ≥2

μg/mL for the non-ESBL-encoding blaSHV strains could not be reproduced after

repetition of the PAP method (Figure 5.4a).

Heteroresistance was apparent for the SHV-ESBL-encoding strains 110-C1 and 110-C2

before determining PAPs. Satellite colonies were observed within the zones of growth

inhibition on the Etest® plate (Figure 5.5). At least for strain 110-C1, the presence of a

single satellite colony increased the CTX MIC from 2.0 (the CTX MIC for the overall

population) to 8.0 μg/mL CTX (MIC determined from the position of the satellite

colony). It was hypothesised that the presence of the satellite colony may be stochastic,

and therefore not reproducible. This hypothesis was tested by performing ten Etest®

replicates for strain 110-C1. The single satellite colony was not reproduced, and a

lowering of the CTX MIC from 8.0 to 2.0-4.0 μg/mL was observed (Figure 5.6). It was

concluded that the appearance of colonies within the zones of growth inhibition of an

Etest® can be stochastic, and the isolate phenotype derived from the Etest® results can

be confounded by such growth.

PAPs were determined for the SHV-ESBL-encoding strains 110-C1 and 110-C2. CTX

heteroresistance was observed for both strains by the presence of subpopulations able

to grow at ≤10 µg/mL CTX during PAP analysis (Figure 5.4b). Colonies derived from

PAP culture selected for further phenotypic and genotypic analysis demonstrated MICs

≥16 μg/mL CTX, regardless of the CTX concentration (Table 5.3). It can be concluded

that the isolate 110 strains were heteroresistant to CTX, harbouring subpopulations

with CTX MICs greater than the overall population MIC. However, CTX-resistant

subpopulations were only observed in the presence of the G238S mutation.

To determine if a CTX-heteroresistant phenotype was statistically significantly different

between isolate 110 strains encoding a non-ESBL SHV and a SHV-ESBL, PAP-AUCs were

compared using the Mann-Whitney test (Figure 5.7). PAP-AUCs, a numerical

representation of the overall population phenotype, were calculated from the PAPs of

the isolate 110 strains encoding non-ESBL SHV and SHV-ESBL. A statistically significant

__________________________________________________________________________________________________________________________________________


difference (p=0.03) was observed between the median PAP-AUC values for the non-

ESBL-encoding blaSHV (9.00) and ESBL-encoding blaSHV (67.09) populations. This

further confirmed the significance of the G238S ESBL-conferring mutation in the

acquisition of a CTX-resistant phenotype in K. pneumoniae.

To determine if CTX heteroresistance could be attributed to blaSHV copy number

fluctuations within the overall population, quantitative real-time PCR was used to

determine the blaSHV dosage of isolate 110 colonies derived from PAP culture relative to

their progenitor (Table 5.3). Error propagation was incorporated into the relative gene

copy number calculation to determine empirical 95% confidence intervals. Relative

gene copy numbers were determined to be statistically significantly different if

confidence intervals were not overlapping. blaSHV dosage of 110-C14 strains derived

from PAP culture ranged from a 2.62- (1.83, 3.74) to a 10.70- (7.52, 15.47) fold increase

(Table 5.3). 110-C14-5 had a significantly lower blaSHV dosage compared to the other

four 110-C14 derivatives (Figure 5.8). An ESBL-conferring point mutation was not

acquired by this derivative; however the colony was picked from an area of the plate

where multiple colonies had clustered (Figure 5.9). The combined β-lactamase

Figure 5.5 Cefotaxime (CTX) minimum inhibitory concentrations (MICs) of isolate 110 strains encoding SHV-ESBL.

A, 110-C1; B, 110-C2. CT, cefotaxime. Etest® strip unit of measurement is μg/mL.


Fig

ure

5.6

Rep

rod

uci

bil

ity

of t

he

sate

llit

e co

lon

y o

bse

rved

wit

hin

th

e E

test

® z

on

e o

f gr

ow

th in

hib

itio

n fo

r is

ola

te 1

10

str

ain

C1

.

CT

, ce

fota

xim

e. E

test

® s

trip

un

it o

f m

ea

sure

me

nt

is μ

g/

mL

.

__________________________________________________________________________________________________________________________________________


expression of clustered colonies potentially reduced the localised CTX concentration

sufficiently to allow growth of colonies with a lower blaSHV dosage compared to single

isolated colonies. The derivatives of 110-C50 encoding an SHV-ESBL had statistically

significantly lower blaSHV dosages compared to the non-ESBL-encoding PAP-derivatives

of the same progenitor (Table 5.3) (Figure 5.8). This demonstrates that the acquisition

of a point mutation in blaSHV giving an ESBL enzyme can confer an equivalent, and even

a greater, level of CTX-resistance compared to an increased dosage of a gene encoding a

non-ESBL SHV.

A single strain derived from PAP culture of 110-C2 had a statistically significantly lower

blaSHV dosage compared to the remaining three 110-C2 derivatives, and the five ESBL-

encoding 110-C1 derivatives (Table 5.3) (Figure 5.8). It was observed that 110-C2-7

was morphologically different to the other PAP-derivatives selected for further

genotypic and phenotypic analysis – the colony was markedly smaller, and appeared to

Figure 5.7 Box and whisker plot of population analysis profile-area under the curve (PAP-AUC) values.

PAP-AUC values of strains harbouring bla genes. (NE), non-ESBL-encoding; (E), ESBL-encoding. The bottom and top of each box depicts the lower and upper quartiles of each data set. The median is represented by the line within each box. The lower and upper whiskers terminate at the lowest and highest data point of each data set. p-values are derived from the comparison of blaSHV or blaTEM non-ESBL- and ESBL-encoding PAP-AUC medians using the Mann-Whitney test. An asterisk (*) denotes a statistically significant p-value.


be a satellite colony of the neighbouring larger colony (Figure 5.9). It is likely that β-

lactamase expressed by the neighbouring colony reduced the local concentration of

CTX to enable the survival of 110-C2-7 at 9 µg/mL CTX despite 110-C2-7 harbouring a

lower blaSHV dosage and thus expressing less SHV β-lactamase. The remaining ESBL-

encoding colonies derived from PAP culture did not appear to be satellite colonies. This

could explain the comparatively higher blaSHV dosages observed. It is concluded that

amplification of both non-ESBL and ESBL blaSHV genes can confer a heteroresistant

phenotype. However, CTX resistant subpopulations were only observed for isolates

with an ESBL SHV.

Figure 5.8 Relative blaSHV copy numbers of isolate 110 population analysis profile (PAP)-derivatives.

Dots represent the blaSHV copy number of each derivative relative to a progenitor, as calculated from quantitative real-time PCR data (Section 2.3.7). Empirical 95% confidence intervals are depicted by a vertical line crossing through each data point, terminating with a horizontal line. Empirical confidence intervals are determined using error propagation (Section 2.3.7.1). A red line indicates a relative gene copy number of 1.0.

__________________________________________________________________________________________________________________________________________


5.3.3 Subpopulations with reduced susceptibility to CAZ are influenced by

the blaTEM gene promoter variant

In Section 4.3.2, it was observed that acquisition of a TEM-ESBL mutation does not

always confer a CAZ MIC greater than the susceptibility breakpoint. Acquisition of a

CAZ MIC greater than the susceptibility breakpoint was observed for strains

harbouring a strong blaTEM promoter variant and expressing TEM-ESBL with a high

catalytic efficiency towards CAZ. It was therefore of interest to determine if blaTEM

amplification in the presence of a TEM-ESBL facilitated the acquisition of higher

resistance levels to CAZ. It was hypothesised that the increase in CAZ MIC as an

outcome of an increase in blaTEM dosage would result in CAZ-resistant subpopulations

for isolates encoding a TEM-ESBL. The contribution of the blaTEM promoter sequence to

the increase of CAZ MIC was also investigated. PAP was performed for K. pneumoniae

Figure 5.9 Colony morphology differences between population analysis profile (PAP)-derivatives.

A, PAP-derived colonies harbouring blaSHV; B, PAP-derived colonies harbouring blaTEM. Arrows point to the PAP-derived colonies referred to at the side of each image.


strains derived from the mutation rate experiments that harboured either non-ESBL

encoding or ESBL-encoding blaTEM (section 4.2.5.2) (Table 5.1). Strains harbouring P3,

Pa/Pb, and P4 blaTEM promoters(184) were included. All progenitors had been exposed

to 1.0 μg/mL CAZ during the mutation rate experiments (Section 4). PAP was

performed for each strain using 10-3, 10-4, and 10-5 dilutions of O/N cultures plated onto

MH agar containing a linear scale of CAZ concentrations (0.5X MIC, MIC to 20 µg/mL

CAZ).

Subpopulations adapted to higher CAZ concentrations than the CAZ MIC of the overall

population were observed for all five of the non-ESBL-encoding blaTEM strains (Figure

5.10a). PAP progenitors 215-35-A-C54, 231-22.2-D-C17, and 231-22.2-D-CR1

harboured subpopulations that grew below the CAZ susceptibility breakpoint (≤4

μg/mL) (71). The two remaining non-ESBL-encoding blaTEM progenitors, 219-08-D-C1

and 222-03-C-C14, both harboured subpopulations that grew at ≤5 μg/mL CAZ. The

3.0, 4.0 and 5 μg/mL CAZ subpopulations of strain 222-03-C-C14 were unable to be

resuscitated from glycerol stocks. Colonies were pale in colour, translucent, and had

uneven edges on solid media compared to healthy 222-03-C-C14 colonies observed at

lower CAZ concentrations (Figure 5.9). 222-03-C-C14 colonies isolated at 1.0 and 2.0

μg/mL CAZ had CAZ MICs between 1.0 – 2.0 μg/mL (Table 5.4). Phantom zones of

growth inhibition indicative of ESBL expression were observed after Etest® analysis of

the 219-08-D-C1 derivatives (Table 5.4). blaTEM gene sequence analysis demonstrated

that the 219-08-D-C1 derivatives did not harbour a TEM-ESBL-encoding blaTEM gene. A

plasmid-borne blaSHV gene was not identified using real-time PCR, and the SHV-ESBL-

conferring G238S mutation was not detected using kinetic PCR for the 219-08-D-C1

PAP-derivatives. It is likely that an alternative bla gene (e.g. blaOXA) is present in these

derivatives, resulting in the expression of an ESBL that is not a TEM or SHV enzyme.

Greater variation in subpopulation CAZ susceptibilities were observed for the TEM-

ESBL-encoding progenitors. Subpopulations that grew above the CAZ susceptibility

breakpoint (≤4 μg/mL) (71) were observed for 4/5 the TEM-ESBL-encoding

progenitors (Figure 5.10b). All four progenitors harboured stronger blaTEM promoters

(Pa/Pb or P4) compared to 231-22.2-D-CR15, which harboured the P3 blaTEM promoter,

and subpopulations that grew only below the CAZ susceptibility breakpoint. Following

on

__________________________________________________________________________________________________________________________________________


Figure 5.10 Population analysis profile (PAP) analyses of K. pneumoniae strains harbouring blaTEM.

A, non-ESBL-encoding strains; B, ESBL-encoding strains. Symbols depict the blaTEM promoter genotype: P3 (circle), Pa/Pb (triangle), P4 (square). blaTEM strains are represented as follows: 215-35-A-C54 (khaki), 219-08-D-C1 (red), 222-03-C-C14 (brown), 231-22.2-D-C17 (purple), 231-22.2-D-CR1 (orange), 215-35-A-C1 (dark blue), 222-03-C-C17 (dark green), 231-22.2-D-C15 (light green), 236-20-D-C22 (aqua), 236-20-D-C30 (light blue).


Table 5.4 Further characterisation of colonies derived from population analysis profile (PAP) culture from strains encoding non-extended spectrum β-lactamase (ESBL) TEM and ESBL TEM.

Isolate Progenitor Derived colony

Plate [CAZ] (μg/mL)

Etest® blaTEM copy numbera

PAP-AUC TZ TZL

215-35-A C1 2 0.094 1b 46.95

4 6 8 0.094 1.20 (0.88, 1.71)

6 6 4 0.094 1.50 (1.04, 2.06)

7 4 3 0.094 0.97 (0.68, 1.37)

8 4 3 0.094 1.52 (1.10, 2.14)

C54 1 0.25 1b 16.44

3 1 1.5 0.094 0.72 (0.51, 0.99)

4 1 0.75 0.125 0.90 (0.62, 1.29)

5 2 1.0 0.19 1.26 (0.92, 1.76)

6 2 1.5 0.25 0.39 (0.28, 0.55)

219-08-D C1 1 0.064c 1b 35.12

1 5 6d 0.064 1.09 (0.78, 1.52)

3 5 6d 0.064 0.3 (0.21, 0.42)

4 5 3d 0.064 0.39 (0.28, 0.54)

5 4 2e 0.064 0.64 (0.45, 0.89)

6 3 4d 0.094 0.76 (0.56, 1.07)

7 3 2e 0.064 0.41 (0.29, 0.57)

8 2 2e 0.064 0.68 (0.49, 0.93)

9 2 2e 0.064 0.49 (0.35, 0.69)

222-03-C C14 1.5 0.25 1b 35.63

4 2 2 0.19 1.13 (0.83, 1.60)

6 2 1 0.19 1.12 (0.81, 1.55)

7 1 1.5 0.25 1.84 (1.31, 2.59)

C17 4 0.5c 1b 54.63

8 7 3 0.25 2.57 (1.92, 3.65)

9 4 4 0.38 1.25 (0.91, 1.75)

10 5 4 0.25 0.81 (0.59, 1.13)

11 6 4 0.25 0.95 (0.66, 1.30)

231-22.2-D C17 1 0.125 1b 25.64

2 3 2 0.25 0.91 (0.67, 1.26)

3 3 1.5 0.064 0.95 (0.67, 1.33)

4 2 1.5 <0.064 1.23 (0.87, 1.70)

5 2 1.5 <0.064 0.98 (0.71, 1.36)

6 2 1 <0.064 1.12 (0.79, 1.55)

CR1 2 0.25 1b 25.28

1 3 2 0.125 0.89 (0.63, 1.21)

2 2 1.5 <0.064 0.83 (0.60, 1.19)

3 2 2 0.125 0.86 (0.61, 1.20)

4 3 1.5 <0.064 0.84 (0.59, 1.14)

CR15 1e 0.19 1b 21.76

6 2 1e <0.064 0.98 (0.71, 1.36)

7 2 1e 0.064 0.82 (0.58, 1.14)

8 1 1e 0.064 0.91 (0.67, 1.26)

236-20-D C22 6d 0.064 1b 126.94

5 18 12 0.125 1.37 (0.95, 1.90)

6 16 12 0.125 1.41 (0.99, 1.99)

7 14 12d 0.064 1.45 (1.03, 1.98)

8 14 8d 0.064 2.45 (1.72, 3.40)

C30 8d 0.064 1b 154.37

5 20 8d 0.064 0.76 (0.53, 1.04)

6 19 ≥32 0.19 1.82 (1.28, 2.54)

7 15 8d 0.064 0.91 (0.64, 1.28)

8 17 24d 0.125 1.24 (0.88, 1.77) a blaTEM copy numbers were calculated with reference to 16S rDNA and are represented as an arithmetic ratio of blaTEM copy numbers from progenitor strains and strains derived from PAP culture; 95% confidence intervals determined using error propagation are listed in brackets (section 2.3.8). b blaSHV copy number normalised to 1.0. c Satellite colonies observed within the zone of growth inhibition. d Phantom growth inhibition zones observed. e Deformation of the zone of growth inhibition.

__________________________________________________________________________________________________________________________________________


from findings in Chapter 4, it seems that despite encoding a TEM-ESBL, a stronger

promoter is required for the acquisition of a CAZ MIC greater than the CAZ

susceptibility breakpoint. It was concluded that a CAZ heteroresistant phenotype does

not depend on the presence of an encoded TEM-ESBL. However, only for progenitors

encoding TEM-ESBL were subpopulations able to grow at CAZ concentrations above

the current CLSI susceptibility breakpoint observed.

To determine if the observed CAZ heteroresistant phenotypes were different in the

presence of a TEM-ESBL, PAP-AUCs of the non-ESBL- and ESBL-encoding strains were

compared using a Mann-Whitney test (Figure 5.7). No statistically significant difference

(P=0.10) was observed between PAP-AUC medians of the non-ESBL-encoding (25.64)

and ESBL-encoding (54.63) blaTEM strains. The absence of a statistically significant

difference is likely attributed to the observed PAP-AUC variation for the progenitors

encoding TEM-ESBL; ranging from 21.76 to 154.37 (Table 5.4). Such variation was not

present for the progenitors encoding non-ESBL TEM, with a PAP-AUC range of 16.44 to

35.63.

It was hypothesised that the observed PAP-AUC variability between strains expressing

a TEM-ESBL was due to blaTEM promoter and blaTEM genotype variations between

strains (Table 5.1). It was observed that for strains expressing a TEM-ESBL, the PAP-

AUC was larger in the presence of stronger promoters (Figure 5.11) (Table 5.4). In the

absence of a TEM-ESBL, this effect was not observed. For strains expressing a TEM-

ESBL, PAP-AUCs were also observed to be larger in strains expressing a more efficient

TEM-ESBL (Figure 5.11) (Table 5.4). These findings demonstrate that the blaTEM

promoter variant and blaTEM genotype are both important determinants of CAZ

resistance in bacterial populations, as represented by the PAP-AUC values.

The role of blaTEM amplification in the expression of a CAZ heteroresistant phenotype

was next investigated. Quantitative real-time PCR was used to determine the blaTEM

dosage of derivatives relative to their progenitor (Table 5.4). Relative to their

respective progenitors, derived strains demonstrated limited blaTEM amplification

(Figure 5.12). Based on confidence interval overlap, the following observations were

made: derivative 6 of isolate 215-35-A-C54 harboured a statistically significantly lower

blaTEM dosage compared to two of the three remaining 215-35-A-C54 derivatives;


Figure 5.11 The correlation between population analysis profile-area under the curve (PAP-AUC) values and blaTEM promoter sequence.

Data points represent PAP-AUC of each isolate. Isolate PAP-AUCs are grouped by whether they encode a TEM-ESBL or TEM-1. blaTEM promoter variants are denoted by the symbols outlined in the key. The expressed TEM enzyme is noted to the right of each PAP-AUC data point.

derivative 8 of isolate 222-03-C-17 harboured a statistically significantly higher blaTEM

dosage than the three remaining 222-03-C-17 derivatives; derivative 6 of isolate 236-

20-D-30 harboured a statistically significantly higher blaTEM dosage than derivatives 5

and 7. The most variation in blaTEM dosage was observed between 219-08-D-C1

derivatives (Figure 5.12). All derivatives demonstrated blaTEM copy number reduction,

which is consistent with the hypothesis that isolate 219-08-D-C1 is expressing a non-

TEM and non-SHV ESBL. Further investigation into the mechanism of CAZ resistance in

isolate 219-08-D-C1 was not made. Overall, it was observed that there was no

statistically significant difference in blaTEM dosage between non-ESBL and ESBL-

encoding strains.

It was concluded that an increase in CAZ MIC was a function of the catalytic efficiency of

the encoded TEM-ESBL, and the blaTEM promoter variant. Heteroresistant phenotypes

were observed for isolates harbouring blaTEM, but were not attributed to blaTEM

amplification. The findings here demonstrate that the blaTEM promoter variant and

__________________________________________________________________________________________________________________________________________


Figure 5.12 Relative blaTEM copy numbers of population analysis profile (PAP)-derived strains encoding TEM.

Dots represent the blaTEM copy number of each derivative relative to a progenitor, as calculated from quantitative real-time PCR data (Section 2.3.8). Empirical 95% confidence intervals are depicted by a vertical line crossing through each data point, terminating with a horizontal line. Empirical confidence intervals are determined using error propagation (Section 2.3.8.1). A red line indicates a relative gene copy number of 1.0.

blaTEM genotype are both important determinants of an isolate’s ability to acquire TEM-

ESBL-mediated resistance to CAZ.

5.4 Discussion

Plasmid-borne blaSHV is derived from a limited number of mobilisations from the K.

pneumoniae chromosome(103). Mobilisation events were facilitated by insertion

sequence IS26, creating compound transposon structures which enable plasmid-borne

blaSHV amplification. Variant promoters stronger than the chromosomal blaSHV

promoter are associated with plasmid-borne blaSHV (260, 325). It is likely that ESBL-

encoding blaSHV genes are encountered frequently on plasmids due to stronger


promoters providing sufficient gene expression, and gene multimerisation allowing

adaptation to increasing selective pressure. The genetic environment and genotype of

blaTEM genes demonstrates a similar impact on resistance phenotype. blaTEM has no

known chromosomal origin and therefore is harboured on plasmids, being frequently

located on transposons (133, 135, 178). Sequence variation in the blaTEM promoter

impacts on the promoter strength, thereby influencing TEM-expression(184). Evolution

of resistance to new β-lactam antibiotics has occurred through mutation of existing β-

lactamases, leading to an increased range of catalytic activities for these enzymes

(www.lahey.org/studies) (198, 252).

A well-described outcome of antibiotic-mediated selective pressure is the increase in

copy number of the corresponding resistance gene. Amplification of plasmid-borne

resistance genes commonly occurs via the homologous recombination pathway,

utilising sequences with shared homology that flank resistance genes (67, 163, 250,

251). Most often the homologous flanking sequences are directly-repeated insertion

sequences. There are continuing reports of bla gene amplification that result in reduced

susceptibility to β-lactam antibiotics. Xiang et. al., (1997) first described the

amplification of plasmid-borne blaSHV-5 in K. pneumoniae isolates demonstrating a

hyperproduction of the SHV-5 β-lactamase (352). The genetic context of amplified

blaSHV-5 was elucidated when tandem repeats of blaSHV-5 flanked by IS26 were

discovered after sequencing the Escherichia coli plasmid p1658/97 (356). Garza-Ramos

et. al., (2009) also reported the tandem duplication of IS26-flanked blaSHV-5 on a plasmid

in an E. cloacae nosocomial-outbreak strain (110). blaTEM-1 amplification was reported

in Salmonella typhimurium strains after selective pressure with first- and second-

generation cephalosporins (312). Tandem repeating units were strain-dependent,

formed by utilising either the flanking IS3 elements or Rep sequences. Duplication of

blaOXA-2 has been implicated in decreased ampicillin susceptibility of P. aeruginosa

strains (317), and carbapenem resistance associated with blaOXA-58 amplification was

observed in A. baumannii (37). More recently, reduced susceptibility to β-lactam

antibiotics was described in E. coli isolates harbouring duplicated blaCMY-2 (182).

There is a linear relationship between resistance to β-lactam antibiotics and the

amount of β-lactamase expressed by a bacterial isolate (237). Since bla gene dosage is

one of many molecular mechanisms that influence the amount of β-lactamase

expressed by a bacterial cell, bla gene copy number heterogeneity would result in

__________________________________________________________________________________________________________________________________________


variable β-lactamase expression within a given bacterial population. The presence of

subpopulations of cells with decreased susceptibility to an antibiotic compared to the

overall population antibiotic MIC is commonly referred to as heteroresistance (99, 282,

323). This section explored the contribution of blaSHV and blaTEM gene copy number

heterogeneity to the formation of heteroresistant K. pneumoniae populations.

Heteroresistance was observed for the majority of the strains screened here, with

greater population MIC variation observed for those strains harbouring ESBL-encoding

bla genes.

Heteroresistance has been associated predominantly with the presence of mutations

within resistance genes or their promoters (57, 63, 212, 221). To our knowledge,

resistance gene amplification has not been implicated previously in heteroresistance.

blaSHV amplification facilitated the adaptation of K. pneumoniae strains to CTX

concentrations greater than the overall population MIC. These findings are consistent

with previously reported CTX-induced blaSHV copy number expansion (127, 352). blaSHV

amplification had a greater impact on the population CTX resistance phenotype for

strains harbouring ESBL-encoding blaSHV than in the absence of the SHV-ESBL-

conferring G238S mutation. The SHV-1 β-lactamase has low catalytic activity against

third-generation cephalosporins (213), and in strains harbouring non-ESBL-encoding

blaSHV the presence of subpopulations able to grow at elevated CTX concentrations was

limited despite blaSHV amplification. Acquisition of the ESBL-conferring G238S mutation

expands the SHV β-lactamase spectrum of activity to include third-generation

cephalosporins (161), and for the SHV-ESBL-encoding progenitors, blaSHV amplification

was observed in subpopulations with MICs greater than the current CLSI CTX-resistant

breakpoint value. A statistically significant difference between the population

phenotypes of the SHV β-lactamase- and SHV-ESBL-encoding strains indicated that

blaSHV amplification provides a significant contribution to CTX-resistance expansion in

the presence of a plasmid-borne ESBL-encoding blaSHV gene.

Heteroresistant phenotypes were observed in the majority of the K. pneumoniae strains

harbouring blaTEM. Heteroresistance in these strains was attributed to blaTEM

amplification prior to PAP, and blaTEM promoter variant and blaTEM genotype. A further

increase in blaTEM dosage was rare in the derived colonies for both non-ESBL- and

ESBL-encoding blaTEM strains. These strains harboured the previously described P3,

Pa/Pb, or P4 promoter sequences(184). Pa/Pb and P4 promoter variants are


discriminated from the P3 promoter sequence by polymorphisms in the -35 and -10

boxes of the blaTEM promoter region. These polymorphisms create -35 and -10

sequences closer to the consensus sequence, thereby increasing the strength of the

blaTEM promoter. Both Pa/Pb and P4 are stronger promoters than P3, and P4 alone is

stronger than Pa/Pb(184). Mutations at several blaTEM codon positions are commonly

associated with TEM-ESBL (www.lahey.org/studies). Site directed mutagenesis of

blaTEM genes has revealed that both the position of the mutation, and the specific amino

acid at a given position affect catalytic activity and efficiency of the TEM-ESBL enzyme

for a given third-generation cephalosporin (38, 328). For a given strain, the strength of

the promoter and the TEM-ESBL catalytic activity together determine the extent to

which subpopulations could grow at CAZ concentrations higher than the overall

population’s MIC for strains harbouring ESBL-encoding blaTEM. Despite the lack of

blaTEM amplification in the majority of the ESBL-encoding derivatives, the contribution

of amplified blaTEM prior to PAP cannot be dismissed. It is likely that blaTEM

amplification observed in progenitor strains prior to PAP facilitated the growth of

subpopulations at CAZ concentrations higher than the overall population MIC. The

minimal contribution of stronger promoter sequences on the population resistance

phenotype of the non-ESBL-encoding blaTEM strains was interesting. Similar to blaSHV, it

seems that evolution to decreased CAZ susceptibility involves blaTEM being present on

an amplifiable structure, in addition to a promoter mutation and an ESBL-conferring

blaTEM point mutation.

It has been hypothesised that gene amplification facilitates the evolution of new

functions in pre-existing genes (36). Acquisition of point mutations occur at a much

lower frequency than gene amplification events; however gene amplification can

facilitate the acquisition of a beneficial mutation by providing multiple gene targets

(36). Expansion of non-ESBL-encoding blaSHV dosage could have facilitated the

acquisition of the G238S point mutation in a single strain during PAP. It is interesting to

note that colonies harbouring G238S demonstrated a lower blaSHV copy number than

non-mutant colonies from the same strain. Relaxation of selective pressure or

acquisition of a genetically more stable mutation can result in a loss of amplified

resistance genes (312). Gene amplification as an intermediate ampicillin resistance

mechanism prior to acquisition of more stable chromosomal mutations that decrease

porin expression was recently observed for blaTEM-1 in S. typhimurium strains (312).

The instability of gene amplifications means that the presence of high bla gene dosages

__________________________________________________________________________________________________________________________________________


in the absence of selective pressure is unlikely. However, prolonged selective pressure

may facilitate the acquisition of ESBL mutations, which is concerning.

The clinical implications of the findings of this study are unclear. Using mouse thigh

models of Enterobacteriaceae infection, Andes et. al., (2005) demonstrated that the

relationship between the efficacy of third generation cephalosporins and percentage

time that the in vivo concentration of free cephalosporin exceeded the MIC, is

independent of ESBL expression (11). This suggests that the measured MIC is the

appropriate guide to clinical practice and heteroresistance is clinically not significant.

However, mouse thigh experiments are generally 24 hours in duration, potentially an

insufficient time period for selection and amplification of resistant subpopulations. The

question as to whether the measured β-lactam MIC always equates to the in vivo MIC

for Enterobacteriaceae infecting humans remains to be fully resolved.

This study has also shed some light on the basis for the “inoculum effect”. The inoculum

effect describes the relationship between MIC and inoculum density (50), and is often

associated with β-lactamase-expressing organisms (29, 54, 120, 272, 307, 322). The

most commonly described inoculum effect mechanism is the transfer of free

β-lactamase into the growth medium along with the inoculum. The β-lactam is

degraded by both the β-lactamase expressed by the culture and carry-over β-lactamase

(272, 322). Our results suggest that the observed inoculum effect is due to two distinct

mechanisms – the commonly accepted one, and also genuine heteroresistance. A larger

inoculum will have a higher probability of containing cells that over-express the SHV-β-

lactamase because of blaSHV amplification. Cells that grow due to carry-over β-lactamase

do not have measurably increased β-lactam MIC values, and tend to grow very poorly in

clumps on the selective solid media. In contrast, cells with increased blaSHV dosage have

increased β-lactam MIC values stable enough to measure using the Etest®, and are able

to form colonies of normal morphology on selective solid media. Isolates B1 and F1

behaved very differently on the selective media, with B1 producing entirely the “small

clumpy” colony phenotype, and F1 producing mainly colonies of normal morphology

(Figure 5.1). It can be seen that B1 appeared to yield more colonies, and it is possible

that this indicates a very high carry over of β-lactamase, resulting in small colonies

completely obscuring potential colonies of normal morphology. It is also possible that

B1 is not heteroresistant in the same way as F1, i.e. it does not give rise to blaSHV copy

number variants at a high frequency.


In conclusion, this study has demonstrated that the process of MIC determination is

straightforward; however it can be confounded by two distinct factors - bla copy

number plasticity, and carry-over of β-lactamase activity. With the ESBL expressing

isolates in this study, CTX MIC is almost impossible to define meaningfully and the

relevant bacterial strains may be regarded as heteroresistant to CTX. blaTEM-associated

CAZ heteroresistance appears to be more variable than that observed for blaSHV-

associated CTX heteroresistance. Promoter strength and the catalytic efficiency of the

encoded TEM β-lactamase also contribute to the CAZ MIC of the population. The high

frequency of copy number variation supports the practice of not differentiating

between “ESBL expressing low MIC” isolates and “ESBL expressing high MIC” isolates

when making clinical decisions regarding antibiotic use.

__________________________________________________________________________________________________________________________________________


CHAPTER 6 Discriminating blaTEM Promoter Variants Using

High Resolution Melt Analysis

6.1 Introduction

Our lab (127, 128) and the findings from previous chapters show that high expression

of a non-extended spectrum β-lactamase likely means that the relevant strain can

acquire an ESBL phenotype as a result of a single base change in the bla coding region.

Conversely, strains with a weak promoter driving expression of a non-extended

spectrum β-lactamase may present a lower clinical risk when challenged with an

extended spectrum cephalosporin, because the same single base change in the coding

region may fail to confer an ESBL phenotype. Therefore rapid bla promoter

identification to discriminate between these possibilities may be beneficial in the

clinical setting.

High resolution melt (HRM) analysis is an emerging technique used to discriminate

DNA sequence variants. HRM analysis is based on accurate determination of the

relationship between temperature and the extent of dissociation of a PCR amplicon

(283). HRM analyses are almost performed universally in real-time PCR thermocyclers

post-PCR. This assay format is rapid, cost effective, and single step/closed tube (126).

HRM analysis is a development from amplimer Tm determination protocols for

validation of amplimer identity. Such protocols were commonly performed in the first

generation of real time PCR devices, and they required dyes such as SYBR® Green I that

only fluoresce when bound to double stranded nucleic acid. In such methods, the Tm is

the peak of the first derivative of the melting curve. This represents the steepest point

of the melting curve.

HRM analysis, as usually understood, differs from conventional Tm determination in

two ways. First, the temperature control is very accurate, with temperature increments

as small as 0.01°C used. Second, saturating dyes such as LCGreen® Plus+ are used.

Saturating dyes differ from non-saturating dyes, such as SYBR® Green I, in that they


may be added to a high enough concentration to saturate all the binding sites in a PCR

amplicon without inhibiting the PCR. Saturating dyes provide superior ability to resolve

sequence variants as compared to non-saturating dyes (345). The reasons for this are

not fully understood, but seem to involve the potential for non-saturating dyes to

redistribute themselves in the amplimer during the melting process. Interestingly,

saturating dyes are particularly effective for detecting heterozygous alleles (345).

Discrimination of sequence variants between amplimers can encompass both

homozygous variants, and the detection of heterozygous alleles within a single sample.

Homozygous variants generally differ in Tm, which changes the position of the melt

curve on the x-axis (temperature). Heterozygous alleles form heteroduplexes, which

melt at lower temperatures than homoduplexes. Heterozygous samples harbor two

heteroduplex and two homoduplex amplimers, which upon melting change the shape of

a melt curve by creating a slower melting transition or introducing multiple melting

transitions (multiple melting domains) (194, 345). The discriminatory power of HRM is

also dependent on the length of the amplimer, whereby sequence variants are more

easily discriminated in shorter amplimers (126). The %GC content of amplimers also

affect discrimination of homozygous and heterozygous samples. A homozygous SNP

will result in a greater Tm shift if the SNP changes the %GC content of the amplimer

relative to the Wt control. For heterozygotes, melt curve shape changes are more

observable when alleles differ in %GC content.

In summary, very accurate temperature control and the use of saturating dyes provide

curves suitable for model-free comparison on the basis of shape, rather than

comparison only on the basis of the calculated Tm(345).

Applications of HRM in clinical diagnostics are numerous. Specifically relevant to this

study is the development of assays to rapidly identify microbial pathogens (92, 153,

207, 226, 318, 347) and to detect SNPs that confer a decrease in antimicrobial

susceptibility (10, 108, 144, 258, 274, 324, 346). In this study, a HRM assay was

developed to discriminate P3, Pa/Pb and P4 blaTEM promoter variants. Four

mastermixes encompassing three different dsDNA fluorescent dyes were trialled to

determine which provided the highest discriminatory power (Table 6.1). Clinical

K. pneumoniae isolates with known blaTEM promoters were analysed. Stronger blaTEM

__________________________________________________________________________________________________________________________________________


Table 6.1 Real-time PCR and HRM Mastermixes used for TEM_Pr HRM analysis.

Manufacturer Mastermix dsDNA

Intercalating Dye

Dye

Saturation

Normalisation

regions (°C)

Invitrogen Platinum® SYBR®

Green qPCR

Supermix-UDG

SYBR® Green I Non-saturating 73.31-74.51

81.50-82.70

Bioline SensiMix™ SYBR®

NoRef

SYBR® Green I Non-saturating 76.29-77.49

81.92-83.21

TrendBio HRM Mastermix LCGreen® Plus+ Saturating 77.80-79.00

85.99-87.19

Bioline SensiMix™ HRM

Mastermix

EvaGreen® Saturating 72.31-73.51

80.50-81.70

promoter alleles present at a low frequency may be masked by weaker promoters at a

high frequency in a given isolate. Therefore discrimination of samples harbouring

stronger promoter alleles in minority from samples that have a pure blaTEM promoter

genotype was also explored.


6.2 Methods


Clinical K. pneumoniae isolates used were from the SENTRY surveillance program Asia-

Pacific region and South Africa, and are listed in Table 6.2. The isolates were stored

frozen in glycerol and routinely cultured on MH agar. Total genomic DNA was prepared

by boiling lysis as described in section 2.3.1.

6.2.2 Characterisation of blaTEM promoter types for individual isolates

The TEM_PrF and TEM_PrR primers (Section 4.2.2) were designed to amplify a 227bp

DNA fragment that included the entire blaTEM promoter region (Figure 6.1) and

encompassed known polymorphic sites (184). The primer sequences and their

positions are shown in Figure 6.1. PCR reactions and cycling conditions were as

described in section 4.2.2. The TEM_Pr amplicons were purified and sequenced at

Bioscience North Australia and Macrogen Inc. as described in section 2.3.5.

6.2.3 Preparation of Spiked Template DNA

blaTEM promoter variant controls were prepared from 1 μL template DNA (diluted 1:10

in ddH2O) for the P3 promoter (isolate 36), Pa/Pb promoter (isolate 1), and the P4

promoter (isolate 236-20-D). P3-Pa/Pb mixed template samples were prepared by

mixing P3 control template with Pa/Pb control template to create 50%, 20%, 10%, 5%

and 2% Pa/Pb template samples in a P3 background. P3-P4 and Pa/Pb-P4 samples were

prepared by mixing each of P3 and Pa/Pb control template with P4 control template to

create 50%, 20%, 10%, 5% and 2% P4 template in a P3 (P3-P4) and Pa/Pb (Pa/Pb-P4)

template background, respectively.

6.2.4 HRM protocol using Invitrogen Platinum® SYBR® Green qPCR

Supermix-UDG Mastermix

HRM was performed on the Corbett RotorGene 6000 real-time thermocycler (QIAGEN,

Hilden, Germany). Reactions contained 5 μL Platinum® SYBR® Green qPCR Supermix-

UDG (Invitrogen, Carlsbad, California, USA), 0.5 μM each of TEM_PrF and TEM_PrR, 1 μL

template DNA (diluted 1:10 in ddH2O), and were made up to a final volume of 10 μL

using ddH2O for individual isolates. P3 and Pa/Pb promoter controls and a NTC were

__________________________________________________________________________________________________________________________________________


Table 6.2 blaTEM promoters in the K. pneumoniae clinical isolates.

Isolate TEM_Pr PCR amplicon blaTEM promoter 1 227 bp Pa/Pb

2 227 bp Pa/Pb

3 227 bp P3

20 227 bp P3+Pa/Pba 23 227 bp P3+Pa/Pb + second mixed alleleb,c 33 227 bp P3

36 227 bp P3

211-32-C 227 bp P3

215-28-A 227 bp P3

215-35-A 227 bp P4

219-07-A 227 bp P3

219-08-D 227 bp P3

221-38-C 227 bp Pa/Pb

222-03-C 227 bp Pa/Pb

224-48-C 227 bp P3

231-22.2-D 227 bp P3

232-21-C 227 bp P3

236-03-C 227 bp P3

236-07-C 227 bp P4

236-20-D 227 bp P4

237-21-C 227 bp P3

237-24-C 227 bp P3

237-49-C 300 bp P3 + insertionc 238-02-A 227 bp P3

238-15-A 227 bp P3+Pa/Pb 252-19-A 227 bp P3

256-06-A 227 bp Pa/Pb

a Mixed P3 and Pa/Pb blaTEM promoter alleles are recorded as P3+Pa/Pb. b A second mixed C/T allele at bp 54 of the TEM_Pr amplicon was identified on the sequencing traces. c The blaTEM promoter sequence of isolates 23 and 237-49-C is shown in Figure 6.1.


-10 Pb

-35 Pa-35 Pb

-10 Pa

-35 P3 -10 P3

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

P3 TGCTCATCAGCTCAGTATTGCCCGCTCCACGGTTTATAAAATTCTTGAAGACGAAAGGGCCTCGTGATACGCCTATT---------------------------------

Pa/Pb ........................................................................T....---------------------------------

P4 .............................................................................---------------------------------

P3+Pa/Pb ........................................................................Y....---------------------------------

Isolate 23 .....................................................R..................Y....---------------------------------

Isolate 237-49-C .............................................................................TGGCTCTGTTGCAAAGATTGGCGACAGCCTACC

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|

P3 --------------------------------------TTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGG

Pa/Pb --------------------------------------........................................................................

P4 --------------------------------------........................................................................

P3+Pa/Pb --------------------------------------........................................................................

Isolate 23 --------------------------------------........................................................................

Isolate 237-49-C TTTGACTGCCGCCAATCTTTGCAACAGAGCCGCCTATT....................................K........................R..........

....|....|....|....|....|....|....|....|....|....|....|....|....|....|....|...

P3 AACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCA

Pa/Pb ..............................................................................

P4 .....................................................T........................

P3+Pa/Pb ..............................................................................

Isolate 23 ..............................................................................

Isolate 237-49-C ..............................................................................

1

Lower Tm

melting domain

__________________________________________________________________________________________________________________________________________


Figure 6.1 blaTEM promoter variants observed for the clinical K. pneumoniae isolates.

Grey bars indicate the -35 and -10 boxes of the Pa/Pb and P3 promoter regions. Matching sequence is denoted by dots (.). Non-matched sequence is indicated by a nucleotide letter in the relevant position. Mixed alleles are denoted by the single letter code for the mixed nucleotide. Sequence gaps are denoted by a dash (-). TEM_Pr primer sequences are enclosed in orange boxes. The number ‘1’ on the sequence alignment indicates Sutcliffe position 1 (314). The lower Tm melting domain is indicated by a purple bar, while the remaining amplicon sequence makes up the higher Tm melting domain (section 6.3.5). blaTEM promoter sequences were obtained from the following: P3 (GenBank accession: FJ790886), Pa/Pb (GenBank accession: EU527189), P4 (GenBank accession: AM941159).


included in every run. Cycling conditions were as follows: 50°C for 2min, 95°C for 2min,

45 cycles of: 95°C for 10s, 60°C for 30s, 72°C for 30s; followed by 50°C for 20s, HRM

(70-95°, 0.1°C increments). Fluorescence was acquired to channel green during the

extension step of real-time PCR cycling, and during the HRM. All reactions apart from

the NTC were performed in duplicate.

6.2.5 HRM protocol using Bioline SensiMix™ SYBR® NoRef

HRM was performed on the Corbett RotorGene 6000 real-time thermocycler (QIAGEN).

Reactions contained 1 X SensiMix™ SYBR® NoRef (Bioline, London, UK), 1 X SYBR®

Green I solution (Bioline), 0.5 μM each of TEM_PrF and TEM_PrR, 1 μL template DNA

(diluted 1:10 in ddH2O), and were made up to a final volume of 10 μL using ddH2O.

Reactions were performed in duplicate for individual isolates. P3 and Pa/Pb promoter

controls (isolates 36 and 1 respectively) and a NTC were included in every run.

Optimised cycling conditions were as follows: 50°C for 2 min, 95°C for 5 min, 45 cycles

of: 95°C for 10s, 60°C for 30s, 72°C for 30s; followed by 50°C for 20s, HRM (70-95°,

0.1°C increments). Acquisition to channel green was performed during the extension

step of real-time PCR cycling, and during the HRM. All reactions apart from the NTC

were performed in duplicate.

6.2.6 HRM protocol using TrendBio HRM Master Mix containing LCGreen®

Plus+


Reactions contained 4 μL TrendBio HRM Master Mix containing LCGreen® Plus+ (Idaho

Technologies Inc., Utah, USA), 0.25 μM each of TEM_PrF and TEM_PrR, 1 μL template

DNA (diluted 1:10 in ddH2O), and made up to a final volume of 10 μL using ddH2O.

Reactions were performed in duplicate for individual isolates. P3, Pa/Pb, and P4

promoter controls (isolates 36, 1, and 236-20-D respectively) and a NTC were included

in every run. Cycling conditions were as follows: 95°C/2min, 45X cycles of: 95°C/10s,

60°C/30s, 72°C/30s; followed by 95°C/30sec, 28°C/30sec, and the HRM (70-95°C,

0.1°C increments). Acquisition to channel green was performed during the extension

step of real-time PCR cycling, and during the HRM. All reactions apart from the NTC

were performed in duplicate.

__________________________________________________________________________________________________________________________________________


6.2.7 HRM protocol using Bioline SensiMix™ HRM Mastermix containing

EvaGreen®


Reactions contained 5 μL SensiMix HRM™ (Bioline), 0.4 μL EvaGreen® (Bioline), 0.5 μM

each of TEM_PrF and TEM_PrR, 1 μL template DNA (diluted 1:10 in ddH2O), and made

up to a final volume of 10 μL with ddH2O. P3, Pa/Pb, and P4 promoter controls (isolates

36, 1, and 236-20-D respectively) and a NTC was included in every run. Cycling

conditions were as follows: 50°C/2min, 95°C/10min, 45 cycles of: 95°C/10s, 60°C/30s,

72°C/30s; followed by 50°C/20s, 72°C/2min, and the HRM (70-95°C, 0.1°C

increments). Acquisition to channel green was performed during the extension step of

real-time PCR cycling, and during the HRM. All reactions apart from the NTC were

performed in duplicate.

6.2.8 Analysis of HRM Data

Raw HRM data was normalised in regions of stable pre- and post-melt fluorescence

using the Corbett Rotor-Gene™ 6000 real-time rotary analyzer software (QIAGEN),

creating normalised dissociation plots. Normalisation regions for each mastermix are

summarised in Table 6.1. Normalised dissociation plots were used to create difference

graphs, which allow a quantitative measure of sample deviation from a control sample.

To determine the discriminatory power of the TEM_Pr HRM assay, normalisation plots

and difference graphs were visually inspected for differences in curve shape and/or Tm.

It was expected that HRM curves of the same sequence would share similar curve

morphology. P3, Pa/Pb, and P4 controls were included in each run to enable inter-run

comparisons.

6.2.9 uMeltSM TEM_Pr HRM curve prediction

uMeltSM HRM curve prediction software (87) was used to analyse the 227 bp TEM_Pr

amplicon sequences of the blaTEM P3, Pa/Pb, and P4 promoters (Figure 6.1). The unified

parameter thermodynamic set was used (296). A 0.1°C resolution for predicted HRM

melt curves and melting profile was used.


6.3 Results

6.3.1 Characterisation of blaTEM promoter type

PCR and DNA sequencing were used to identify the blaTEM promoters in the isolates

used in this study (Table 6.3). The predicted 227 bp TEM_Pr amplicon was amplified

from 26 of the 33 isolates. One isolate yielded a 299 bp TEM_Pr amplicon, and the

remaining six isolates yielded no amplicon (Table 6.2). TEM_Pr sequences are shown in

Figure 6.1, and summarised in Table 6.2. Three known blaTEM promoters, P3, Pa/Pb, and

P4, were all found (184). Isolates 20, 23, and 238-15-A harboured mixtures of P3 and

Pa/Pb (P3+Pa/Pb) (Figure 6.1). An additional mixed C/T allele was present in the

blaTEM promoter of isolate 23, located between the -35Pa and -35Pb elements at

position 13 according to the Sutcliffe numbering system (314) (Figure 6.1). The

atypical 299 bp amplicon of isolate 237-49-C had a 72 bp nucleotide insertion. BLAST

analysis revealed that the insertion consisted of two right inverted repeats of IS6100

seperated by a short sequence. The 72 bp insertion was located between positions 36

and 37 (Sutcliffe numbering system) (314), which is between the -10Pa and the -10Pb

elements (Figure 6.1). Further analysis of the nucleotide insertion revealed a

potentially new -35 element at nucleotide positions 130-135 of the novel TEM_Pr

amplicon (Figure 6.1). This new -35 element in conjunction with the existing -10Pb

element could perform as an additional blaTEM promoter (Figure 6.1). Aside from the

insertion, the 237-49-C blaTEM promoter sequence aligned to the P3 promoter sequence

(Figure 6.1).

6.3.2 Comparison of four mastermixes for HRM-based discrimination of

blaTEM promoter sequences.

The blaTEM promoter HRM assay was tested initially using template from isolates

harbouring blaTEM promoter variants that did not appear to be mixed according to the

sequencing traces. Four commercial mastermixes (Table 6.1) were tested for their

ability to differentiate the P3, Pa/Pb, and P4 blaTEM promoters.

The Invitrogen SYBR® mastermix was able to discriminate P4 promoters from the P3

and Pa/Pb promoters in the lower Tm melting domain of the TEM_PR amplicaon (Figure

6.2A). The large spread of P3 TEM_Pr HRM curves did not allow for confident

__________________________________________________________________________________________________________________________________________


Figure 6.2 TEM_Pr amplicon high resolution melt (HRM) curves of K. pneumoniae clinical isolates harbouring pure blaTEM promoter variants.

Normalised melt curves of P3 (red), Pa/Pb (black), and P4 (blue) blaTEM promoter variants are shown in the upper panel. Difference graphs are shown in the lower panel, where Pa/Pb TEM_Pr curves are set to baseline. A, Invitrogen Platinum® SYBR® Green qPCR Supermix-UDG chemistry; B, Bioline SensiMix™ SYBR® NoRef chemistry; C, TrendBio HRM Master Mix containing LCGreen® Plus+; D, Bioline SensiMix™ HRM Mastermix containing EvaGreen®.


discrimination of P3 and Pa/Pb promoters genotypes (Figure 6.2A). This was due to

single replicates of isolates 211-32-C (P3) and 238-02-A (P3) that produced melting

curve shapes inconsistent with the remaining P3 promoter replicates. The observed

range of P3 promoter melt curves was not reproducible and both replicates of isolates

211-32-C and 238-02-A had similar profiles to the remaining P3 promoter melt curves

when the TEM_Pr HRM assay was repeated (data not shown).

The blaTEM promoter sequences could not be discriminated using the Bioline SensiMix™

SYBR® NoRef mastermix (Figure 6.2B). Single domain HRM curves were produced,

which contributed to the low discriminatory power of this mastermix. Similar to the

Invitrogen SYBR® mastermix, a large spread of P3 TEM_Pr HRM curves was observed

(Figure 6.2B), and the reproducibility of HRM curves using this mastermix was quite

poor.

The TrendBio HRM Master Mix containing LCGreen® Plus+ successfully discriminated

the P4 promoter from the Pa/Pb and P3 promoters in the lower Tm melting domain

(Figure 6.2C). The majority of the isolates harbouring Pa/Pb promoters could be

discriminated from the P3 promoter isolates in the higher Tm melting domain. However,

duplicate melt curves that had a similar profile to Pa/Pb promoter melt curves were

observed for the P3 promoter isolate 237-24-C (Figure 6.2C). Both the melt curve

profile (Pa/Pb) and sequencing result (P3) for isolate 237-24-C were reproducible.

Therefore due to the P3 melt curve spread, Pa/Pb was not discriminated confidently

from P3. Interestingly, the Tm values obtained using this mastermix were approximately

5°C higher than the Tm values obtained using the other mastermixes (Figure 6.2C). This

is consistent with other reports (185).

Bioline SensiMix™ HRM Mastermix discriminated the P4 promoter from P3 and Pa/Pb

promoter variants (Figure 6.2D). Analogous to the TrendBio HRM Master Mix results,

the Pa/Pb promoters were not discriminated from the P3 promoters due to the large

spread of P3 promoter melt curves (Figure 6.2D). The P3, Pa/Pb and P4 promoter

amplicons demonstrated similar melt profiles to those seen with the TrendBio HRM

Master Mix, although TEM_Pr Tm values were comparable to those observed with the

Invitrogen SYBR® mastermix (Figure 6.2d).

__________________________________________________________________________________________________________________________________________


Overall, the mastermixes containing saturating dyes, TrendBio HRM Master Mix and

Bioline SensiMix™ HRM Mastermix, provided greater discrimination of the pure P3,

Pa/Pb, and P4 blaTEM promoter variants than the mastermixes containing SYBR® Green

I. There were no observable differences in discriminatory power between the

mastermixes containing saturating dyes.

6.3.3 Discrimination of P3+Pa/Pb mixed allele promoters from pure P3,

Pa/Pb, and P4 promoters

The four commercially available mastermixes (Table 6.1) were tested for their ability to

identify the mixed P3+Pa/Pb promoters observed in isolates 20, 23, and 238-15-A, from

the pure P3, Pa/Pb, and P4 promoters of the remaining clinical K. pneumoniae isolates

(Table 6.2). Isolate 20, 23, and 238-15-A TEM_Pr melt curves were overlayed onto the

P3, Pa/Pb, and P4 promoter melt curve data presented in section 6.3.2. The

mastermixes containing SYBR® Green I had a lower discriminatory power compared to

the mastermixes containing saturating dyes. The Invitrogen SYBR® mastermix was able

to discriminate the P3+Pa/Pb promoter of isolate 23 from pure P3, Pa/Pb, and P4

promoters (Figure 6.3A). Isolate 20 and 238-15-A P3+Pa/Pb melting curves were

discriminated from the pure P4 promoter in the first melt domain, but not from pure P3

and Pa/Pb HRM curves in the second melt domain. The difference between TEM_Pr

amplicon sequences for all three isolates is that two mismatched base pairs are present

for isolate 23 (Figure 6.1). Additional mixed allele polymorphisms in a DNA fragment

provide additional regions of heteroduplex destabilisation. Hence two mixed-alleles

polymorphisms within the TEM_Pr amplicon confer a greater curve displacement than

a single mixed allele polymorphism relative to pure TEM_Pr variant melt curves (124).

It was hypothesised that this greater curve displacement allowed discrimination of the

TEM_Pr melt curve of isolate 23 from pure P3, Pa/Pb and P4 blaTEM promoter variants.

No such effect was observed for the TEM_Pr HRM curves generated using the Bioline

SensiMix™ SYBR® NoRef mastermix. The mixed P3+Pa/Pb promoters were not

discriminated from pure promoter genotypes, and melt curve shape changes were not

observed (Figure 6.3B).

Melting curves with a higher discriminatory power were observed when mastermixes

containing saturating dyes (i.e. LC Green+® and EvaGreen®) were used. Heteroduplex


Figure 6.3 TEM_Pr amplicon high resolution melt (HRM) curves of K. pneumoniae clinical isolates harbouring mixed P3 and Pa/Pb blaTEM promoter alleles (P3+Pa/Pb).

P3+Pa/Pb melt curves (green) were overlayed onto the TEM_Pr HRM curves of pure blaTEM promoter variants demonstrated in Figure 6.2 - P3 (red), Pa/Pb (black), P4 (blue). Normalised melt curves are shown in the upper panel. Difference graphs are shown in the lower panel, where Pa/Pb TEM_Pr curves are set to baseline. A, Invitrogen Platinum® SYBR® Green qPCR Supermix-UDG chemistry; B, Bioline SensiMix™ SYBR® NoRef chemistry; C, TrendBio HRM Master Mix containing LCGreen® Plus+; D, Bioline SensiMix™ HRM Mastermix containing EvaGreen®.

__________________________________________________________________________________________________________________________________________


formation and subsequent melt curve shape changes allowed discrimination of the

three P3+Pa/Pb mixed promoters from the pure P3, Pa/Pb, and P4 promoter melt

curves in the higher Tm melting domain (Figures 6.3C and 6.3D). The melt curve shape

changes were best visualised on the difference graphs, where the heteroduplex melt

curves cross the baseline during the higher Tm melting domain (Figures 6.3c and 6.3d,

bottom panels). It can be concluded that both mastermixes containing saturating dyes

were able to discriminate mixed P3+Pa/Pb promoters from pure blaTEM promoter

variants, demonstrating a higher discriminatory power than the mastermixes

containing SYBR® Green I.

6.3.4 Discrimination of strong blaTEM promoters in minority allele

frequencies from pure P3, Pa/Pb, and P4 promoters

Discrimination of the stronger Pa/Pb promoter at lower frequencies in a P3 promoter

background was investigated using the four commercially available mastermixes

(Table 6.1). The P3-Pa/Pb mixed template samples described in Section 6.2.2 were

tested.

Samples containing 50% Pa/Pb alleles, and samples containing 20% Pa/Pb alleles were

discriminated from pure P3 and Pa/Pb when the Invitrogen SYBR® Green I mastermix

was used (Figure 6.4A). The 50% and 20% P3-Pa/Pb melt curves were a different

shape to the pure Pa/Pb melt curves, with a slight difference in Tm between the spiked

template curves. The 10%, 5%, and 2% P3-Pa/Pb mixed template sample curves could

not be discriminated confidently from the pure P3 melt curves. Aberrant melt curves

were produced for a single replicate of the 10% and 2% P3-Pa/Pb mixed template

samples (Figure 6.4A). The remaining two replicate curves of each of these P3-Pa/Pb

mixed template samples demonstrated melt curves consistent between replicates, and

comparable with the 5% P3-Pa/Pb and pure P3 template HRM curves. Thus it is

unlikely that the aberrant melt curves were due to a problem with the template DNA

sample. The aberrant melt curves are more likely due to a salt concentration variation

between replicate reactions for each of the 10% and 2% P3-Pa/Pb mixed template

samples (30, 126, 298). Aberrant melt curves analogous to those demonstrated for the

10% and 2% P3-Pa/Pb mixed template replicates using the Invitrogen SYBR®

mastermix did not occur with the three alternate mastermixes. This was not explored

further.


Figure 6.4 Discrimination of P3 promoter template mixed with Pa/Pb template (P3-Pa/Pb) TEM_Pr amplicons from pure P3 and Pa/Pb promoter template TEM_Pr amplicons.

HRM curve colours are as follows: pure P3 (red), pure Pa/Pb (black), 50% Pa/Pb (light blue), 20% Pa/Pb (purple), 10% Pa/Pb (green), 5% Pa/Pb (orange), and 2% Pa/Pb (grey). Normalised melt curves are shown in the upper panel, a zoomed in view of the higher Tm melting domain is shown in the middle panel, and difference graphs with pure Pa/Pb curves set to baseline in the lower panel. A, Invitrogen Platinum® SYBR® Green qPCR Supermix-UDG chemistry; B, Bioline SensiMix™ SYBR® NoRef chemistry.

__________________________________________________________________________________________________________________________________________


Figure 6.4 (cont.) Discrimination of P3 promoter template mixed with Pa/Pb template (P3-Pa/Pb) TEM_Pr amplicons from pure P3 and Pa/Pb promoter template TEM_Pr amplicons.

HRM curve colours are as follows: pure P3 (red), pure Pa/Pb (black), 50% Pa/Pb (light blue), 20% Pa/Pb (purple), 10% Pa/Pb (green), 5% Pa/Pb (orange), and 2% Pa/Pb (grey). Normalised melt curves are shown in the upper panel, a zoomed in view of the higher Tm melting domain is shown in the middle panel, and difference graphs with pure Pa/Pb curves set to baseline in the lower panel. C, TrendBio HRM Master Mix containing LCGreen® Plus+; D, Bioline SensiMix™ HRM Mastermix containing EvaGreen®.


Analogous to the clinical isolate HRM analysis, a single melting domain was observed

using the Bioline SensiMix™ SYBR® NoRef mastermix. Pure Pa/Pb promoter was

discriminated from pure P3 promoter, but all mixed template samples (50% to 2%

Pa/Pb) were not discriminated from the pure P3 promoter (Figure 6.4B). In an aim to

improve heteroduplex formation, triplicates were mixed and redistributed to their

wells post-HRM prior to performing a second HRM. Triplicates were in general tighter

for the second HRM, however no further discriminatory power was obtained for this

mastermix (data not shown).

TrendBio HRM Mastermix was able to discriminate mixed template containing 50%,

20%, and 10% Pa/Pb alleles confidently from pure P3 and Pa/Pb promoters (Figure

6.4C). Heteroduplex melt curve shape changes in the higher Tm melting domain were

observed for these template samples. Heteroduplex melt curve shape changes were

more clearly identified on the difference graph (Figure 6.4C, bottom panel). Mixed

template containing 5% and 2% Pa/Pb could not be discriminated from the pure P3

melt curves.

Bioline SensiMix™ HRM mastermix was able to discriminate template DNA with 50%

Pa/Pb alleles in a P3 promoter background (Figure 6.4d). Heteroduplex effects for the

mixed template sample containing 50% Pa/Pb were observed in the higher Tm melting

domain of the TEM_Pr melt curve. Melt curves of the mixed template samples

containing 20% to 2% Pa/Pb could not be discriminated from the pure P3 melt curves

(Figure 6.4D).

The blaTEM P4 promoter is stronger than both Pa/Pb and P3 promoters (184).

Discrimination of minor P4 promoter alleles in P3 and Pa/Pb backgrounds from pure

P3 and Pa/Pb promoters would enable detection of bacterial subpopulations better

adapted to selective pressure. The TrendBio HRM Mastermix performed the best at

discriminating Pa/Pb alleles in minority from pure P3 and Pa/Pb, so only this

mastermix was trialled. P3-P4 mixed template samples were not discriminated from

the pure P3 promoter (Figure 6.5A), demonstrating that the TEM_Pr HRM assay cannot

detect low frequencies of P4 alleles in a P3 background. 50% and 20% P4 alleles in a

Pa/Pb background were discriminated from the pure P4 and Pa/Pb due to

displacement of the melt curves in the lower Tm TEM_Pr melting domain (Figure 6.5B).

Mixed template samples containing 10%, 5% and 2% Pa/Pb alleles could not be

__________________________________________________________________________________________________________________________________________


Figure 6.5 Discrimination of P3 promoter template mixed with P4 template (P3-P4) and Pa/Pb promoter template mixed with P4 template (Pa/Pb-P4) from pure blaTEM promoter variants using the TrendBio HRM Mastermix.

A, HRM melt curves of P3-P4 mixed templates, B, HRM melt curves of Pa/Pb-P4 mixed templates. Normalised melt curves are shown in the upper panel, a zoomed in view of the lower Tm melting domain is shown in the middle panel, and a difference graph with pure P4 melt curves set to baseline in the lower panel. HRM curve colours are as follows: pure P4 (blue), pure P3 (red), pure Pa/Pb (black), 50% P4 (light blue), 20% P4 (purple), 10% P4 (green), 5% P4 (orange), and 2% P4 (grey).


discriminated from the pure Pa/Pb promoters (Figure 6.5B). P4 alleles in minority

were more easily discriminated in a Pa/Pb background than a P3 background. This was

attributed to the presence of two mismatched bases in the Pa/Pb-P4 heteroduplex

dsDNA molecule compared to one in the P3-P4 heteroduplex molecule (124).

6.3.5 TEM_Pr HRM curve prediction

It was of interest to compare actual TEM_Pr HRM assay outcomes with predicted HRM

results. P3, Pa/Pb, and P4 TEM_Pr amplicon sequences were analysed using the melt

curve prediction software uMeltSM (87) (Figure 6.6).

The static melting profile predicted the temperature(s) that regions of the TEM_Pr

amplicon would melt during HRM, based on the nucleotide sequence of the amplicon

(Figure 6.6A). The TEM_Pr region corresponding to nucleotide positions 153-227 was

predicted to melt at ~82°C, generating the lower Tm TEM_Pr melting domain (Figure

6.6A). The remainder of the amplicon was predicted to dissociate at ~86.5°C, forming

the higher Tm melting domain (Figure 6.6A). uMeltSM software also generates HRM melt

curve predictions. Melt curves are derived from the calculated total helicity of the

TEM_Pr amplicon across a temperature range (87). According to uMeltSM predicted

melt curves, the P4 polymorphism is discriminated from P3 and Pa/Pb in the lower Tm

melting domain, and the presence of the Pa/Pb polymorphism is differentiated from P3

and P4 in the higher Tm melting domain (Figure 6.6B). This correlates with the

positions of the Pa/Pb and P4 promoter-conferring SNPs within the TEM_Pr amplicon

(positions 72 and 205, respectively) (Figure 6.1).

The discriminatory power of the two TEM_Pr melting domains was accurately

identified using the uMeltSM software. Predicted Tms of the TEM_Pr melting domains

were over-estimated by 0.5-1.0°C for the first domain, and ~1.5°C for the second

domain when compared to the TrendBio HRM Mastermix experimental data. Dwight et.

al., (2011) verified that whilst the unified parameter thermodynamic set (296)

provided the best match between predicted and experimental HRM curves, a shift in

the Tm of the predicted melt curve was still present (87).

__________________________________________________________________________________________________________________________________________


Figure 6.6 uMelt™ TEM_Pr amplicon dissociation predictions.

A, the static melting profile of the P3 TEM_Pr amplicon, demonstrating regions of the TEM_Pr amplicon and the temperatures each region will dissociate at; B, predicted normalised HRM melt curves for P3 (red), Pa/Pb (black) and P4 (blue) blaTEM promoter variants.


6.4 Discussion

Four commonly observed promoter variants are involved in blaTEM expression: P3,

Pa/Pb, P4, P5 (184). Pa/Pb, P4, and P5 promoter variants are characterised by

individual point mutations that increase promoter strength compared to the weak P3

promoter (122, 190, 314). Lartigue et. al., (2002) compared the influence of each blaTEM

promoter variant on TEM-1 and TEM-30 expression, describing the order of promoter

strength as P3<Pa/Pb<P4<P5 (184). Alternative blaTEM promoter sequences created

due to insertion or deletion events have also been described(16, 109, 123, 285).

The K. pneumoniae clinical isolates used in this study harboured P3, Pa/Pb, and P4

blaTEM promoter variants, and one isolate with a 72 bp insert in a P3 promoter (Table

6.2). HRM analysis was able to discriminate pure blaTEM promoter variants in these

isolates, with mastermixes containing a saturating fluorescent dye performing the best.

SYBR® Green I is a PCR inhibitor and is therefore used at non-saturating concentrations

in real-time PCR and HRM applications (344). Upon release from denatured DNA,

SYBR® Green I molecules are free to re-intercalate into unmelted DNA regions, masking

potential melt curve shape changes and multiple melting domains of a given amplicon

(3, 85, 117). Used at saturating concentrations, dyes such as LCGreen® Plus+ and

EvaGreen® overcome the dye re-intercalation associated with SYBR® Green I. This

enables the identification of amplicon melting domains, and differences in melt curve

shapes, increasing the discriminatory power of HRM (345). A paradoxical finding in this

study was that Pa/Pb and P3 blaTEM promoter variants could only be discriminated

when template samples were mixed with P3 template DNA. It was hypothesised that

salt concentration variation between template DNA samples (30, 126, 298), or the

presence of a low-level cryptic promoter that was not identified in the sequencing

traces, contributed to the P3 promoter melt curve spread observed for the higher Tm

TEM_Pr melting domain using un-spiked template DNA samples (Figure 6.2). Initially

observed for the three isolates harbouring mixed P3 and Pa/Pb alleles, melt curve

shape changes were observed in the higher Tm TEM_Pr melting domain compared to

pure P3 and Pa/Pb melt curves (Figure 6c and 6d). When mixed allele DNA template is

amplified, homoduplex and heteroduplex molecules form (227). Heteroduplex

molecules melt at lower temperatures than homoduplex molecules, resulting in an

earlier decrease in fluorescence prior to the major homoduplex melting transition. THe

formation of heteroduplexes resulted in the observed HRM curve shape changes (194,

__________________________________________________________________________________________________________________________________________


345). It was interesting to note that the P4 promoter was clearly discriminated from P3

and Pa/Pb melt curves by a Tm shift in the lower Tm melting domain, and that the P3

melt curve spread observed in the higher Tm melting domain was not evident here.

None of the K. pneumoniae isolates in our collection harboured the blaTEM P5 promoter.

However, the ability of the blaTEM promoter HRM assay to discriminate the P5 promoter

from P3, Pa/Pb, and P4 was tested in silico. The melt curve prediction software uMelt™

determined that the TEM_Pr amplicon containing the P5 promoter nucleotide sequence

would have the same melt curve profile as the P3 TEM_Pr amplicon. This finding was

not surprising. The Tm of an amplicon is positively correlated with its size and %GC

content (126, 275). The blaTEM P5 promoter differs in sequence to P3 by a C � G point

mutation in the P3 -35 box which does not result in a %GC content difference between

P3 and P5 TEM_Pr amplicons. Although not tested in this study, it is hypothesised that

spiking samples with an alternative blaTEM promoter sample would enable the

discrimination of P5 blaTEM promoters from P3, Pa/Pb and P4 promoter variants by

promoting heteroduplex formation.

A novel application of HRM analysis is the detection of mutant alleles present in

minority within an excess of wild-type alleles. This concept has been explored in

relation to detecting somatic mutations associated with cancer, where biopsies often

contain only a small number of neoplastic cells (82, 107, 180, 181, 236, 303). Regarding

antibiotic resistance determinants, HRM discrimination of minor mutant allele

populations has been little explored. Bacterial genes are often assumed to be

monoploid therefore polymorphisms are assumed to be harboured by the entire

population. However, resistance genes can be present on multiple replicons and gene

amplification events can increase resistance gene dosage creating multiple targets

available to acquire a mutation. Mutant resistance gene alleles may be present in only a

subpopulation of bacterial cells, contributing to an uneven distribution of mutant

alleles within a bacterial population. It has been demonstrated for β-lactamases that an

ESBL-encoding allele confers an ESBL phenotype, even when present in a minority

(128). Andersson et. al., (2009) recently described a single tube HRM assay to detect

ESBL blaSHV codon 238 and 240 polymorphisms in previously characterised

K. pneumoniae isolates (10). Single and double mutant alleles at various allele

frequencies were differentiated, including discrimination of 20% double mutant alleles

in a background of Wt blaSHV alleles. The current study explored the application of HRM


for detection of higher-activity promoter alleles present in minority. The TrendBio

HRM mastermix containing LCGreen® Plus+ performed the best of the four

mastermixes. Discrimination of minor blaTEM promoter alleles from pure promoter

variants depended on the promoter alleles present. Mixed template samples containing

50%, 20% and 10% Pa/Pb alleles in a P3 promoter background were discriminated

from pure Pa/Pb and P3 promoter template. P4 alleles in minority could only be

discriminated when Pa/Pb was the major allele. Rouleau et. al., (2009) reported

difficulties in discriminating the c.380+27A>G variant in exon 4 of the MLH1 gene from

the reference curve, due to the position of the SNP at the end of the amplicon (290). It is

hypothesised that the location of the P4 polymorphism within the TEM_Pr fragment

(i.e. close to the reverse primer binding site), reduced the discriminatory power of the

blaTEM promoter HRM assay for detecting P4 alleles in minority to P3. Discrimination of

P4 alleles in a Pa/Pb background is attributed to the presence of two unpaired

nucleotide loci, conferring two regions of destabilisation in the heteroduplex molecule.

In conclusion, HRM was demonstrated to be an effective platform for successfully

discriminating previously described P3, Pa/Pb, and P4 blaTEM promoter variants in

clinical K. pneumoniae isolates. HRM provides a rapid and cost-effective platform with

which to conduct SNP-genotyping. Future application of the TEM_Pr HRM assay to

detect the presence of strong blaTEM promoters requires two reactions: 1, the test

template and 2, the test template spiked with pure P3 control template (Figure 6.7).

The former reaction facilitates discrimination of P4 promoters from Pa/Pb and P3

promoters. The latter enables discrimination of Pa/Pb promoters from P3 by

promoting heteroduplex formation (Figure 6.7). Reaction one also enables the

detection of Pa/Pb alleles present in minority in an excess of P3 alleles that may be

diluted out in the spiking process. The TEM_Pr HRM assay performed best when the

TrendBio HRM Mastermix containing the saturating dye LCGreen® Plus+ was used. It is

this HRM mastermix that is recommended for future TEM_PR HRM assay utilisation.

Discrimination of blaTEM promoter variants that impact on the level of TEM-β-lactamase

expression can indicate which bacterial isolates have the potential to express a

TEM-ESBL at high concentrations. Discriminating these promoter variants has the

potential to provide further insights regarding the response of a bacterial population to

antimicrobial therapies.

__________________________________________________________________________________________________________________________________________


Figure 6.7 Application of the blaTEM promoter high resolution melt (HRM) assay.

Reaction 1 involves performing the blaTEM promoter HRM assay on unknown template samples, and will enable the discrimination of P4 from P3 and Pa/Pb promoters. Reaction 2 comprises spiking the unknown template sample with P3 promoter template, allowing discrimination of P3 from Pa/Pb by promoting heteroduplex formation.


CHAPTER 7 General Discussion

The relationship between the genotype and phenotype of organisms harbouring β-

lactamase-encoding genes is not yet fully understood. Since the presence of an ESBL-

encoding bla gene does not always confer an ESBL phenotype, the aim of the current

study was to elucidate the genotypic markers necessary for ESBL expression. The work

described in this thesis focused on blaSHV and blaTEM genes, encoding SHV and TEM β-

lactamases, respectively. It is well known that bla gene mutations can expand the

spectrum of activity of the encoded β-lactamase, mutations in the -35 and -10 promoter

regions that confer a sequence closer in identity to the consensus can increase β-

lactamase expression, and bla gene amplification increases β-lactamase expression by

providing more gene copies to be expressed. A central question that is addressed in this

thesis is whether mutant promoters and gene amplification events primer a cell to

acquire an ESBL mutation? The results indicate that bla gene promoter mutations and

gene amplification events not only contribute to the expression of an ESBL phenotype,

but are required for acquisition of an ESBL genotype.

Amplification of ESBL-encoding blaSHV genes contributes to a high level of resistance to

third generation cephalosporins (127, 128, 352). Until recently, the mechanism of

plasmid-borne blaSHV amplification was unknown; hence the aim of experiments

described in Chapter Three was to identify the structure responsible for blaSHV dosage

fluctuations. During the course of these experiments, a tandem duplication of the IS26-

flanked blaSHV-5 composite transposon (large-blaSHV transposon) was described on

plasmid p1658/97 isolated from Escherichia coli (356). It was proposed that the

formation of large-blaSHV transposon tandem repeats was the mechanism of blaSHV

amplification. A tandem duplication of the large-blaSHV transposon was later

demonstrated in clinical E. cloacae strains (110). In this thesis, tandem repeats of the

large-blaSHV transposon were also described, consistent with previous findings (110,

356). I was able to demonstrate the small-blaSHV transposon, which differs from the

large-blaSHV transposon with respect to the positions of flanking IS26 elements relative

to blaSHV, also formed tandem repeats as a mechanism of blaSHV amplification. This

finding has not been previously described.

__________________________________________________________________________________________________________________________________________


Whilst determining the blaSHV amplifiable unit, a novel antibiotic resistance gene array

was identified. The aminoglycoside resistance determinant aph(3’)-Ia was detected at

the 5’ and 3’ ends of the large-blaSHV transposon tandem repeat region in one isolate

(Figure 3.6). The aph(3’)-Ia gene is commonly described as part of a composite

transposon structure that includes flanking IS26 elements (125, 248, 266, 351). IS26

elements at adjacent boundaries of the aph(3’)-Ia and large-blaSHV composite

transposons were shared in the novel antibiotic resistance gene array described in this

thesis (Figure 3.6). It was hypothesised that no preference for IS26 elements would be

observed during homologous recombination events, therefore incorporation of the

aph(3’)-Ia transposon into the blaSHV transposon tandem repeating unit in the presence

of selective pressure with CTX would occur, but these were not observed (Figure 3.5).

Observed amplification events were specific to the gene under selective pressure

(blaSHV). Considering that the aph(3’)-Ia gene was not under selective pressure during

the stepwise selection to CTX resistance, an increased aph(3’)-Ia dosage would be of no

immediate benefit to cell fitness in a CTX selective environment.

The question of how the closest flanking sequence of homology was identified to

facilitate amplification events still remains. Answers to similar questions in regard to

how sequences of homology are detected for the repair of DNA double strand breaks

(DSBs) by homologous recombination are being pursued (25). In prokaryotes, the Rec

family of proteins are recruited for DSB repair, with RecA participating in all three

stages of DSB repair (175). Intracellular assemblies that contain DNA and RecA have

been observed in E. coli cells subjected to environmental stress, and are proposed to be

the machinery that facilitates RecA-mediated repair of DSBs (191). In Bacillus subtilis,

RecA has been shown to form filaments that extend from DSBs to the other half of the

nucleoid. RecA filaments are proposed to scan the nucleoid for sequence homology to

the damaged DNA (175). However, the diffusion of RecA filaments throughout the

cellular space is slow, and homology searches are further encumbered by small

concentrations of target DNA, and high concentrations of competitive non-target DNA

(34, 337). To overcome these impedances, DNA can co-localise and form a two

dimensional parallel alignment, thus reducing the area of diffusion (191). Potentially,

similar molecular machinery could be involved in the formation of tandem repeats of

composite transposons, since homologous recombination is the process common to

both genetic events. RecA-mediated searches for sequence homology may identify the

closest homologous sequence surrounding the gene under selective pressure, thus


ensuring the smallest and most energy efficient tandem repeating unit. The intricacies

of the molecular machinery in the homologous recombination process, specifically the

method of identifying the flanking sequence of homology during gene amplification

events warrants further study.

In this thesis, it was observed that multiple genetic mechanisms are required for the

acquisition of ESBL-mediated resistance to third-generation cephalosporins: ESBL-

conferring mutations, stronger promoter variants, and bla gene amplification. Point

mutations in bla genes create ESBL enzymes, expanding the spectrum of enzyme

activity to include third-generation cephalosporins. For blaSHV, a G238S mutation

expands the SHV β-lactamase spectrum of activity to include third-generation

cephalosporins (e.g. CTX). Multiple polymorphic sites are associated with TEM-ESBL

(http://www.lahey.org/studies/), and in this study a correlation between the catalytic

efficiency of the encoded TEM-ESBL and CAZ MIC was observed (Figure 4.5). Strong

promoter variants were required for sufficient ESBL expression to result in a third

generation cephalosporin MIC conferring resistance to third-generation cephalosporins

(sections 4.3.1 and 4.3.2). For SHV-ESBLs, this correlates with the presence of blaSHV on

a plasmid, since the chromosomal blaSHV promoter is weaker than the described

plasmid-borne blaSHV promoters (325). Specifically for blaTEM, the CAZ MIC reflects both

the promoter strength and the catalytic efficiency of the encoded TEM-ESBL (Figure

4.5). blaSHV amplification was determined to not be a requirement for acquisition of an

SHV-dependent ESBL phenotype (Figure 4.3). However, blaSHV amplification was

observed following subsequent CTX selective pressure, conferring an increased CTX

MIC (Figure 5.8). A statistically significantly larger blaTEM dosage was observed for both

non-ESBL and ESBL derivatives after selective pressure with 1.0 µg/mL CAZ (Figure

4.6). It is evident that bla gene amplification contributes to the expression of an ESBL

phenotype, but also provides low-level resistance to third generation cephalosporins in

the absence of an ESBL-encoding bla gene. The overarching finding is that promoter

strength is a predictor of the acquisition of ESBL and third-generation cephalosporin

resistant phenotypes in isolates harbouring bla genes. This then begs the question: of

what clinical significance is a gene encoding an ESBL governed by a weak promoter?

Another question raised by the findings from this thesis is the relative validity of MIC

measurements. Both CLSI and EUCAST have made recent revisions to susceptibility

breakpoints for third-generation cephalosporins based on pharmacokinetic and

__________________________________________________________________________________________________________________________________________


pharmacodynamic properties, MIC distributions and limited clinical data (70, 71, 95).

Revised third-generation cephalosporin breakpoints are designed to capture the

majority of ESBL-producers without the need for ESBL detection methods. Thus

confirmatory testing for ESBL expression is no longer required to help guide

antimicrobial therapy (i.e. change a sensitive or intermediate MIC to intermediate or

resistant, respectively). There is a concern that low-MIC ESBL-producers will not be

captured with the revised breakpoints (154) (286), however the evidence for this is

conflicting (263). Certainly in this study, if ESBL confirmatory testing was not

performed, not all K. pneumoniae isolates expressing TEM-ESBLs would have been

reported as resistant to CAZ using current CLSI susceptibility breakpoints alone (Table

4.6, Figure 4.6). Again, the clinical significance of isolates harbouring these phenotypes

needs to be addressed. There is the potential for blaTEM amplification to increase TEM-

ESBL expression and confer resistance in the presence of selective pressure with a

third-generation cephalosporin. Acquisition of compensatory mutations, whether they

be additional blaTEM mutations, or non-β-lactamase related mutations (e.g. porin loss)

could contribute to the acquisition of a third-generation cephalosporin resistant

phenotype. Certainly, continuing with routine ESBL detection alongside MIC

determination could be seen as a way of limiting the number of low MIC ESBL

producers that are not currently detected using phenotypic testing (154). As

demonstrated in Table 4.6, ESBL activity can be detected without any discernable

ESBL-encoding bla gene present, so revisions to current ESBL detection methods may

need to be explored.

A general assumption when interpreting antimicrobial susceptibilities and thus

determining appropriate therapy is that the microbial population is phenotypically and

genotypically homogeneous. However, as demonstrated in Chapter 5, this is not always

the case. Heteroresistance is a term commonly used to describe phenotype variation in

a microbial population, observed as subpopulations with phenotypes different to that

of the overall microbial population. Despite the use of the term ‘heteroresistance’ in

analogous contexts, authors still regularly state that no standard definition has been

applied to the word. Recently, heteroresistance was defined as the phenotypic

variability observed within a microbial population that is genetically homogenous

(162). This is an interesting interpretation of heteroresistance, considering that

genotypic determinants such as mutated penicillin binding proteins (212, 221),

promoter mutations (63), and mixed Mt and Wt alleles of gyrA (57) have all been


shown to result in a heteroresistant phenotype in the microbial populations they have

been observed in. In this thesis it was demonstrated that bla gene copy number

heterogeneity contributes to third-generation cephalosporin heteroresistance in K.

pneumoniae populations (Figure 5.4, Figure 5.10). This finding could be extended to

any bacterial species harbouring a blaSHV or blaTEM gene located on a plasmid, the site

where bla gene amplification is most commonly observed. A similar finding was

observed in Cryptococcus neoformans populations heteroresistant to azole drugs (305).

Duplication of C. neoformans chromosomes was observed in subpopulations with

increased azole drug resistance. Chromosome duplication was hypothesised to be the

mechanism that facilitated the amplification of genes encoding azole resistance.

There are interesting parallels between gene amplification and heteroresistance. Gene

amplification can facilitate an in increase in antimicrobial resistance by providing

multiple gene targets that are available for acquisition of a more stable resistance

mechanism (i.e. point mutations) (36). Heteroresistance is postulated to be a

mechanism via which bacterial populations can explore antimicrobial resistance

evolution prior to acquisition of resistance by the entire population (221). Therefore

antibiotic resistance gene dosage heterogeneity within a microbial population

conferring a heteroresistant phenotype is plausible, and it is interesting that a

relationship between heteroresistance and gene copy number heterogeneity is not

more frequently described.

Yet the question of whether a heteroresistant phenotype is clinically significant still

remains. A significant proportion of literature describing heteroresistance focuses on

heteroresistant vancomycin intermediate S. aureus (hVISA) infections and isolates, of

which the clinical significance has been the subject of several recent review

articles(151, 288, 333). It has been postulated that hVISA is a precursor to development

of vancomycin intermediate S. aureus (VISA) infections (76). hVISA has been associated

with vancomycin treatment failure (14, 59, 102, 171, 220, 229), especially in patients

that have had prior exposure to vancomycin, and colonisation or infection with S.

aureus. High inoculum infections such as endocarditis, deep abscesses, and prosthetic

device infections are also associated with a hVISA phenotype (59, 102, 208).

Considering that treatment failure is often associated with high inoculum infections

independent of population phenotype, and hVISA infections do not always result in

treatment failure, it is postulated that a hVISA phenotype is the consequence of

__________________________________________________________________________________________________________________________________________


treatment failure, rather than the cause (333). It is likely that these conclusions and

hypotheses can be drawn for bacterial species other than S. aureus; however, due to a

lack of literature regarding the clinical impact of heteroresistance in other organisms,

further research is warranted.

This project also identified some interesting parallels between heteroresistance and

the inoculum effect. The inoculum effect is described as an observable increase in MIC

when the inoculum size is increased (50). In β-lactamase-expressing organisms, this is

thought to be due to β-lactamase carry-over in the culture medium, and free β-

lactamase released from lysed cells. There is a continuing debate over the clinical

significance of the inoculum effect. It has been suggested that the inoculum effect is an

artefact of antimicrobial susceptibility testing (50, 75). Animal infection models have

demonstrated that the inoculum concentration has no impact on drug efficacy (11,

204), therefore the in vitro MIC obtained using a standard inoculum (5 X 105 CFU) can

predict antibiotic efficacy in vivo regardless of inoculum size. Despite these claims, it

has been demonstrated that the inoculum effect can reduce treatment efficacy due to

insufficient antibiotic dosage (307), and can provide an environment that favours the

selection of antibiotic resistant mutants (210). The inoculum effect has been observed

in a clinical setting (183, 222), suggesting that the inoculum effect can be clinically

significant. In this study, observed inoculum effects were not directly correlated with

the size of the inoculum so much as an increased β-lactamase expression due to

amplified bla. This finding is of potential clinical significance. MIC-guided therapy may

select for cells harbouring amplified bla, hence the increased concentration of β-

lactamase lowers the amount of antibiotic available to kill pathogenic cells, potentially

decreasing treatment efficacy (88, 91, 149, 311). Recently, Tan et. al., (2012) described

the mechanistic basis behind the inoculum effect observed for ribosome-targeting

antimicrobials in the absence of encoded resistance mechanisms (319). At high

bacterial densities, antibiotic-induced heat shock response and associated fast

ribosome degradation produced an inoculum effect. This finding strongly refutes the

suggestion that the inoculum effect is an artefact of antimicrobial susceptibility testing.

The findings from this thesis and those of Tan et. al., (2012) both demonstrate that

there is a mechanistic basis for the observed inoculum effects, thus refuting the

suggestion that the inoculum effect is not real (319). However, further research is still

required to determine the clinical significance of the inoculum effect.


A well-known limitation of antimicrobial susceptibility testing is that the resistance

determinant responsible for the observed resistance phenotype cannot be determined

from an MIC profile. It is suggested that genotypic testing could circumvent this, and in

addition detect low MIC resistance mechanisms that do not confer a resistant

phenotype (186, 321). Molecular testing also has the potential to detect cells primed to

acquire phenotypic resistance in the presence of selective pressure (Chapter 6).

Genotypic testing has a minor role in current antimicrobial susceptibility testing,

including MRSA detection (340), Rifampicin resistance detection in M. tuberculosis (45,

136), and vancomycin-resistant Enterococci (VRE) discrimination (310). PCR-based

technologies for detecting resistance-encoding genes or resistance-conferring SNPs are

favoured, due to the reduced workload, cost, and time associated with performing

experiments. Unfortunately, PCR-based methods can only detect known resistance

mechanisms and reactions are specific to a precise DNA target. For genotypic testing to

become more commonplace in antimicrobial susceptibility testing, and complement

current phenotypic methods, the first requirement is results that areobtainable in the

18-24 hrs that it takes to achieve phenotypic results. Ideally, the method(s) would be

able to detect both known and novel resistance mechanisms, and multiple resistance

mechanisms would be detected in a single reaction akin to phenotypic methods.

Genotypic testing technologies would also offer a more universal method, not

dependent on bacterial species. This would reduce staff training requirements – one of

several current arguments against the introduction of genotypic testing.

HRM is a popular platform for the detection and discrimination of antibiotic resistance

determinants. Coupled with a real-time PCR for resistance gene detection, HRM can

discriminate different alleles based on melt curve Tm or melt curve shape variations,

which are ultimately a function of the amplicon nucleotide sequence (283). While

generally a single DNA target is investigated per reaction, success has been found with

multiplexing the real-time PCR step, allowing multiple gene targets to be discriminated

for a single sample in a single reaction (39, 170, 306). HRM also offer reactions that are

more rapid than current phenotypic antimicrobial susceptibility testing methods. In

this thesis, HRM was shown to be able to determine the presence of markers that

indicate the potential to acquire antimicrobial resistance. It was observed that the

blaTEM promoter variant is indicative of the potential of an isolate to acquire a CAZ-

resistant phenotype (section 4.3.2). HRM of the blaTEM promoter region was able to

successfully discriminate the P3, Pa/Pb, and P4 promoter variants based on HRM curve

__________________________________________________________________________________________________________________________________________


shape variations (section 6.3.2). A novel blaTEM promoter sequence, containing a 72 bp

insertion and isolates harbouring mixed blaTEM promoter alleles were also

discriminated. Despite HRM assays being specific to the amplicon of interest, HRM does

have the capacity to identify novel sequences within amplicons (section 6.3.2) (2, 139,

140) and population heterogeneity (sections 6.3.3, 6.3.4) (10, 82, 107, 180, 181, 236,

303). Despite the success of HRM for discriminating markers for antibiotic resistance

phenotype acquisition, application of this technology to complement phenotypic testing

would require that each isolate be screened for a vast number of genetic targets.

Ultimately, multiple reactions per isolate would need to be performed to produce a

meaningful antimicrobial resistance gene profile. After the incorporation of controls for

each gene target, the number of isolates able to be included in a given HRM run may

make this a less than optimal molecular AST method.

MALDI-TOF MS has recently emerged as a technique beneficial to clinical microbiology.

MALDI-TOF MS utilises the mass-to-charge ratio of biomolecules (e.g. proteins, PCR

amplicons) from bacterial extracts or even whole bacterial cells (66). MALDI-TOF MS

was originally developed to characterise and identify large biomolecules. However, the

technology has fast become popular as a molecular approach for genus and species

identification of microorganisms (115). MALDI-TOF MS microorganism

characterisation is comparable, if not superior to more conventional phenotypic

methods (43, 232, 330). Further innovations of MALDI-TOF MS include discrimination

of antibiotic sensitive and resistant organisms (224), and detection of antibiotic

resistance activity (53, 147, 152, 308). MALDI-TOF MS currently relies on hydrolysis of

antibiotics to determine the presence of antimicrobial resistance activity, therefore the

resistance determinant cannot be determined, and antibiotic resistance conferred by

porin loss or up-regulation of an efflux pump cannot be detected. Despite this, MALDI-

TOF MS is able to determine enzyme specificity despite not knowing the enzyme

identity (147), which is of potential clinical importance. In comparison to phenotypic

antimicrobial susceptibility testing, which can take anywhere from 8 to 48 h after initial

culture, MALDI-TOF MS can provide interpretative results up to 20 h earlier if an O/N

bacterial culture is available (232). Whilst antimicrobial susceptibility testing

applications of MALDI-TOF MS are being developed, technological limitations remain.

The greatest concern with using MALDI-TOF MS in a clinical setting is inter-laboratory

standardisation. Standardised spectra of microorganisms are available commercially

for speciation purposes. Yet variations in culturing techniques can affect the score of


different species (172). Development of a standardised protocol for MALDI-TOF MS is

essential for adoption into the clinical microbiology laboratory. The ability to apply

MALDI-TOF MS directly to clinical material would further increase the rapidity of the

technique, negating the need for an O/N culture (342). MALDI-TOF MS as an adjunct to

antimicrobial susceptibility testing has not yet emerged, but application has begun.

The application of next generation sequencing (NGS) to the clinical microbiology

laboratory has been the source of much discussion(179). NGS has become a relatively

affordable technology, with a bacterial whole genome sequence generated for as little

as $100 (336). NGS also offers a single universal methodology to determine the

complete nucleotide sequence of a pathogen. Detection of antibiotic resistance

determinants is generally by comparison of resistant and susceptible bacterial isolates.

This affords NGS the ability to determine the presence of both known, and novel

antibiotic resistance determinants in a single reaction. However, a major limitation of

the clinical application of NGS is that draft genome assembly do not generally include

sequence containing repeated elements (256). Draft genomes for the most part can be a

computerised process with the right software and pipelines available. However,

repeated elements (mobile elements, genes containing internal repeat structures, genes

repeated in more than one genomic location) can be “resistant” to computerised

assembly. Repeated elements such as insertion sequences are often associated with

antimicrobial resistance genes, of which they themselves can also be replicated.

Fleshing out repeat regions and their location is generally encompassed in the

‘finishing’ stage of genome assembly, which is arduous, labour-intensive, and can take

anywhere from months to years to complete (225). To be competitive with other more-

rapid technologies, NGS reactions and subsequent genome assembly needs to be

completed within the 18-24 h window of antimicrobial susceptibility testing to make

NGS a viable molecular complement to phenotypic testing (179). To reduce time spent

analysing NGS data, and to minimise data interpretation error, algorithms and/or

pipelines would need to be developed for contig assembly and data comparison against

a database of comparator sequences that includes repeated elements. This process

would also reduce human data interpretation error, and the need for specialised

training of laboratory staff.

However, the reads produced by the NGS technologies are relatively short, which can

make the de novo genome assembly a challenging enterprise. Accordingly, the term

__________________________________________________________________________________________________________________________________________


‘whole genome sequence’ refers often to only approximately 90% of the entire genome.

The gaps between assembled regions (contigs) are mainly caused by the presence of

dispersed or tandemly arrayed repeats.

The current study has demonstrated that the presence of an ESBL-encoding blaSHV or

blaTEM gene does not always confer a third-generation cephalosporin-resistant

phenotype. SHV- and TEM-ESBL-mediated antibiotic resistance relies on multiple

genetic events to confer a resistance phenotype - strong promoter sequences, bla gene

amplification, and the acquisition of an ESBL-conferring mutation. blaTEM and blaSHV

promoter sequences are key indicators of the potential to acquire an ESBL phenotype.

In addition to determining the presence of an ESBL, discrimination of bla promoter

variants in clinical isolates can predict the outcomes of selective pressure with third-

generation cephalosporins. The ability of molecular markers to predict the acquisition

of point mutations creating ESBLs, and the expression of phenotypic resistance to

third-generation cephalosporins demonstrates the added benefit of incorporating

genotypic testing into current antimicrobial susceptibility testing procedures,

regarding both treatment efficacy and limiting the selection of ESBL-mediated

antibiotic resistance. Future research emerging from this project could include

determining if gene amplification and more efficient promoters are associated with

ESBL genotype acquisition in other bla gene families, and the application of these

findings toward antimicrobial susceptibility testing.


BIBLIOGRAPHY

1. Aathithan S, French GL. 2010. Hypermutability in clinical isolates of Klebsiella

pneumoniae is uncommon and is unrelated to ciprofloxacin resistance. International Journal of Antimicrobial Agents 36:239-242.

2. Aihara M, Yamamoto S, Nishioka H, Inoue Y, Hamano K, Oka M, Mizukami Y. 2012. Optimizing high-resolution melting analysis for the detection of mutations of GPR30/GPER-1 in breast cancer. Gene 501:118-126.

3. Aktipis S, Martz WW, Kindelis A. 1975. Thermal denaturation of the DNA-ethidium complex. Redistribution of the intercalated dye during melting. Biochemistry 14:326-331.

4. Alam MR, Donabedian S, Brown W, Gordon J, Chow JW, Zervos MJ, Hershberger E. 2001. Heteroresistance to Vancomycin in Enterococcus

faecium. Journal of Clinical Microbiology 39:3379-3381.

5. Albertí S, Rodríquez-Quiñones F, Schirmer T, Rummel G, Tomás JM, Rosenbusch JP, Benedí VJ. 1995. A porin from Klebsiella pneumoniae: sequence homology, three-dimensional model, and complement binding. Infection and Immunity 63:903-910.

6. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology 215:403-410.

7. Ambler RP. 1980. The structure of beta-lactamases. Philos.Trans.R.Soc.Lond.B.Biol.Sci. 289:321-331.

8. Ambler RP, Coulson AF, Frere JM, Ghuysen JM, Joris B, Forsman M, Levesque RC, Tiraby G, Waley SG. 1991. A standard numbering scheme for the class A beta-lactamases. The Biochemical journal 276 ( Pt 1):269-270.

9. Andersson DI, Hughes D. 2009. Gene Amplification and Adaptive Evolution in Bacteria. Annual Review of Genetics 43:167-195.

10. Andersson P, Harris T, Tong SY, Giffard PM. 2009. Analysis of blaSHV codon 238 and 240 allele mixtures using Sybr green high-resolution melting analysis. Antimicrobial Agents and Chemotherapy 53:2679-2683.

11. Andes D, Craig WA. 2005. Treatment of infections with ESBL-producing organisms: pharmacokinetic and pharmacodynamic considerations. Clin.Microbiol.Infect. 11 Suppl 6:10-7:10-17.

12. Aoyama H, Sato K, Kato T, Hirai K, Mitsuhashi S. 1987. Norfloxacin resistance in a clinical isolate of Escherichia coli. Antimicrobial Agents and Chemotherapy 31:1640-1641.

13. Applied Biosystems. 1997. User Bulletin #2, ABI Prism 7700 Sequence Detection System.

__________________________________________________________________________________________________________________________________________


14. Ariza J, Pujol M, Cabo J, Peña C, Fernández N, Liñares J, Ayats J, Gudiol F. 1999. Vancomycin in surgical infections due to meticillin-resistant Staphylococcus aureus with heterogeneous resistance to vancomycin. The Lancet 353:1587-1588.

15. Arlet G, Brami G, Decre D, Flippo A, Gaillot O, Lagrange PH, Philippon A. 1995. Molecular characterisation by PCR-restriction fragment length

polymorphism of TEM β-lactamases. FEMS Microbiology Letters 134:203-208.

16. Arlet G, Goussard S, Courvalin P, Philippon A. 1999. Sequences of the genes

for the TEM-20, TEM-21, TEM-22, and TEM-29 extended-spectrum β-lactamases. Antimicrobial Agents and Chemotherapy 43:969-971.

17. Arthur A, Sherratt D. 1979. Dissection of the transposition process: A transposon-encoded site-specific recombination system. Molec. gen. Genet. 175:267-274.

18. Ayala G, Galvan-Portillo M, Chihu L, Fierros G, Sanchez A, Carrillo B, Roman A, Lopez-Carrillo L, Silva-Sanchez J. 2011. Resistance to antibiotics and characterization of Helicobacter pylori strains isolated from antrum and body from adults in Mexico. Microbial Drug Resistance 17:149-155.

19. Azucena E, Mobashery S. 2001. Aminoglycoside-modifying enzymes: mechanisms of catalytic processes and inhibition. Drug Resistance Updates 4:106-117.

20. Babini GS, Livermore DM. 2000. Are SHV β -Lactamases Universal in Klebsiella

pneumoniae? Antimicrobial Agents and Chemotherapy 44:2230.

21. Bae IG, Federspiel JJ, Miró JM, Woods CW, Park L, Rybak MJ, Rude TH, Bradley S, Bukovski S, Garcia de la Maria C, Kanj SS, Korman TM, Marco F, Murdoch DR, Plesiat P, Rodriguez-Creixems M, Reinbott P, Steed L, Tattevin P, Tripodi MF, Newton KL, Corey GR, Fowler VG, Investigator ftICoE-M. 2009. Heterogeneous Vancomycin-Intermediate Susceptibility Phenotype in Bloodstream Methicillin-Resistant Staphylococcus aureus Isolates from an International Cohort of Patients with Infective Endocarditis: Prevalence, Genotype, and Clinical Significance. Journal of Infectious Diseases 200:1355-1366.

22. Bailey JK, Pinyon JL, Anantham S, Hall RM. 2011. Distribution of the blaTEM gene and blaTEM-containing transposons in commensal Escherichia coli. Journal of Antimicrobial Chemotherapy 66:745-751.

23. Barenfanger J, Drake C, Kacich G. 1999. Clinical and Financial Benefits of Rapid Bacterial Identification and Antimicrobial Susceptibility Testing. Journal of Clinical Microbiology 37:1415-1418.

24. Barthelemy M, Guionie M, Labia R. 1978. Beta-Lactamases: Determination of Their Isoelectric Points. Antimicrobial Agents and Chemotherapy 13:695-698.

25. Barzel A, Kupiec M. 2008. Finding a match: how do homologous sequences get together for recombination? Nature Reviews Genetics 9:27-37.


26. Bauer KA, West JE, Balada-Llasat JM, Pancholi P, Stevenson KB, Goff DA. 2010. An antimicrobial stewardship program's impact with rapid polymerase chain reaction methicillin-resistant Staphylococcus aureus/S. aureus blood culture test in patients with S. aureus bacteremia. Clinical Infectious Diseases 51:1074-1080.

27. Bauernfeind A, Stemplinger I, Jungwirth R, Wilhelm R, Chong Y. 1996. Comparative characterization of the cephamycinase blaCMY-1 gene and its

relationship with other β-lactamase genes. Antimicrobial Agents and Chemotherapy 40:1926-1930.

28. Beadle BM, Shoichet BK. 2002. Structural Bases of Stability-function Tradeoffs in Enzymes. Journal of Molecular Biology 321:285-296.

29. Bedenic B, Beader N, Zagar Z. 2001. Effect of inoculum size on the antibacterial activity of cefpirome and cefepime against Klebsiella pneumoniae

strains producing SHV extended-spectrum β-lactamases. Clinical Microbiology and Infection 7:626-635.

30. Bell JM, Turnidge JD, Andersson P. 2010. aac(6')-Ib-cr Genotyping by Simultaneous High-Resolution Melting Analyses of an Unlabeled Probe and Full-Length Amplicon. Antimicrobial Agents and Chemotherapy 54:1378-1380.

31. Berg D. 1985. Mechanisms of Transposition in Bacteria, p. 33-44. In Helinski D, Cohen S, Clewell D, Jackson D, Hollaender A (ed.), Plasmids in Bacteria. Springer US.

32. Berg DE. 1977. Insertion and excision of the transposable kanamycin resistance determinant Tn5. In Bukhari AI, Shapiro, J.A., Adhya, S.L. (ed.), DNA Insertion Elements, Plasmids and Episomes. Cold Spring Harbor Press, New York.

33. Berg DE. 1983. Structural requirement for IS50-mediated gene transposition. Proceedings of the National Academy of Sciences 80:792-796.

34. Berg OG, Winter RB, von Hippel PH. 1981. Diffusion-driven mechanisms of protein translocation on nucleic acids. 1. Models and theory. Biochemistry 20:6929-6948.

35. Berger-Bächi B, Strässle A, Kayser F. 1986. Characterization of an isogenic set of methicillin-resistant and susceptible mutants of Staphylococcus aureus. European Journal of Clinical Microbiology & Infectious Diseases 5:697-701.

36. Bergthorsson U, Andersson DI, Roth JR. 2007. Ohno's dilemma: evolution of new genes under continuous selection. Proceedings of the National Academy of Sciences 104:17004-17009.

37. Bertini A, Poirel L, Bernabeu S, Fortini D, Villa L, Nordmann P, Carattoli A. 2007. Multicopy blaOXA-58 gene as a source of high-level resistance to carbapenems in Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 51:2324-2328.

__________________________________________________________________________________________________________________________________________


38. Bethel CR, Hujer AM, Hujer KM, Thomson JM, Ruszczycky MW, Anderson VE, Pusztai-Carey M, Taracila M, Helfand MS, Bonomo RA. 2006. Role of

Asp104 in the SHV β-Lactamase. Antimicrobial Agents and Chemotherapy 50:4124-4131.

39. Bidet P, Liguori S, Plainvert C, Bonacorsi S, Courroux C, d'Humiéres C, Poyart C, Efstratiou A, Bingen E. 2012. Identification of group A streptococcal emm types commonly associated with invasive infections and antimicrobial resistance by the use of multiplex PCR and high-resolution melting analysis. European Journal of Clinical Microbiology & Infectious Diseases 31:2817-2826.

40. Billard-Pomares T, Tenaillon O, Le Nagard H, Rouy Z, Cruveiller S, Médigue C, Arlet G, Denamur E, Branger C. 2011. Complete Nucleotide Sequence of

Plasmid pTN48, Encoding the CTX-M-14 Extended-Spectrum β-Lactamase from an Escherichia coli O102-ST405 Strain. Antimicrobial Agents and Chemotherapy 55:1270-1273.

41. bioMérieux. 2009. Table 1: Summary of Etest Performance, Interpretive Criteria and Quality Control Ranges. AB bioMérieux, Solna, Sweden.

42. Birkett CI, Ludlam HA, Woodford N, Brown DF, Brown NM, Roberts MT, Milner N, Curran MD. 2007. Real-time TaqMan PCR for rapid detection and

typing of genes encoding CTX-M extended-spectrum β-lactamases. Journal of Medical Microbiology 56:52-55.

43. Bizzini A, Durussel C, Bille J, Greub G, Prod'hom G. 2010. Performance of matrix-assisted laser desorption ionization-time of flight mass spectrometry for identification of bacterial strains routinely isolated in a clinical microbiology laboratory. Journal of Clinical Microbiology 48:1549-1554.

44. Blazquez J, Morosini MI, Negri MC, Baquero F. 2000. Selection of Naturally

Occurring Extended-Spectrum TEM β -Lactamase Variants by Fluctuating β-Lactam Pressure. Antimicrobial Agents and Chemotherapy 44:2182-2184.

45. Boehme CC, Nabeta P, Hillemann D, Nicol MP, Shenai S, Krapp F, Allen J, Tahirli R, Blakemore R, Rustomjee R, Milovic A, Jones M, O'Brien SM, Persing DH, Ruesch-Gerdes S, Gotuzzo E, Rodrigues C, Alland D, Perkins MD. 2010. Rapid molecular detection of tuberculosis and rifampin resistance. New England Journal of Medicine 363:1005-1015.

46. Bonner DP, Sykes RB. 1984. Structure activity relationships among the monobactams. Journal of Antimicrobial Chemotherapy 14:313-327.

47. Bonnet R. 2004. Growing Group of Extended-Spectrum β-Lactamases: the CTX-M Enzymes. Antimicrobial Agents and Chemotherapy 48:1-14.

48. Bradford PA. 2001. Extended-Spectrum β-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clinical Microbiology Reviews 14:933-951.

49. Bridges BA. 2001. Hypermutation in bacteria and other cellular systems. Philos.Trans.R.Soc.Lond.B.Biol.Sci. 356:29-39.


50. Brook I. 1989. Inoculum effect. Reviews of Infectious Diseases 11:361-368.

51. Brown T. 2001. Southern Blotting, Current Protocols in Immunology. John Wiley & Sons, Inc.

52. Bryan LE, Godfrey AJ. 1991. β-lactam antibiotics, mode of action and bacterial resistance, p. 599-664. In Lorian V (ed.), Antibiotics in Laboratory Medicine. Williams and Wilkins, Baltimore.

53. Burckhardt I, Zimmermann S. 2011. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry To Detect Carbapenem Resistance within 1 to 2.5 Hours. Journal of Clinical Microbiology 49:3321-3324.

54. Burgess DS, Hall RG. 2004. In vitro killing of parenteral β-lactams against

standard and high inocula of extended-spectrum β-lactamase and non-ESBL producing Klebsiella pneumoniae. Diagnostic Microbiology and Infectious Disease 49:41-46.

55. Bush K, Jacoby GA, Medeiros AA. 1995. A functional classification scheme for

β-lactamases and its correlation with molecular structure. Antimicrobial Agents and Chemotherapy 39:1211-1233.

56. Chain E, Florey HW, Adelaide MB, Gardner AD, Heatley NG, Jennings MA, Orr-Erwing J, Sanders AG. 1940. Penicillin as a chemotherapeutic agent. Lancet 24:226-231.

57. Chakravorty S, Aladegbami B, Thoms K, Lee JS, Lee EG, Rajan V, Cho EJ, Kim H, Kwak H, Kurepina N, Cho SN, Kreiswirth B, Via LE, Barry CE, III, Alland D. 2011. Rapid Detection of Fluoroquinolone-Resistant and Heteroresistant Mycobacterium tuberculosis by Use of Sloppy Molecular Beacons and Dual Melting-Temperature Codes in a Real-Time PCR Assay. Journal of Clinical Microbiology 49:932-940.

58. Chanawong A, M'Zali FH, Heritage J, Lulitanond A, Hawkey PM. 2000.

Characterisation of extended-spectrum β-lactamases of the SHV family using a combination of PCR-single strand conformational polymorphism (PCR-SSCP) and PCR-restriction fragment length polymorphism (PCR-RFLP). FEMS Microbiology Letters 184:85-89.

59. Charles PGP, Ward PB, Johnson PDR, Howden BP, Grayson ML. 2004. Clinical Features Associated with Bacteremia Due to Heterogeneous Vancomycin-Intermediate Staphylococcus aureus. Clinical Infectious Diseases 38:448-451.

60. Chaves J, Ladona MG, Segura C, Coira A, Reig R, Ampurdanes C. 2001. SHV-1

β-Lactamase Is Mainly a Chromosomally Encoded Species-Specific Enzyme in Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy 45:2856-2861.

61. Chen L, Chavda KD, Mediavilla JR, Zhao Y, Fraimow HS, Jenkins SG, Levi MH, Hong T, Rojtman AD, Ginocchio CC, Bonomo RA, Kreiswirth BN. 2012. Multiplex real-time PCR for detection of an epidemic KPC-producing Klebsiella

__________________________________________________________________________________________________________________________________________


pneumoniae ST258 clone. Antimicrobial Agents and Chemotherapy 56:3444-3447.

62. Chen ST, Clowes RC. 1984. Two improved promoter sequences for the β-lactamase expression arising from a single base-pair substitution. Nucleic Acids Research 12:3219-3234.

63. Chen TL, Chang WC, Kuo SC, Lee YT, Chen CP, Siu LK, Cho WL, Fung CP. 2010. Contribution of a Plasmid-Borne blaOXA-58 Gene with Its Hybrid Promoter

Provided by IS1006 and an ISAba3-Like Element to β-Lactam Resistance in Acinetobacter Genomic Species 13TU. Antimicrobial Agents and Chemotherapy 54:3107-3112.

64. Chen YT, Liao TL, Liu YM, Lauderdale TL, Yan JJ, Tsai SF. 2009. Mobilization of qnrB2 and ISCR1 in Plasmids. Antimicrobial Agents and Chemotherapy 53:1235-1237.

65. Chouchani C, Ben-Achour N, M'Charek A, Belhadj O. 2007. Cloning and sequencing of the class A β-lactamase gene (blaTEM-15) located on a chromosomal Tn801 transposon. Diagnostic Microbiology and Infectious Disease 58:459-463.

66. Claydon MA, Davey SN, Edwards-Jones V, Gordon DB. 1996. The rapid identification of intact microorganisms using mass spectrometry. Nature Biotechnology 14:1584-1586.

67. Clewell DB, Yagi Y, Bauer B. 1975. Plasmid-determined tetracycline resistance in Streptococcus faecalis: evidence for gene amplification during growth in presence of tetracycline. Proceedings of the National Academy of Sciences 72:1720-1724.

68. Clinical and Laboratory Standards Institute. 2009. Methods for dilution antimicrobial susceptibility testing for bacteria that grew aerobically. Approved Standard M1-A10. Clinical and Laboratory Standards Institute, Wayne, PA.

69. Clinical and Laboratory Standards Institute. 2009. Performance standards for antimicrobial susceptibility testing. Nineteenth informational supplement. M100-S19. Clinical and Laboratory Standards Institute, Wayne, PA.

70. Clinical and Laboratory Standards Institute. 2010. Clinical and Laboratory Standards Institute M100-20 (2010) Cephalosporin and Aztreonam Breakpoint Revisions Fact Sheet. Clinical and Laboratory Standards Institute, Wayne, PA.

71. Clinical and Laboratory Standards Institute. 2010. Performance Standards for Antimicrobial Susceptibility Testing: Twentieth Information Supplement M100-20. Clinical and Laboratory Standards Institute, Wayne, PA.

72. Clinical and Laboratory Standards Institute. 2012. Performance standards for antimicrobial disk susceptibility tests. Approved Standard M02-A11. Eleventh Edition. Clinical and Laboratory Standards Institute, Wayne, PA.


73. Clinical and Laboratory Standards Institute. 2013. Performance standards for antimicrobial susceptibility testing. Twenty-third informational supplement. M100-S23. Clinical and Laboratory Standards Institute, Wayne, PA.

74. Corvec S, Caroff N, Cosano D, Dauvergne S, Drugeon H, Reynaud A. 2006.

Increased resistance to β-lactams in a Klebsiella pneumoniae strain: role of a deletion downstream of the Pribnow box in the blaSHV-1 promoter. International Journal of Antimicrobial Agents 28:308-312.

75. Craig WA, Bhavnani SM, Ambrose PG. 2004. The inoculum effect: fact or artifact? Diagnostic Microbiology and Infectious Disease 50:229-230.

76. Cui L, Ma X, Sato K, Okuma K, Tenover FC, Mamizuka EM, Gemmell CG, Kim MN, Ploy MC, El Solh N, Ferraz V, Hiramatsu K. 2003. Cell Wall Thickening Is a Common Feature of Vancomycin Resistance in Staphylococcus aureus. Journal of Clinical Microbiology 41:5-14.

77. Dakh F. 2008. Mutation Frequency of Non-ESBL Phenotype SENTRY (Asia-Pacific) Isolates of Klebsiella pneumoniae Conversion to an ESBL Positive Phenotype. Queensland University of Technology.

78. Datta N, Kontomichalou P. 1965. Penicillinase synthesis controlled by infectious R factors in Enterobacteriaceae. Nature 208:239-241.

79. De Champs C, Chanal C, Sirot D, Baraduc R, Romaszko JP, Bonnet R, Plaidy A, Boyer M, Carroy E, Gbadamassi MC, Laluque S, Oules O, Poupart MC, Villemain M, Sirot J. 2004. Frequency and diversity of Class A extended-

spectrum β-lactamases in hospitals of the Auvergne, France: a 2 year prospective study. Journal of Antimicrobial Chemotherapy 54:634-639.

80. De Champs C, Rich C, Chandezon P, Chanal C, Sirot D, Forestier C. 2004. Factors associated with antimicrobial resistance among clinical isolates of Klebsiella pneumoniae: 1-year survey in a French university hospital. European Journal of Clinical Microbiology & Infectious Diseases 23:456-462.

81. Delmas J, Robin F, Bittar F, Chanal C, Bonnet R. 2005. Unexpected enzyme TEM-126: role of mutation Asp179Glu. Antimicrobial Agents and Chemotherapy 49:4280-4287.

82. Do H, Krypuy M, Mitchell PL, Fox SB, Dobrovic A. 2008. High resolution melting analysis for rapid and sensitive EGFR and KRAS mutation detection in formalin fixed paraffin embedded biopsies. BMC Cancer 8:142.:142.

83. Doern GV, Vautour R, Gaudet M, Levy B. 1994. Clinical impact of rapid in vitro susceptibility testing and bacterial identification. Journal of Clinical Microbiology 32:1757-1762.

84. Doménech-Sánchez A, Hernández-Allés S, Martínez-Martínez L, Benedí VJ, Albertí S. 1999. Identification and Characterization of a New Porin Gene of Klebsiella pneumoniae: Its Role in β-Lactam Antibiotic Resistance. Journal of Bacteriology 181:2726-2732.

__________________________________________________________________________________________________________________________________________


85. Douthart RJ, Burnett JP, Beasley FW, Frank BH. 1973. Binding of ethidium bromide to double-stranded ribonucleic acid. Biochemistry 12:214-220.

86. Dubois V, Arpin C, Noury P, Quentin C. 2002. Clinical Strain of Pseudomonas aeruginosa Carrying a blaTEM-21 Gene Located on a Chromosomal Interrupted TnA Type Transposon. Antimicrobial Agents and Chemotherapy 46:3624-3626.

87. Dwight Z, Palais R, Wittwer CT. 2011. uMELT: prediction of high-resolution melting curves and dynamic melting profiles of PCR products in a rich web application. Bioinformatics 27:1019-1020.

88. Eagle H. 1949. The effect on the size of the inoculum and the age of the infection on the curative dose of penicillin in experimental infections with Streptococci, Pneumococci, and Treponema pallidum. The Journal of Experimental Medicine 90:595-607.

89. Ellem J, Partridge SR, Iredell JR. 2011. Efficient direct extended-spectrum β-lactamase detection by multiplex real-time PCR: accurate assignment of phenotype by use of a limited set of genetic markers. Journal of Clinical Microbiology 49:3074-3077.

90. Endimiani A, Hujer AM, Perez F, Bethel CR, Hujer KM, Kroeger J, Oethinger M, Paterson DL, Adams MD, Jacobs MR, Diekema DJ, Hall GS, Jenkins SG, Rice LB, Tenover FC, Bonomo RA. 2009. Characterization of blaKPC-containing Klebsiella pneumoniae isolates detected in different institutions in the Eastern USA. Journal of Antimicrobial Chemotherapy 63:427-437.

91. Eng RH, Cherubin C, Smith SM, Buccini F. 1985. Inoculum effect of beta-lactam antibiotics on Enterobacteriaceae. Antimicrobial Agents and Chemotherapy 28:601-606.

92. Ereqat S, Bar-Gal GK, Nasereddin A, Azmi K, Qaddomi SE, Greenblatt CL, Spigelman M, Abdeen Z. 2010. Rapid differentiation of Mycobacterium

tuberculosis and M. bovis by high-resolution melt curve analysis. Journal of Clinical Microbiology 48:4269-4272.

93. Ericsson HM, Sherris JC. 1971. Antibiotic sensitivity testing. Report of an international collaborative study. Acta Pathol.Microbiol.Scand.B.Microbiol.Immunol. 217:Suppl 217:1:Suppl.

94. Essack SY. 2001. The development of β-lactam antibiotics in response to the

evolution of β-lactamases. Pharmaceutical Research 18:1391-1399.

95. EUCAST. 2010. Breakpoint tables for interpretation of MICs and zone diameters v1.1. EUCAST.

96. EUCAST. 2012. Antimicrobial susceptibility testing EUCAST disk diffusion method v2.1. EUCAST.




99. Falagas ME, Makris GC, Dimopoulos G, Matthaiou DK. 2008. Heteroresistance: a concern of increasing clinical significance? Clinical Microbiology and Infection 14:101-104.

100. Fiett J, Palucha A, Miaczynska B, Stankiewicz M, Przondo-Mordarska H, Hryniewicz W, Gniadkowski M. 2000. A novel complex mutant β-lactamase, TEM-68, identified in a Klebsiella pneumoniae isolate from an outbreak of

extended-spectrum β-lactamase-producing Klebsiellae. Antimicrobial Agents and Chemotherapy 44:1499-1505.

101. Fleming A. 1929. On the antibacterial action of cultures of a penicillium, with special reference to their use in the isolation of B. influenzae. British Journal of Experimental Pathology 10:226-236.

102. Fong R, Low J, Koh T, Kurup A. 2009. Clinical features and treatment outcomes of vancomycin-intermediate Staphylococcus aureus (VISA) and heteroresistant vancomycin-intermediate Staphylococcus aureus (hVISA) in a tertiary care institution in Singapore. European Journal of Clinical Microbiology & Infectious Diseases 28:983-987.

103. Ford PJ, Avison MB. 2004. Evolutionary mapping of the SHV β-lactamase and evidence for two separate IS26-dependent blaSHV mobilization events from the Klebsiella pneumoniae chromosome. Journal of Antimicrobial Chemotherapy 54:69-75.

104. Fournier B, Lu CY, Lagrange PH, Krishnamoorthy R, Philippon A. 1995.

Point mutation in the pribnow box, the molecular basis of β-lactamase overproduction in Klebsiella oxytoca. Antimicrobial Agents and Chemotherapy 39:1365-1368.

105. Frere JM, Joris B. 1985. Penicillin-sensitive enzymes in peptidoglycan biosynthesis. Critical Reviews in Microbiology 11:299-396.

106. Fujii R, Kitaoka M, Hayashi K. 2004. One-step random mutagenesis by error-prone rolling circle amplification. Nucleic Acids Research 32:e145-e145.

107. Fukui T, Ohe Y, Tsuta K, Furuta K, Sakamoto H, Takano T, Nokihara H, Yamamoto N, Sekine I, Kunitoh H, Asamura H, Tsuchida T, Kaneko M, Kusumoto M, Yamamoto S, Yoshida T, Tamura T. 2008. Prospective study of the accuracy of EGFR mutational analysis by high-resolution melting analysis in small samples obtained from patients with non-small cell lung cancer. Clinical Cancer Research 14:4751-4757.

108. Gan LS, Loh JP. 2010. Rapid identification of chloroquine and atovaquone drug resistance in Plasmodium falciparum using high-resolution melt polymerase chain reaction. Malaria Journal 9:134.:134.

109. Garcia-Cobos S, Campos J, Cercenado E, Roman F, Lazaro E, Perez-Vazquez M, de AF, Oteo J. 2008. Antibiotic resistance in Haemophilus influenzae

__________________________________________________________________________________________________________________________________________


decreased, except for β-lactamase-negative amoxicillin-resistant isolates, in parallel with community antibiotic consumption in Spain from 1997 to 2007. Antimicrobial Agents and Chemotherapy 52:2760-2766.

110. Garza-Ramos U, Davila G, Gonzalez V, puche-Aranda C, Lopez-Collada VR, cantar-Curiel D, Newton O, Silva-Sanchez J. 2009. The blaSHV-5 gene is encoded in a compound transposon duplicated in tandem in Enterobacter

cloacae. Clinical Microbiology and Infection.

111. Germer S, Higuchi R. 2003. Homogeneous allele-specific PCR in SNP genotyping. Methods in Molecular Biology 212:197-214.:197-214.

112. Germer S, Holland MJ, Higuchi R. 2000. High-throughput SNP allele-frequency determination in pooled DNA samples by kinetic PCR. Genome Research 10:258-266.

113. Geyer CN, Reisbig MD, Hanson ND. 2012. Development of a TaqMan multiplex

PCR assay for detection of plasmid-mediated ampC β-lactamase genes. Journal of Clinical Microbiology 50:3722-3725.

114. Ghuysen JM. 1991. Serine β-lactamases and penicillin-binding proteins. Annual Review of Microbiology 45:37-67.:37-67.

115. Giebel R, Worden C, Rust SM, Kleinheinz GT, Robbins M, Sandrin TR. 2010. Chapter 6 - Microbial Fingerprinting using Matrix-Assisted Laser Desorption Ionization Time-Of-Flight Mass Spectrometry (MALDI-TOF MS): Applications and Challenges, p. 149-184. In Allen IL (ed.), Advances in Applied Microbiology, Volume 71 ed. Academic Press.

116. Giffard PM, McMahon JA, Gustafson HM, Barnard RT, Voisey J. 2001. Comparison of competitively primed and conventional allele-specific nucleic acid amplification. Analytical Biochemistry 292:207-215.

117. Giglio S, Monis PT, Saint CP. 2003. Demonstration of preferential binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR. Nucleic Acids Research 31:e136.

118. Glupczynski Y, Berhin C, Bauraing C, Bogaerts P. 2007. Evaluation of a New Selective Chromogenic Agar Medium for Detection of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae. Journal of Clinical Microbiology 45:501-505.

119. Gniadkowski M. 2008. Evolution of extended-spectrum β-lactamases by mutation. Clinical Microbiology and Infection 14 Suppl 1:11-32.

120. Goldstein EJ, Citron DM, Cherubin CE. 1991. Comparison of the inoculum effects of members of the family Enterobacteriaceae on cefoxitin and other

cephalosporins, β-lactamase inhibitor combinations, and the penicillin-derived components of these combinations. Antimicrobial Agents and Chemotherapy 35:560-566.


121. Gordon NC, Wareham DW. 2009. Failure of the MicroScan WalkAway system to detect heteroresistance to carbapenems in a patient with Enterobacter

aerogenes bacteremia. Journal of Clinical Microbiology 47:3024-3025.

122. Goussard S, Courvalin P. 1999. Updated sequence information for TEM β-lactamase genes. Antimicrobial Agents and Chemotherapy 43:367-370.

123. Goussard S, Sougakoff W, Mabilat C, Bauernfeind A, Courvalin P. 1991. An

IS1-like element is responsible for high-level synthesis of extended-spectrum β-lactamase TEM-6 in Enterobacteriaceae. Journal of General Microbiology 137:2681-2687.

124. Graham R, Liew M, Meadows C, Lyon E, Wittwer CT. 2005. Distinguishing Different DNA Heterozygotes by High-Resolution Melting. Clinical Chemistry 51:1295-1298.

125. Grindley ND, Joyce CM. 1980. Genetic and DNA sequence analysis of the kanamycin resistance transposon Tn903. Proceedings of the National Academy of Sciences 77:7176-7180.

126. Gundry CN, Vandersteen JG, Reed GH, Pryor RJ, Chen J, Wittwer CT. 2003. Amplicon Melting Analysis with Labeled Primers: A Closed-Tube Method for Differentiating Homozygotes and Heterozygotes. Clinical Chemistry 49:396-406.

127. Hammond DS, Harris T, Bell J, Turnidge J, Giffard PM. 2008. Selection of SHV

Extended-Spectrum-β-Lactamase-Dependent Cefotaxime and Ceftazidime Resistance in Klebsiella pneumoniae Requires a Plasmid-Borne blaSHV Gene. Antimicrobial Agents and Chemotherapy 52:441-445.

128. Hammond DS, Schooneveldt JM, Nimmo GR, Huygens F, Giffard PM. 2005. blaSHV Genes in Klebsiella pneumoniae: Different Allele Distributions Are Associated with Different Promoters within Individual Isolates. Antimicrobial Agents and Chemotherapy 49:256-263.

129. Hancock RE, Bellido F. 1992. Factors involved in the enhanced efficacy against gram-negative bacteria of fourth generation cephalosporins. Journal of Antimicrobial Chemotherapy 29 Suppl A:1-6.:1-6.

130. Hart CA, Percival A. 1982. Resistance to cephalosporins among gentamicin-resistant klebsiellae. Journal of Antimicrobial Chemotherapy 9:275-286.

131. Hashimoto H, Rownd RH. 1975. Transition of the R factor NR1 and Proteus

mirabilis: level of drug resistance of nontransitioned and transitioned cells. Journal of Bacteriology 123:56-68.

132. Hawley JS, Murray CK, Jorgensen JH. 2008. Colistin Heteroresistance in Acinetobacter and Its Association with Previous Colistin Therapy. Antimicrobial Agents and Chemotherapy 52:351-352.

133. Hedges RW, Jacob AE. 1974. Transposition of ampicillin resistance from RP4 to other replicons. Molecular and General Genetics 132:31-40.

__________________________________________________________________________________________________________________________________________


134. Heffron F. 1983. Tn3 and its relatives. In Shapiro JA (ed.), Mobile Genetic Elements. Academic Press, New York.

135. Heffron F, Sublett R, Hedges RW, Jacob A, Falkow S. 1975. Origin of the TEM beta-lactamase gene found on plasmids. The Journal of Bacteriology 122:250-256.

136. Helb D, Jones M, Story E, Boehme C, Wallace E, Ho K, Kop J, Owens MR, Rodgers R, Banada P, Safi H, Blakemore R, Lan NT, Jones-Lopez EC, Levi M, Burday M, Ayakaka I, Mugerwa RD, McMillan B, Winn-Deen E, Christel L, Dailey P, Perkins MD, Persing DH, Alland D. 2010. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. Journal of Clinical Microbiology 48:229-237.

137. Helfand MS, Bonomo RA. 2003. Beta-lactamases: a survey of protein diversity. Current Drug Targets - Infectious Disorders 3:9-23.

138. Hernan RC, Karina B, Gabriela G, Marcela N, Carlos V, Angela F. 2009. Selection of colistin-resistant Acinetobacter baumannii isolates in postneurosurgical meningitis in an intensive care unit with high presence of heteroresistance to colistin. Diagnostic Microbiology and Infectious Disease 65:188-191.

139. Hewson K, Noormohammadi AH, Devlin JM, Mardani K, Ignjatovic J. 2009. Rapid detection and non-subjective characterisation of infectious bronchitis virus isolates using high-resolution melt curve analysis and a mathematical model. Archives of Virology 154:649-660.

140. Hewson KA, Browning GF, Devlin JM, Ignjatovic J, Noormohammadi AH. 2010. Application of high-resolution melt curve analysis for classification of infectious bronchitis viruses in field specimens. Australian Veterinary Journal 88:408-413.

141. Higuchi R, Dollinger G, Walsh PS, Griffith R. 1992. Simultaneous amplification and detection of specific DNA sequences. Biotechnology 10:413-417.

142. Hindiyeh M, Smollan G, Grossman Z, Ram D, Robinov J, Belausov N, Ben-David D, Tal I, Davidson Y, Shamiss A, Mendelson E, Keller N. 2011. Rapid detection of blaKPC carbapenemase genes by internally controlled real-time PCR assay using bactec blood culture bottles. Journal of Clinical Microbiology 49:2480-2484.

143. Hirakata Y, Matsuda J, Miyazaki Y, Kamihira S, Kawakami S, Miyazawa Y, Ono Y, Nakazaki N, Hirata Y, Inoue M, Turnidge JD, Bell JM, Jones RN, Kohno S. 2005. Regional variation in the prevalence of extended-spectrum β-lactamase-producing clinical isolates in the Asia-Pacific region (SENTRY 1998-2002). Diagnostic Microbiology and Infectious Disease 52:323-329.

144. Hoek KG, Gey van Pittius NC, Moolman-Smook H, Carelse-Tofa K, Jordaan A, van der Spuy GD, Streicher E, Victor TC, van Helden PD, Warren RM.


2008. Fluorometric assay for testing rifampin susceptibility of Mycobacterium

tuberculosis complex. Journal of Clinical Microbiology 46:1369-1373.

145. Hofmann-Thiel S, van Ingen J, Feldmann K, Turaev L, Uzakova GT, Murmusaeva G, van Soolingen D, Hoffmann H. 2009. Mechanisms of heteroresistance to isoniazid and rifampin of Mycobacterium tuberculosis in Tashkent, Uzbekistan. European Respiratory Journal 33:368-374.

146. Holt KE, Thomson NR, Wain J, Phan MD, Nair S, Hasan R, Bhutta ZA, Quail MA, Norbertczak H, Walker D, Dougan G, Parkhill J. 2007. Multidrug-Resistant Salmonella enterica Serovar Paratyphi A Harbors IncHI1 Plasmids Similar to Those Found in Serovar Typhi. Journal of Bacteriology 189:4257-4264.

147. Hooff GP, van Kampen JJA, Meesters RJW, van Belkum A, Goessens WHF, Luider TM. 2011. Characterization of β-Lactamase Enzyme Activity in Bacterial Lysates using MALDI-Mass Spectrometry. Journal of Proteome Research 11:79-84.

148. Hoover JRE. 1983. β-lactam antibiotics, structure activity relationships, p. 119-246. In Demain AL, Solomon NA (ed.), Antibiotics containing the beta-lactam structure, 1 ed. Springer-Verlag, Heidelberg.

149. Hope WW, Drusano GL, Moore CB, Sharp A, Louie A, Walsh TJ, Denning DW, Warn PA. 2007. Effect of neutropenia and treatment delay on the response to antifungal agents in experimental disseminated candidiasis. Antimicrobial Agents and Chemotherapy 51:285-295.

150. Howard C, van Daal A, Kelly G, Schooneveldt J, Nimmo G, Giffard PM. 2002.

Identification and Minisequencing-Based Discrimination of SHV β-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia. Antimicrobial Agents and Chemotherapy 46:659-664.

151. Howden BP, Davies JK, Johnson PDR, Stinear TP, Grayson ML. 2010. Reduced Vancomycin Susceptibility in Staphylococcus aureus, Including Vancomycin-Intermediate and Heterogeneous Vancomycin-Intermediate Strains: Resistance Mechanisms, Laboratory Detection, and Clinical Implications. Clinical Microbiology Reviews 23:99-139.

152. Hrabák J, Walková R, Študentová V, Chudácková E, Bergerová T. 2011. Carbapenemase Activity Detection by Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry. Journal of Clinical Microbiology 49:3222-3227.

153. Hrncirova K, Lengerova M, Kocmanova I, Racil Z, Volfova P, Palousova D, Moulis M, Weinbergerova B, Winterova J, Toskova M, Pospisilova S, Mayer J. 2010. Rapid detection and identification of mucormycetes from culture and tissue samples by use of high-resolution melt analysis. J.Clin.Microbiol. 48:3392-3394.

154. Hsueh PR, Ko WC, Wu JJ, Lu JJ, Wang FD, Wu HY, Wu TL, Teng LJ. 2010. Consensus Statement on the Adherence to Clinical and Laboratory Standards

__________________________________________________________________________________________________________________________________________


Institute (CLSI) Antimicrobial Susceptibility Testing Guidelines (CLSI-2010 and CLSI-2010-update) for Enterobacteriaceae in Clinical Microbiology Laboratories in Taiwan. Journal of Microbiology, Immunology and Infection 43:452-455.

155. Huang CC, Chen YS, Toh HS, Lee YL, Liu YM, Ho CM, Lu PL, Liu CE, Chen YH, Wang JH, Tang HJ, Yu KW, Liu YC, Chuang YC, Xu Y, Ni Y, Ko WC, Hsueh PR. 2012. Impact of revised CLSI breakpoints for susceptibility to third-generation cephalosporins and carbapenems among Enterobacteriaceae isolates in the Asia-Pacific region: results from the Study for Monitoring Antimicrobial Resistance Trends (SMART), 2002-2010. International Journal of Antimicrobial Agents 40, Supplement 1:S4-S10.

156. Huang MM, Arnheim N, Goodman MF. 1992. Extension of base mispairs by Taq DNA polymerase: implications for single nucleotide discrimination in PCR. Nucleic Acids Research 20:4567-4573.

157. Huang T-D, Bogaerts P, Berhin C, Guisset A, Glupczynski Y. 2010. Evaluation of Brilliance ESBL Agar, a Novel Chromogenic Medium for Detection of Extended-Spectrum-Beta- Lactamase-Producing Enterobacteriaceae. Journal of Clinical Microbiology 48:2091-2096.

158. Huang XZ, Cash DM, Chahine MA, Nikolich MP, Craft DW. 2012. Development and validation of a multiplex TaqMan real-time PCR for rapid detection of genes encoding four types of class D carbapenemase in Acinetobacter baumannii. Journal of Medical Microbiology 61:1532-1537.

159. Huang ZM, Mao PH, Chen Y, Wu L, Wu J. 2004. Study on the molecular

epidemiology of SHV type β-lactamase-encoding genes of multiple-drug-resistant Acinetobacter baumannii. Zhonghua Liu Xing Bing Xue Za Zhi 25:425-427.

160. Hudson RE, Bergthorsson U, Roth JR, Ochman H. 2002. Effect of Chromosome Location on Bacterial Mutation Rates. Molecular Biology and Evolution 19:85-92.

161. Huletsky A, Knox JR, Levesque RC. 1993. Role of Ser-238 and Lys-240 in the

hydrolysis of third-generation cephalosporins by SHV-type β-lactamases probed by site-directed mutagenesis and three-dimensional modeling. Journal of Biological Chemistry 268:3690-3697.

162. Hung KH, Wang MC, Huang AH, Yan JJ, Wu JJ. 2012. Heteroresistance to Cephalosporins and Penicillins in Acinetobacter baumannii. Journal of Clinical Microbiology 50:721-726.

163. Iida S, Mollet B, Meyer J, Arber W. 1984. Functional characterization of the prokaryotic mobile genetic element IS26. Molecular and General Genetics 198:84-89.

164. Ikonomidis A, Neou E, Gogou V, Vrioni G, Tsakris A, Pournaras S. 2009. Heteroresistance to Meropenem in Carbapenem-Susceptible Acinetobacter

baumannii. Journal of Clinical Microbiology 47:4055-4059.


165. Jacoby GA, Carreras I. 1990. Activities of β-lactam antibiotics against

Escherichia coli strains producing extended-spectrum β-lactamases. Antimicrobial Agents and Chemotherapy 34:858-862.

166. Jacoby GA, Medeiros AA. 1991. More extended-spectrum β-lactamases. Antimicrobial Agents and Chemotherapy 35:1697-1704.

167. Jarlier V, Nicolas MH, Fournier G, Philippon A. 1988. Extended broad-

spectrum β-lactamases conferring transferable resistance to newer β-lactam agents in Enterobacteriaceae: hospital prevalence and susceptibility patterns. Reviews of Infectious Diseases 10:867-878.

168. Jorgensen JH, Turnidge JD. 2007. Antibacterial susceptibility tests: dilution and disk diffusion methods, p. 1152-1172. In Murray PR, Baron EJ, Jorgensen JH, Landry ML, Pfaller MA (ed.), Manual of Clinical Microbiology, 9 ed. American Society for Microbiology, Washington DC.

169. Jurinke C, Oeth P, van den BD. 2004. MALDI-TOF mass spectrometry: a versatile tool for high-performance DNA analysis. Molecular Biotechnology 26:147-164.

170. Kagkli DM, Folloni S, Barbau-Piednoir E, Van den Eede G, Van den Bulcke M. 2012. Towards a Pathogenic Escherichia coli Detection Platform Using Multiplex SYBR® Green Real-Time PCR Methods and High Resolution Melting Analysis. PLoS ONE 7:e39287.

171. Kantzanou M, Tassios PT, Tseleni-Kotsovili A, Legakis NJ, Vatopoulos AC. 1999. Reduced susceptibility to vancomycin of nosocomial isolates of methicillin-resistant Staphylococcus aureus. Journal of Antimicrobial Chemotherapy 43:729-731.

172. Karger A, Stock R, Ziller M, Elschner M, Bettin B, Melzer F, Maier T, Kostrzewa M, Scholz HC, Neubauer H, Tomaso H. 2012. Rapid identification of Burkholderia mallei and Burkholderia pseudomallei by intact cell Matrix-assisted Laser Desorption/Ionisation mass spectrometric typing. BMC Microbiology 12:229.

173. Khan SA, Sung K, Layton S, Nawaz MS. 2008. Heteroresistance to vancomycin and novel point mutations in Tn1546 of Enterococcus faecium ATCC 51559. International Journal of Antimicrobial Agents 31:27-36.

174. Khatib R, Jose J, Musta A, Sharma M, Fakih MG, Johnson LB, Riederer K, Shemes S. 2011. Relevance of vancomycin-intermediate susceptibility and heteroresistance in methicillin-resistant Staphylococcus aureus bacteraemia. Journal of Antimicrobial Chemotherapy 66:1594-1599.

175. Kidane D, Graumann PL. 2005. Dynamic formation of RecA filaments at DNA double strand break repair centers in live cells. The Journal of Cell Biology 170:357-366.

__________________________________________________________________________________________________________________________________________


176. Kim JJ, Kim JG, Kwon DH. 2003. Mixed-Infection of Antibiotic Susceptible and Resistant Helicobacter pylori Isolates in a Single Patient and Underestimation of Antimicrobial Susceptibility Testing. Helicobacter 8:202-206.

177. Knothe H, Shah P, Krcmery V, Antal M, Mitsuhashi S. 1983. Transferable resistance to cefotaxime, cefoxitin, cefamandole and cefuroxime in clinical isolates of Klebsiella pneumoniae and Serratia marcescens. Infection 11:315-317.

178. Kopecko DJ, Cohen SN. 1975. Site specific recA-independent recombination between bacterial plasmids: involvement of palindromes at the recombinational loci. Proceedings of the National Academy of Sciences 72:1373-1377.

179. Koser CU, Ellington MJ, Cartwright EJ, Gillespie SH, Brown NM, Farrington M, Holden MT, Dougan G, Bentley SD, Parkhill J, Peacock SJ. 2012. Routine use of microbial whole genome sequencing in diagnostic and public health microbiology. PLoS Pathogens 8:e1002824.

180. Krypuy M, Ahmed AA, Etemadmoghadam D, Hyland SJ, DeFazio A, Fox SB, Brenton JD, Bowtell DD, Dobrovic A. 2007. High resolution melting for mutation scanning of TP53 exons 5-8. BMC Cancer 7:168.:168.

181. Krypuy M, Newnham GM, Thomas DM, Conron M, Dobrovic A. 2006. High resolution melting analysis for the rapid and sensitive detection of mutations in clinical samples: KRAS codon 12 and 13 mutations in non-small cell lung cancer. BMC Cancer 6:295.:295.

182. Kurpiel PM, Hanson ND. 2011. Association of IS5 with divergent tandem blaCMY-2 genes in clinical isolates of Escherichia coli. Journal of Antimicrobial Chemotherapy 66:1734-1738.

183. Lai YC, Wang TH, Huang SH, Yang SS, Wu CH, Chen TK, Lee CL. 2003. Density of Helicobacter pylori may affect the efficacy of eradication therapy and ulcer healing in patients with active duodenal ulcers. World Journal of Gastroenterology 9:1537-1540.

184. Lartigue MF, Leflon-Guibout V, Poirel L, Nordmann P, Nicolas-Chanoine MH. 2002. Promoters P3, Pa/Pb, P4, and P5 Upstream from blaTEM Genes and

Their Relationship to β-Lactam Resistance. Antimicrobial Agents and Chemotherapy 46:4035-4037.

185. Laurie AD, Smith MP, George PM. 2007. Detection of Factor VIII Gene Mutations by High-Resolution Melting Analysis. Clinical Chemistry 53:2211-2214.

186. Ledeboer NA, Hodinka RL. 2011. Molecular Detection of Resistance Determinants. Journal of Clinical Microbiology 49 (no. 9 supplement):S20-S24.

187. Lee HY, Chen CL, Wang SB, Su LH, Chen SH, Liu SY, Wu TL, Lin TY, Chiu CH. 2011. Imipenem heteroresistance induced by imipenem in multidrug-resistant


Acinetobacter baumannii: mechanism and clinical implications. International Journal of Antimicrobial Agents 37:302-308.

188. Lee KY, Hopkins JD, Syvanen M. 1991. Evolved neomycin phosphotransferase from an isolate of Klebsiella pneumoniae. Molecular Microbiology 5:2039-2046.

189. Lee YC, Lee SY, Pyo JH, Kwon DH, Rhee JC, Kim JJ. 2005. Isogenic Variation of Helicobacter pylori Strain Resulting in Heteroresistant Antibacterial Phenotypes in a Single Host In Vivo. Helicobacter 10:240-248.

190. Leflon-Guibout V, Heym B, Nicolas-Chanoine MH. 2000. Updated Sequence Information and Proposed Nomenclature for blaTEM Genes and Their Promoters. Antimicrobial Agents and Chemotherapy 44:3232-3234.

191. Levin-Zaidman S, Frenkiel-Krispin D, Shimoni E, Sabanay I, Wolf SG, Minsky A. 2000. Ordered intracellular RecA-DNA assemblies: A potential site of in vivo RecA-mediated activities. Proceedings of the National Academy of Sciences 97:6791-6796.

192. Li J, Rayner CR, Nation RL, Owen RJ, Spelman D, Tan KE, Liolios L. 2006. Heteroresistance to Colistin in Multidrug-Resistant Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 50:2946-2950.

193. Li XZ, Nikaido H. 2009. Efflux-mediated drug resistance in bacteria: an update. Drugs 69:1555-1623.

194. Liew M, Pryor R, Palais R, Meadows C, Erali M, Lyon E, Wittwer C. 2004. Genotyping of Single-Nucleotide Polymorphisms by High-Resolution Melting of Small Amplicons. Clinical Chemistry 50:1156-1164.

195. Liu Y, Li J, Du J, Hu M, Bai H, Qi J, Gao C, Wei T, Su H, Jin J, Gao P. 2011. Accurate assessment of antibiotic susceptibility and screening resistant strains of a bacterial population by linear gradient plate. Science China Life Science 54:953-960.

196. Livak KJ. 1999. Allelic discrimination using fluorogenic probes and the 5' nuclease assay. Genetic Analysis 14:143-149.

197. Livermore DM. 1987. Mechanisms of resistance to cephalosporin antibiotics. Drugs 34 Suppl 2:64-88.:64-88.

198. Livermore DM. 1995. β-Lactamases in laboratory and clinical resistance. Clinical Microbiology Reviews 8:557-584.

199. Livermore DM, Williams JD. 1996. Mode of action and mechanisms of bacterial resistance, p. 502-577. In Lorian V (ed.), Antibiotics in Laboratory Medicine, 4 ed. Williams and Wilkins, Baltimore.

200. Lo-Ten-Foe JR, de Smet AM, Diederen BMW, Kluytmans JAJW, van Keulen PHJ. 2007. Comparative Evaluation of the VITEK 2, Disk Diffusion, Etest, Broth Microdilution, and Agar Dilution Susceptibility Testing Methods for Colistin in Clinical Isolates, Including Heteroresistant Enterobacter cloacae and

__________________________________________________________________________________________________________________________________________


Acinetobacter baumannii Strains. Antimicrobial Agents and Chemotherapy 51:3726-3730.

201. M'Zali FH, Gascoyne-Binzi DM, Heritage J, Hawkey PM. 1996. Detection of

mutations conferring extended-spectrum activity on SHV β-lactamases using polymerase chain reaction single strand conformational polymorphism (PCR-SSCP). Journal of Antimicrobial Chemotherapy 37:797-802.

202. M'Zali FH, Heritage J, Gascoyne-Binzi DM, Snelling AM, Hawkey PM. 1998. PCR single strand conformational polymorphism can be used to detect the gene

encoding SHV-7 extended-spectrum β-lactamase and to identify different SHV genes within the same strain. Journal of Antimicrobial Chemotherapy 41:123-125.

203. Mabilat C, Courvalin P. 1990. Development of "oligotyping" for

characterization and molecular epidemiology of TEM β-lactamases in members of the family Enterobacteriaceae. Antimicrobial Agents and Chemotherapy 34:2210-2216.

204. Maglio D, Ong C, Banevicius MA, Geng Q, Nightingale CH, Nicolau DP. 2004. Determination of the In Vivo Pharmacodynamic Profile of Cefepime against

Extended-Spectrum-β-Lactamase-Producing Escherichia coli at Various Inocula. Antimicrobial Agents and Chemotherapy 48:1941-1947.

205. Mahillon J, Chandler M. 1998. Insertion Sequences. Microbiology and Molecular Biology Reviews 62:725-774.

206. Mandell GL, Sande MA. 1991. Antimicrobial agents penicillins and

cephalosporins and other β-lactam antibiotics, p. 1065-1098. In Goodman GA, Goodman LS, Gilman A (ed.), Goodman and Gilman's The Pharmaceutical Basis of Therapeutics, 8 ed. MacMillan Publishing Company Inc., New York.

207. Mandviwala T, Shinde R, Kalra A, Sobel JD, Akins RA. 2010. High-throughput identification and quantification of Candida species using high resolution derivative melt analysis of panfungal amplicons. Journal of Molecular Diagnostics 12:91-101.

208. Maor Y, Hagin M, Belausov N, Keller N, Ben-David D, Rahav G. 2009. Clinical Features of Heteroresistant Vancomycin-Intermediate Staphylococcus aureus Bacteremia versus Those of Methicillin-Resistant S. aureus Bacteremia. Journal of Infectious Diseases 199:619-624.

209. Martinez-Martinez L. 2008. Extended-spectrum β-lactamases and the permeability barrier. Clinical Microbiology and Infection 14 Suppl 1:82-89.

210. Martinez JL, Baquero F. 2000. Mutation Frequencies and Antibiotic Resistance. Antimicrobial Agents and Chemotherapy 44:1771-1777.

211. Matagne A, Lamotte-Brasseur J, Frere JM. 1998. Catalytic properties of class

A β-lactamases: efficiency and diversity. Biochemical Journal 330:581-598.


212. Matteo MJ, Granados G, Olmos M, Wonaga A, Catalano M. 2008. Helicobacter

pylori amoxicillin heteroresistance due to point mutations in PBP-1A in isogenic isolates. Journal of Antimicrobial Chemotherapy 61:474-477.

213. Matthew M. 1979. Plasmid-mediated β-lactamases of Gram-negative bacteria: properties and distribution. Journal of Antimicrobial Chemotherapy 5:349-358.

214. Medeiros AA. 1997. Evolution and Dissemination of β-Lactamases Accelerated

by Generations of β-Lactam Antibiotics. Clinical Infectious Diseases 24:S19-S45.

215. Medeiros AA, Jacoby GA. 1986. Beta-lactamase-mediated resistance, p. 49-84. In Quenner SF, Webber JA, Queener SW (ed.), Beta-lactam antibiotics for clinical use. Marcel Dekker Inc., New York.

216. Meletis G, Tzampaz E, Sianou E, Tzavaras I, Sofianou D. 2011. Colistin heteroresistance in carbapenemase-producing Klebsiella pneumoniae. Journal of Antimicrobial Chemotherapy 66:946-947.

217. Mendes RE, Kiyota KA, Monteiro J, Castanheira M, Andrade SS, Gales AC, Pignatari AC, Tufik S. 2007. Rapid detection and identification of metallo-beta-lactamase-encoding genes by multiplex real-time PCR assay and melt curve analysis. Journal of Clinical Microbiology 45:544-547.

218. Moland ES, Hong SG, Thomson KS, Larone DH, Hanson ND. 2007. Klebsiella

pneumoniae Isolate Producing at Least Eight Different β-Lactamases, Including

AmpC and KPC β-Lactamases. Antimicrobial Agents and Chemotherapy 51:800-801.

219. Monteiro J, Widen RH, Pignatari AC, Kubasek C, Silbert S. 2012. Rapid detection of carbapenemase genes by multiplex real-time PCR. Journal of Antimicrobial Chemotherapy 67:906-909.

220. Moore MR, Perdreau-Remington Fo, Chambers HF. 2003. Vancomycin Treatment Failure Associated with Heterogeneous Vancomycin-Intermediate Staphylococcus aureus in a Patient with Endocarditis and in the Rabbit Model of Endocarditis. Antimicrobial Agents and Chemotherapy 47:1262-1266.

221. Morand B, Mühlemann K. 2007. Heteroresistance to penicillin in Streptococcus pneumoniae. Proceedings of the National Academy of Sciences 104:14098-14103.

222. Moshkowitz M, Konikoff FM, Peled Y, Santo M, Hallak A, Bujanover Y, Tiomny E, Gilat T. 1995. High Helicobacter pylori numbers are associated with low eradication rate after triple therapy. Gut 36:845-847.

223. Mugnier P, Dubrous P, Casin I, Arlet G, Collatz E. 1996. A TEM-derived

extended-spectrum β-lactamase in Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 40:2488-2493.

224. Muroi M, Shima K, Igarashi M, Nakagawa Y, Tanamoto Ki. 2012. Application of Matrix-Assisted Laser Desorption Ionization-Time of Flight Mass

__________________________________________________________________________________________________________________________________________


Spectrometry for Discrimination of Laboratory-Derived Antibiotic-Resistant Bacteria. Biological and Pharmaceutical Bulletin 35:1841-1845.

225. Nagarajan N, Cook C, Di Bonaventura M, Ge H, Richards A, Bishop-Lilly K, DeSalle R, Read T, Pop M. 2010. Finishing genomes with limited resources: lessons from an ensemble of microbial genomes. BMC Genomics 11:242.

226. Nasereddin A, Jaffe CL. 2010. Rapid diagnosis of Old World Leishmaniasis by high-resolution melting analysis of the 7SL RNA gene. Journal of Clinical Microbiology 48:2240-2242.

227. Nataraj AJ, Olivos-Glander I, Kusukawa N, Highsmith WE, Jr. 1999. Single-strand conformation polymorphism and heteroduplex analysis for gel-based mutation detection. Electrophoresis 20:1177-1185.

228. Nazarenko I, Lowe B, Darfler M, Ikonomi P, Schuster D, Rashtchian A. 2002. Multiplex quantitative PCR using self-quenched primers labeled with a single fluorophore. Nucleic Acids Research 30:e37.

229. Neoh Hm, Hori S, Komatsu M, Oguri T, Takeuchi F, Cui L, Hiramatsu K. 2007. Impact of reduced vancomycin susceptibility on the therapeutic outcome of MRSA bloodstream infections. Annals of Clinical Microbiology and Antimicrobials 6:13.

230. Neu HC. 1986. β-Lactam antibiotics: structural relationships affecting in vitro activity and pharmacologic properties. Reviews of Infectious Diseases 8 Suppl 3::S237-S259.

231. Neuwirth C, Siebor E, Lopez J, Pechinot A, Kazmierczak A. 1996. Outbreak of TEM-24-producing Enterobacter aerogenes in an intensive care unit and

dissemination of the extended-spectrum β-lactamase to other members of the family enterobacteriaceae. Journal of Clinical Microbiology 34:76-79.

232. Neville SA, Lecordier A, Ziochos H, Chater MJ, Gosbell IB, Maley MW, van Hal SJ. 2011. Utility of matrix-assisted laser desorption ionization-time of flight mass spectrometry following introduction for routine laboratory bacterial identification. Journal of Clinical Microbiology 49:2980-2984.

233. Nijs A, Cartuyvels R, Mewis A, Peeters V, Rummens JL, Magerman K. 2003. Comparison and evaluation of Osiris and Sirscan 2000 antimicrobial susceptibility systems in the clinical microbiology laboratory. Journal of Clinical Microbiology 41:3627-3630.

234. Nikaido H. 1989. Outer membrane barrier as a mechanism of antimicrobial resistance. Antimicrobial Agents and Chemotherapy 33:1831-1836.

235. Nikaido H. 2003. Molecular Basis of Bacterial Outer Membrane Permeability Revisited. Microbiology and Molecular Biology Reviews 67:593-656.

236. Nomoto K, Tsuta K, Takano T, Fukui T, Fukui T, Yokozawa K, Sakamoto H, Yoshida T, Maeshima AM, Shibata T, Furuta K, Ohe Y, Matsuno Y. 2006. Detection of EGFR mutations in archived cytologic specimens of non-small cell


lung cancer using high-resolution melting analysis. American Journal of Clinical Pathology 126:608-615.

237. Nordström K, Ingram LC, Lundbäck A. 1972. Mutations in R Factors of Escherichia coli Causing an Increased Number of R-Factor Copies per Chromosome. Journal of Bacteriology 110:562-569.

238. Nuesch-Inderbinen MT, Hachler H, Kayser FH. 1995. New system based on site-directed mutagenesis for highly accurate comparison of resistance levels

conferred by SHV β-lactamases. Antimicrobial Agents and Chemotherapy 39:1726-1730.

239. Nuesch-Inderbinen MT, Hachler H, Kayser FH. 1996. Detection of genes

coding for extended-spectrum SHV β-lactamases in clinical isolates by a molecular genetic method, and comparison with the E test. European Journal of Clinical Microbiology & Infectious Diseases 15:398-402.

240. Nuesch-Inderbinen MT, Kayser FH, Hachler H. 1997. Survey and molecular

genetics of SHV β-lactamases in Enterobacteriaceae in Switzerland: two novel enzymes, SHV-11 and SHV-12. Antimicrobial Agents and Chemotherapy 41:943-949.

241. Oka A, Sugisaki H, Takanami M. 1981. Nucleotide sequence of the kanamycin resistance transposon Tn903. Journal of Molecular Biology 147:217-226.

242. Oliver A, Mena A. 2010. Bacterial hypermutation in cystic fibrosis, not only for antibiotic resistance. Clinical Microbiology and Infection 16:798-808.

243. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T. 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proceedings of the National Academy of Sciences 86:2766-2770.

244. Ouellette M, Paul GC, Philippon AM, Roy PH. 1988. Oligonucleotide probes

(TEM-1, OXA-1) versus isoelectric focusing in β-lactamase characterization of 114 resistant strains. Antimicrobial Agents and Chemotherapy 32:397-399.

245. Pansegrau W, Miele L, Lurz R, Lanka E. 1987. Nucleotide sequence of the kanamycin resistance determinant of plasmid RP4: homology to other aminoglycoside 3'-phosphotransferases. Plasmid 18:193-204.

246. Papp AC, Pinsonneault JK, Cooke G, Sadee W. 2003. Single nucleotide polymorphism genotyping using allele-specific PCR and fluorescence melting curves. Biotechniques 34:1068-1072.

247. Partridge SR. 2011. Analysis of antibiotic resistance regions in Gram-negative bacteria. FEMS Microbiology Reviews 35:820-855.

248. Partridge SR, Hall RM. 2003. In34, a Complex In5 Family Class 1 Integron Containing orf513 and dfrA10. Antimicrobial Agents and Chemotherapy 47:342-349.

__________________________________________________________________________________________________________________________________________


249. Paterson DL, Bonomo RA. 2005. Extended-Spectrum β-Lactamases: a Clinical Update. Clinical Microbiology Reviews 18:657-686.

250. Peterson BC, Rownd RH. 1985. Drug resistance gene amplification of plasmid NR1 derivatives with various amounts of resistance determinant DNA. Journal of Bacteriology 161:1042-1048.

251. Peterson BC, Rownd RH. 1985. Recombination sites in plasmid drug resistance gene amplification. Journal of Bacteriology 164:1359-1361.

252. Petrosino J, Cantu III C, Palzkill T. 1998. β-Lactamases: protein evolution in real time. Trends in Microbiology 6:323-327.

253. Pettersson M, Sun S, Andersson D, Berg O. 2009. Evolution of new gene functions: simulation and analysis of the amplification model. Genetica 135:309-324.

254. Pettersson ME, Andersson DI, Roth JR, Berg OG. 2005. The amplification model for adaptive mutation: simulations and analysis. Genetics 169:1105-1115.

255. Philippon A, Labia R, Jacoby G. 1989. Extended-spectrum β-lactamases. Antimicrobial Agents and Chemotherapy 33:1131-1136.

256. Phillippy A, Schatz M, Pop M. 2008. Genome assembly forensics: finding the elusive mis-assembly. Genome Biology 9:R55.

257. Piatek AS, Telenti A, Murray MR, El-Hajj H, Jacobs WR, Jr., Kramer FR, Alland D. 2000. Genotypic analysis of Mycobacterium tuberculosis in two distinct populations using molecular beacons: implications for rapid susceptibility testing. Antimicrobial Agents and Chemotherapy 44:103-110.

258. Pietzka AT, Indra A, Stoger A, Zeinzinger J, Konrad M, Hasenberger P, Allerberger F, Ruppitsch W. 2009. Rapid identification of multidrug-resistant Mycobacterium tuberculosis isolates by rpoB gene scanning using high-resolution melting curve PCR analysis. Journal of Antimicrobial Chemotherapy 63:1121-1127.

259. Pitton JS. 1970. Genetic control of the synthesis of penicillinases in various gram-negative bacilli. Pathol.Microbiol.(Basel). 36:299-300.

260. Podbielski A, Schonling J, Melzer B, Haase G. 1991. Different promoters of

SHV-2 and SHV-2a β-lactamase lead to diverse levels of cefotaxime resistance in their bacterial producers. Journal of General Microbiology 137:1667-1675.

261. Podbielski A, Schönling J, Melzer B, Warnatz K, Leusch H-G. 1991. Molecular characterization of a new plasmid-encoded SHV-type β-lactamase (SHV-2 variant) conferring high-level cefotaxime resistance upon Klebsiella pneumoniae. Journal of General Microbiology 137:569-578.

262. Poirel L, Lebessi E, Castro M, Fèvre C, Foustoukou M, Nordmann P. 2004.

Nosocomial Outbreak of Extended-Spectrum β-Lactamase SHV-5-Producing


Isolates of Pseudomonas aeruginosa in Athens, Greece. Antimicrobial Agents and Chemotherapy 48:2277-2279.

263. Polsfuss S, Bloemberg GV, Giger J, Meyer V, Hombach M. 2012. Comparison of European Committee on Antimicrobial Susceptibility Testing (EUCAST) and

CLSI screening parameters for the detection of extended-spectrum β-lactamase production in clinical Enterobacteriaceae isolates. Journal of Antimicrobial Chemotherapy 67:159-166.

264. Pomba-Féria C, Caniça M. 2003. A novel sequence framework (blaTEM-1G) encoding the parental TEM-1 beta-lactamase. FEMS Microbiology Letters 220:177-180.

265. Poole K. 2004. Resistance to β-lactam antibiotics. Cellular and Molecular Life Sciences 61:2200-2223.

266. Post V, Hall RM. 2009. AbaR5, a Large Multiple-Antibiotic Resistance Region Found in Acinetobacter baumannii. Antimicrobial Agents and Chemotherapy 53:2667-2671.

267. Poudyal A, Howden BP, Bell JM, Gao W, Owen RJ, Turnidge JD, Nation RL, Li J. 2008. In vitro pharmacodynamics of colistin against multidrug-resistant Klebsiella pneumoniae. Journal of Antimicrobial Chemotherapy 62:1311-1318.

268. Pournaras S, Kristo I, Vrioni G, Ikonomidis A, Poulou A, Petropoulou D, Tsakris A. 2010. Characteristics of Meropenem Heteroresistance in Klebsiella

pneumoniae Carbapenemase (KPC)-Producing Clinical Isolates of K.

pneumoniae. Journal of Clinical Microbiology 48:2601-2604.

269. Price EP, Smith H, Huygens F, Giffard PM. 2007. High-Resolution DNA Melt Curve Analysis of the Clustered, Regularly Interspaced Short-Palindromic-Repeat Locus of Campylobacter jejuni. Applied and Environmental Microbiology 73:3431-3436.

270. Ptashne K, Cohen SN. 1975. Occurrence of insertion sequence (IS) regions on plasmid deoxyribonucleic acid as direct and inverted nucleotide sequence duplications. The Journal of Bacteriology 122:776-781.

271. Qu Tt, Zhang Jl, Zhou Zh, Wei ZQ, Yu YS, Chen YG, Li LJ. 2009. Heteroresistance to Teicoplanin in Enterococcus faecium Harboring the vanA Gene. Journal of Clinical Microbiology 47:4194-4196.

272. Queenan AM, Foleno B, Gownley C, Wira E, Bush K. 2004. Effects of Inoculum

and β-Lactamase Activity in AmpC- and Extended-Spectrum β-Lactamase (ESBL)-Producing Escherichia coli and Klebsiella pneumoniae Clinical Isolates Tested by Using NCCLS ESBL Methodology. Journal of Clinical Microbiology 42:269-275.

273. Raimondi A, Traverso A, Nikaido H. 1991. Imipenem- and meropenem-resistant mutants of Enterobacter cloacae and Proteus rettgeri lack porins. Antimicrobial Agents and Chemotherapy 35:1174-1180.

__________________________________________________________________________________________________________________________________________


274. Ramirez MV, Cowart KC, Campbell PJ, Morlock GP, Sikes D, Winchell JM, Posey JE. 2010. Rapid detection of multidrug-resistant Mycobacterium

tuberculosis by use of real-time PCR and high-resolution melt analysis. Journal of Clinical Microbiology 48:4003-4009.

275. Reed GH, Wittwer CT. 2004. Sensitivity and Specificity of Single-Nucleotide Polymorphism Scanning by High-Resolution Melting Analysis. Clinical Chemistry 50:1748-1754.

276. Réglier-Poupet H, Naas T, Carrer A, Cady A, Adam J-M, Fortineau N, Poyart C, Nordmann P. 2008. Performance of chromID ESBL, a chromogenic medium for detection of Enterobacteriaceae producing extended-spectrum β-lactamases. Journal of Medical Microbiology 57:310-315.

277. Retailliau HF, Hightower AW, Dixon RE, Allen JR. 1979. Acinetobacter

calcoaceticus: a nosocomial pathogen with an unusual seasonal pattern. Journal of Infectious Diseases 139:371-375.

278. Rice LB, Carias LL, Hujer AM, Bonafede M, Hutton R, Hoyen C, Bonomo RA. 2000. High-Level Expression of Chromosomally Encoded SHV-1 β-Lactamase and an Outer Membrane Protein Change Confer Resistance to Ceftazidime and Piperacillin- Tazobactam in a Clinical Isolate of Klebsiella pneumoniae. Antimicrobial Agents and Chemotherapy 44:362-367.

279. Richter SS, Ferraro MJ. 2007. Susceptibility testing instrumentation and computerized expert systems for data analysis and interpretation, p. 245-256. In Murray PR, Baron EJ, Jorgensen JH, Landry ML, Pfaller MA (ed.), Manual of Clinical Microbiology, 9 ed. American Society for Microbiology, Washington D.C.

280. Riederer K, Shemes S, Chase P, Musta A, Mar A, Khatib R. 2011. Detection of intermediately vancomycin-susceptible and heterogeneous Staphylococcus

aureus isolates: comparison of Etest and Agar screening methods. Journal of Clinical Microbiology 49:2147-2150.

281. Righetti PG. 1983. Isoelectric focusing: Theory, Methodology, and Applications. In Work TS, Burdon RH (ed.), Laboratory Techniques in Biochemistry and Molecular Biology. Elsevier Biomedical Press, Amsterdam.

282. Rinder H. 2001. Hetero-resistance: an under-recognised confounder in diagnosis and therapy? Journal of Medical Microbiology 50:1018-1020.

283. Ririe KM, Rasmussen RP, Wittwer CT. 1997. Product Differentiation by Analysis of DNA Melting Curves during the Polymerase Chain Reaction. Analytical Biochemistry 245:154-160.

284. Robberts FJL, Kohner PC, Patel R. 2009. Unreliable Extended-Spectrum β-Lactamase Detection in the Presence of Plasmid-Mediated AmpC in Escherichia

coli Clinical Isolates. Journal of Clinical Microbiology 47:358-361.

285. Robin F, Delmas J, Schweitzer C, Tournilhac O, Lesens O, Chanal C, Bonnet R. 2007. Evolution of TEM-type enzymes: biochemical and genetic


characterization of two new complex mutant TEM enzymes, TEM-151 and TEM-152, from a single patient. Antimicrobial Agents Chemother. 51:1304-1309.

286. Rodríguez-Baño J, Picón E, Navarro MD, López-Cerero L, Pascual Á, Group tE-R. 2012. Impact of changes in CLSI and EUCAST breakpoints for

susceptibility in bloodstream infections due to extended-spectrum β-lactamase-producing Escherichia coli. Clinical Microbiology and Infection 18:894-900.

287. Rodriguez CH, De AA, Bajuk M, Spinozzi M, Nastro M, Bombicino K, Radice M, Gutkind G, Vay C, Famiglietti A. 2010. In vitro antimicrobials activity against endemic Acinetobacter baumannii multiresistant clones. The Journal of Infection in Developing Countries 4:164-167.

288. Rong SL, Leonard SN. 2010. Heterogeneous Vancomycin Resistance in Staphylococcus aureus: A Review of Epidemiology, Diagnosis, and Clinical Significance. The Annals of Pharmacotherapy 44:844-850.

289. Rosche WA, Foster PL. 2000. Determining Mutation Rates in Bacterial Populations. Methods 20:4-17.

290. Rouleau E, Lefol C, Bourdon V, Coulet F, Noguchi T, Soubrier F, Bieche I, Olschwang S, Sobol H, Lidereau R. 2009. Quantitative PCR high-resolution melting (qPCR-HRM) curve analysis, a new approach to simultaneously screen point mutations and large rearrangements: application to MLH1 germline mutations in Lynch syndrome. Human Mutation 30:867-875.

291. Rozen S, Skaletsky H. 2000. Primer3 on the WWW for general users and for biologist programmers. Methods in Molecular Biology 132:365-86.:365-386.

292. Saiki RK, Scharf S, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N. 1985. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350-1354.

293. Saito R, Koyano S, Nagai R, Okamura N, Moriya K, Koike K. 2010. Evaluation of a chromogenic agar medium for the detection of extended-spectrum β-lactamase-producing Enterobacteriaceae. Letters in Applied Microbiology 51:704-706.

294. Salverda MLM, De Visser JA, Barlow M. 2010. Natural evolution of TEM-1 β-lactamase: experimental reconstruction and clinical relevance. FEMS Microbiology Reviews 34:1015-1036.

295. Sanders CC, Sanders WE, Jr. 1979. Emergence of resistance to cefamandole: possible role of cefoxitin-inducible bet-lactamases. Antimicrobial Agents and Chemotherapy 15:792-797.

296. SantaLucia J, Jr. 1998. A unified view of polymer, dumbbell, and oligonucleotide DNA nearest-neighbor thermodynamics. Proceedings of the National Academy of Sciences 95:1460-1465.

__________________________________________________________________________________________________________________________________________


297. Schooneveldt JM, Nimmo GR, Giffard P. 1998. Detection and characterisation

of extended spectrum β-lactamases in Klebsiella pneumoniae causing nosocomial infection. Pathology. 30:164-168.

298. Schütz E, von Ahsen N. 2009. Influencing factors of dsDNA dye (high-resolution) melting curves and improved genotype call based on thermodynamic considerations. Analytical Biochemistry 385:143-152.

299. Senda K, Arakawa Y, Nakashima K, Ito H, Ichiyama S, Shimokata K, Kato N, Ohta M. 1996. Multifocal outbreaks of metallo-β-lactamase-producing

Pseudomonas aeruginosa resistant to broad-spectrum β-lactams, including carbapenems. Antimicrobial Agents and Chemotherapy 40:349-353.

300. Shapiro JA. 1979. Molecular model for the transposition and replication of bacteriophage Mu and other transposable elements. Proceedings of the National Academy of Sciences 76:1933-1937.

301. Sharma J, Sharma M, Ray P. 2010. Detection of TEM & SHV genes in Escherichia coli & Klebsiella pneumoniae isolates in a tertiary care hospital from India. Indian Journal of Medical Research 132::332-336.

302. Shaw KJ, Rather PN, Hare RS, Miller GH. 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiology and Molecular Biology Reviews 57:138-163.

303. Simi L, Pratesi N, Vignoli M, Sestini R, Cianchi F, Valanzano R, Nobili S, Mini E, Pazzagli M, Orlando C. 2008. High-resolution melting analysis for rapid detection of KRAS, BRAF, and PIK3CA gene mutations in colorectal cancer. American Journal of Clinical Pathology 130:247-253.

304. Simpson IN, Harper PB, O'Callaghan CH. 1980. Principal β-lactamases

responsible for resistance to β-lactam antibiotics in urinary tract infections. Antimicrobial Agents and Chemotherapy 17:929-936.

305. Sionov E, Lee H, Chang YC, Kwon-Chung KJ. 2010. Cryptococcus neoformans Overcomes Stress of Azole Drugs by Formation of Disomy in Specific Multiple Chromosomes. PLoS Pathogens 6:e1000848.

306. Slinger R, Desjardins M, Moldovan I, Harvey SB, Chan F. 2011. A rapid, high-resolution melting (HRM) multiplex PCR assay to detect macrolide resistance determinants in group A streptococcus. International Journal of Antimicrobial Agents 38:183-185.

307. Soriano F, Ponte C, Santamaria M, Jimenez-Arriero M. 1990. Relevance of the inoculum effect of antibiotics in the outcome of experimental infections caused by Escherichia coli. Journal of Antimicrobial Chemotherapy 25:621-627.

308. Sparbier K, Schubert S, Weller U, Boogen C, Kostrzewa M. 2012. Matrix-

Assisted Laser Desorption Ionization−Time of Flight Mass Spectrometry-Based

Functional Assay for Rapid Detection of Resistance against β-Lactam Antibiotics. Journal of Clinical Microbiology 50:927-937.


309. Speldooren V, Heym B, Labia R, Nicolas-Chanoine MH. 1998. Discriminatory

detection of inhibitor-resistant β-lactamases in Escherichia coli by single-strand conformation polymorphism-PCR. Antimicrobial Agents and Chemotherapy 42:879-884.

310. Stamper PD, Cai M, Lema C, Eskey K, Carroll KC. 2007. Comparison of the BD GeneOhm VanR assay to culture for identification of vancomycin-resistant enterococci in rectal and stool specimens. Journal of Clinical Microbiology 45:3360-3365.

311. Stevens DL, Van S, Bryant AE. 1993. Penicillin-Binding Protein Expression at Different Growth Stages Determines Penicillin Efficacy In Vitro and In Vivo: An Explanation for the Inoculum Effect. Journal of Infectious Diseases 167:1401-1405.

312. Sun S, Berg OG, Roth JR, Andersson DI. 2009. Contribution of Gene Amplification to Evolution of Increased Antibiotic Resistance in Salmonella

typhimurium. Genetics 182:1183-1195.

313. Superti SV, Martins DS, Caierao J, Soares FS, Prochnow T, Zavascki AP. 2009. Indications of carbapenem resistance evolution through heteroresistance as an intermediate stage in Acinetobacter baumannii after carbapenem administration. Revista do Instituto de Medicina Tropical de Sao Paulo 51:111-113.

314. Sutcliffe JG. 1978. Nucleotide sequence of the ampicillin resistance gene of Escherichia coli plasmid pBR322. Proceedings of the National Academy of Sciences 75:3737-3741.

315. Swayne RL, Ludlam HA, Shet VG, Woodford N, Curran MD. 2011. Real-time TaqMan PCR for rapid detection of genes encoding five types of non-metallo- (class A and D) carbapenemases in Enterobacteriaceae. International Journal of Antimicrobial Agents 38:35-38.

316. Sykes RB, Matthew M. 1976. The β-lactamases of Gram-negative bacteria and

their role in resistance to β-lactam antibiotics. Journal of Antimicrobial Chemotherapy 2:115-157.

317. Szczepanowski R, Braun S, Riedel V, Schneiker S, Krahn I, Pühler A, Schlüter A. 2005. The 120 592 bp IncF plasmid pRSB107 isolated from a sewage-treatment plant encodes nine different antibiotic-resistance determinants, two iron-acquisition systems and other putative virulence-associated functions. Microbiology 151:1095-1111.

318. Talmi-Frank D, Nasereddin A, Schnur LF, Schonian G, Toz SO, Jaffe CL, Baneth G. 2010. Detection and identification of old world Leishmania by high resolution melt analysis. PLoS Neglected Tropical Diseases 4:e581.

319. Tan C, Phillip SR, Srimani JK, Riccione KA, Prasada S, Kuehn M, You L. 2012. The inoculum effect and band-pass bacterial response to periodic antibiotic treatment. Molecular Systems Biology 8::617.

__________________________________________________________________________________________________________________________________________


320. Tato M, Morosini M, Garcia L, Alberti S, Coque MT, Canton R. 2010. Carbapenem Heteroresistance in VIM-1-Producing Klebsiella pneumoniae Isolates Belonging to the Same Clone: Consequences for Routine Susceptibility Testing. Journal of Clinical Microbiology 48:4089-4093.

321. Tenover FC. 2010. Potential impact of rapid diagnostic tests on improving antimicrobial use. Annals of the New York Academy of Sciences 1213::70-80.

322. Thomson KS, Moland ES. 2001. Cefepime, piperacillin-tazobactam, and the

inoculum effect in tests with extended-spectrum β-lactamase-producing Enterobacteriaceae. Antimicrobial Agents and Chemotherapy 45:3548-3554.

323. Thornsberry C, McDougal LK. 1983. Successful use of broth microdilution in susceptibility tests for methicillin-resistant (heteroresistant) staphylococci. Journal of Clinical Microbiology 18:1084-1091.

324. Tuohy MJ, Reja V, Park S, Perlin DS, Wnek M, Procop GW, Yen-Lieberman B. 2010. Use of a high-resolution melt assay to characterize codon 54 of the cyp51A gene of Aspergillus fumigatus on a Rotor-Gene 6000 instrument. Antimicrobial Agents and Chemotherapy 54:2248-2251.

325. Turner MS, Andersson P, Bell JM, Turnidge JD, Harris T, Giffard PM. 2009. Plasmid-borne blaSHV genes in Klebsiella pneumoniae are associated with strong promoters. Journal of Antimicrobial Chemotherapy 64:960-964.

326. Turnidge J, Paterson DL. 2007. Setting and Revising Antibacterial Susceptibility Breakpoints. Clinical Microbiology Reviews 20:391-408.

327. Vadwai V, Daver G, Udwadia Z, Sadani M, Shetty A, Rodrigues C. 2011. Clonal Population of Mycobacterium tuberculosis Strains Reside within Multiple Lung Cavities. PLoS ONE 6:e24770.

328. Vakulenko SB, Taibi-Tronche P, Tóth M, Massova I, Lerner SA, Mobashery S. 1999. Effects on Substrate Profile by Mutational Substitutions at Positions

164 and 179 of the Class A TEMpUC19 β-Lactamase from Escherichia coli. Journal of Biological Chemistry 274:23052-23060.

329. Vakulenko SB, Toth M, Taibi P, Mobashery S, Lerner SA. 1995. Effects of

Asp-179 mutations in TEMpUC19 β-lactamase on susceptibility to β-lactams. Antimicrobial Agents and Chemotherapy 39:1878-1880.

330. van Belkum A, Durand G, Peyret M, Chatellier S, Zambardi G, Schrenzel J, Shortridge D, Engelhardt A, Dunne WM, Jr. 2013. Rapid clinical bacteriology and its future impact. Annals of Laboratory Medicine 33:14-27.

331. van Belkum A, Welker M, Erhard M, Chatellier S. 2012. Biomedical Mass Spectrometry in Today's and Tomorrow's Clinical Microbiology Laboratories. Journal of Clinical Microbiology 50:1513-1517.

332. van der Bij AK, van Dijk K, Muilwijk J, Thijsen SFT, Notermans DW, de Greeff S, van de Sande-Bruinsma N, group obotI-As. 2012. Clinical breakpoint changes and their impact on surveillance of antimicrobial resistance


in Escherichia coli causing bacteraemia. Clinical Microbiology and Infection 18:E466-E472.

333. van Hal SJ, Paterson DL. 2011. Systematic Review and Meta-Analysis of the Significance of Heterogeneous Vancomycin-Intermediate Staphylococcus aureus Isolates. Antimicrobial Agents and Chemotherapy 55:405-410.

334. van Hal SJ, Wehrhahn MC, Barbagiannakos T, Mercer J, Chen D, Paterson DL, Gosbell IB. 2011. Performance of various testing methodologies for detection of heteroresistant vancomycin-intermediate Staphylococcus aureus in bloodstream isolates. Journal of Clinical Microbiology 49:1489-1494.

335. Vanstone GL, Yorgancioglu A, Wilkie L, Mouskos K, Charalambous BM, Balakrishnan I. 2012. A real-time multiplex PCR assay for the rapid detection of CTX-M-type extended spectrum beta-lactamases directly from blood cultures. Journal of Medical Microbiology 61:1631-1632.

336. Vernet G, Saha S, Satzke C, Burgess DH, Alderson M, Maisonneuve JF, Beall BW, Steinhoff MC, Klugman KP. 2011. Laboratory-based diagnosis of pneumococcal pneumonia: state of the art and unmet needs. Clinical Microbiology and Infection 17:1-13.

337. von Hippel PH, Berg OG. 1989. Facilitated target location in biological systems. Journal of Biological Chemistry 264:675-678.

338. Wainwright M, Swan HT. 1986. C.G. Paine and the earliest surviving clinical records of penicillin therapy. Medical History 30:42-56.

339. Walsh TR, Bolmström A, Qwärnström A, Ho P, Wootton M, Howe RA, MacGowan AP, Diekema D. 2001. Evaluation of Current Methods for Detection of Staphylococci with Reduced Susceptibility to Glycopeptides. Journal of Clinical Microbiology 39:2439-2444.

340. Warren DK, Liao RS, Merz LR, Eveland M, Dunne WM, Jr. 2004. Detection of methicillin-resistant Staphylococcus aureus directly from nasal swab specimens by a real-time PCR assay. Journal of Clinical Microbiology 42:5578-5581.

341. White H, Potts G. 2006. Evaluation of Rotor-Gene™ 6000 (Corbett Life Science), HR-1™ and 384 well LightScanner™ (Idaho Technology). National Genetics Reference Laboratory (Wessex).

342. Wieser A, Schneider L, Jung J, Schubert S. 2012. MALDI-TOF MS in microbiological diagnostics-identification of microorganisms and beyond (mini review). Applied Microbiology and Biotechnology 93:965-974.

343. Wise R, Andrews JM, Bedford KA. 1980. Clavulanic acid and CP-45,899: a comparison of their in vitro activity in combination with penicillins. Journal of Antimicrobial Chemotherapy 6:197-206.

344. Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. 1997. Continuous fluorescence monitoring of rapid cycle DNA amplification. Biotechniques 22:130-138.

__________________________________________________________________________________________________________________________________________


345. Wittwer CT, Reed GH, Gundry CN, Vandersteen JG, Pryor RJ. 2003. High-resolution genotyping by amplicon melting analysis using LCGreen. Clinical Chemistry 49:853-860.

346. Wolff BJ, Thacker WL, Schwartz SB, Winchell JM. 2008. Detection of macrolide resistance in Mycoplasma pneumoniae by real-time PCR and high-resolution melt analysis. Antimicrobial Agents and Chemotherapy 52:3542-3549.

347. Won H, Rothman R, Ramachandran P, Hsieh YH, Kecojevic A, Carroll KC, Aird D, Gaydos C, Yang S. 2010. Rapid identification of bacterial pathogens in positive blood culture bottles by use of a broad-based PCR assay coupled with high-resolution melt analysis. Journal of Clinical Microbiology 48:3410-3413.

348. Wong-Beringer A, Hindler J, Loeloff M, Queenan AM, Lee N, Pegues DA, Quinn JP, Bush K. 2002. Molecular Correlation for the Treatment Outcomes in Bloodstream Infections Caused by Escherichia coli and Klebsiella pneumoniae with Reduced Susceptibility to Ceftazidime. Clinical Infectious Diseases 34:135-146.

349. Wootton M, Howe RA, Hillman R, Walsh TR, Bennett PM, MacGowan AP. 2001. A modified population analysis profile (PAP) method to detect hetero-resistance to vancomycin in Staphylococcus aureus in a UK hospital. Journal of Antimicrobial Chemotherapy 47:399-403.

350. Wright GD, Thompson PR. 1999. Aminoglycoside phosphotransferases: proteins, structure, and mechanism. Frontiers in Bioscience 4:D9-21.

351. Wrighton CJ, Strike P. 1987. A pathway for the evolution of the plasmid NTP16 involving the novel kanamycin resistance transposon Tn4352. Plasmid 17:37-45.

352. Xiang X, Shannon K, French G. 1997. Mechanism and stability of

hyperproduction of the extended-spectrum β-lactamase SHV-5 in Klebsiella

pneumoniae. Journal of Antimicrobial Chemotherapy 40:525-532.

353. Yagi Y, Clewell DB. 1977. Identification and characterization of a small sequence located at two sites on the amplifiable tetracycline resistance plasmid

pAMα1 in Streptococcus faecalis. Journal of Bacteriology 129:400-406.

354. Yang YJ, Livermore DM. 1988. Chromosomal β-lactamase expression and

resistance to β-lactam antibiotics in Proteus vulgaris and Morganella morganii. Antimicrobial Agents and Chemotherapy 32:1385-1391.

355. Yusof A, Engelhardt A, Karlsson A, Bylund L, Vidh P, Mills K, Wootton M, Walsh TR. 2008. Evaluation of a New Etest Vancomycin-Teicoplanin Strip for Detection of Glycopeptide-Intermediate Staphylococcus aureus (GISA), in Particular, Heterogeneous GISA. Journal of Clinical Microbiology 46:3042-3047.

356. Zienkiewicz M, Kern-Zdanowicz I, Golebiewski M, Zylinska J, Mieczkowski P, Gniadkowski M, Bardowski J, Ceglowski P. 2007. Mosaic structure of p1658/97, a 125-kilobase plasmid harboring an active amplicon with the


extended-spectrum β-lactamase gene blaSHV-5. Antimicrobial Agents and Chemotherapy 51:1164-1171.

__________________________________________________________________________________________________________________________________________


APPENDICES

APPENDIX A. MSS-MLE Program in MATLAB R2007a Software1.

1 The computer programs were designed by Joshua C. Chan whose work was supported by the Australian Research Council (Discovery Grant DP0558957)


APPENDIX B. nllike_m.m program1.

1 The computer programs were designed by Joshua C. Chan whose work was supported by the Australian Research Council (Discovery Grant DP0558957)

__________________________________________________________________________________________________________________________________________


APPENDIX C. Actual, 25th, 500th and 975th relative gene copy number iterations derived from error propagation (Chapter 4).

Isolate Iteration

bla gene 25 500 Actuala 975

110-1 0.61103 0.7697299 0.7684375 0.9659956 SHV

110-14 1.727316 2.198517 2.196186 2.807349 SHV

110-18 0.8451428 1.072577 1.068066 1.355449 SHV

110-2 0.7032824 0.8982435 0.8950252 1.115153 SHV

110-22 0.6287373 0.8196226 0.8207417 1.046959 SHV

110-26 0.6496198 0.8255545 0.8235912 1.046046 SHV

110-35 0.5849554 0.7415015 0.7422621 0.9463363 SHV

110-38 1.220145 1.539034 1.547566 1.956298 SHV

110-41 0.6376547 0.8216461 0.8207417 1.038947 SHV

110-50 0.7992458 1.037974 1.024556 1.325949 SHV

110-8 0.9589136 1.213749 1.205808 1.527764 SHV

215-35-A 1 2.049308 2.703879 2.694468 3.508186 TEM

215-35-A 35 5.507556 7.156243 7.135428 9.202123 TEM

215-35-A 54 7.764071 10.21284 10.23189 13.38337 TEM

215-35-A 86 2.035609 2.681066 2.675855 3.472372 TEM

219-08-D 1 7.73102 10.14485 10.16121 13.4465 TEM

222-03-C 1 1.272225 1.670571 1.687631 2.15423 TEM

222-03-C 14 15.86529 20.62466 20.6061 27.00101 TEM

222-03-C 17 1.017651 1.374433 1.36604 1.778003 TEM

222-03-C 23 1.131168 1.495122 1.510472 2.006137 TEM

231-22.2-D 1 1.61883 2.115996 2.121376 2.792191 TEM

231-22.2-D 10 1.284528 1.658714 1.670176 2.163933 TEM

231-22.2-D 11 1.299993 1.704594 1.71119 2.244818 TEM

231-22.2-D 16 1.12215 1.461394 1.479387 1.891558 TEM

231-22.2-D 17 1.23096 1.59621 1.607702 2.080495 TEM

231-22.2-D 2 1.606898 2.058524 2.063366 2.673287 TEM

231-22.2-D 7 1.268857 1.652023 1.647181 2.205202 TEM

231-22.2-D 8 1.299745 1.686213 1.681794 2.218481 TEM

231-22.2-D R1 1.312205 1.717776 1.723091 2.269186 TEM

231-22.2-D R15 1.294236 1.681685 1.687632 2.27657 TEM

231-22.2-D R19 1.461624 1.867538 1.853176 2.376087 TEM

231-22.2-D R20 1.31628 1.726382 1.723091 2.206147 TEM

231-22.2-D R6 1.686791 2.192342 2.181015 2.891945 TEM

236-20-D 13 1.94369 2.513429 2.540302 3.337129 TEM

236-20-D 19 2.463513 3.256488 3.226567 4.177848 TEM

236-20-D 22 3.2125 4.230838 4.228072 5.574551 TEM

236-20-D 30 2.010084 2.655981 2.648179 3.385808 TEM a Relative gene copy number as determined from original CT data


APPENDIX D. Actual, 25th, 500th and 975th relative gene copy number iterations derived from error propagation (Chapter 5).

Isolate Iteration


110-C1-5 6.715098 9.872939 9.781125 14.02717 SHV

110-C1-6 6.847704 9.972366 9.986649 14.1594 SHV

110-C1-7 6.494503 9.519278 9.480744 13.98312 SHV

110-C1-8 10.89102 15.57102 15.56248 22.02554 SHV

110-C1-9 3.97474 5.652705 5.656856 8.217504 SHV

110-C14-1 6.456499 9.311996 9.317867 13.15823 SHV

110-C14-2 6.139112 8.84085 8.754348 12.36788 SHV

110-C14-3 7.515995 10.7931 10.70342 15.46679 SHV

110-C14-4 3.841662 5.540464 5.578973 8.086406 SHV

110-C14-5 1.829448 2.638447 2.620786 3.741487 SHV

110-C2-5 8.948875 12.78379 12.81713 18.38363 SHV

110-C2-6 15.24467 21.80447 22.00868 31.42188 SHV

110-C2-7 1.52248 2.129015 2.136131 3.074654 SHV

110-C2-8 7.871928 11.40862 11.63178 16.36247 SHV

110-C50-1 1.691681 2.355294 2.370185 3.413209 SHV

110-C50-2 1.187405 1.733561 1.753211 2.473524 SHV

110-C50-3 12.28213 17.76632 17.81475 25.21848 SHV

110-C50-4 7.586251 10.82012 10.62948 15.31801 SHV

110-C50-5 12.90516 18.83705 18.76536 27.38759 SHV

110-C50-6 6.52096 9.55324 9.415252 13.92038 SHV

215-35-A-C1-4 0.8757074 1.204455 1.201636 1.712083 TEM

215-35-A-C1-6 1.035891 1.502435 1.50004 2.064029 TEM

215-35-A-C1-7 0.6778027 0.9720476 0.9726546 1.373135 TEM

215-35-A-C1-8 1.099901 1.525498 1.515716 2.138549 TEM

215-35-A-C54-3 0.5139725 0.720855 0.7194669 0.994348 TEM

215-35-A-C54-4 0.6156641 0.9030457 0.9043794 1.290949 TEM

215-35-A-C54-5 0.9163868 1.262653 1.261377 1.761962 TEM

215-35-A-C54-6 0.2756607 0.3947395 0.393654 0.547008 TEM

219-08-D-C1-1 0.7847553 1.091235 1.094295 1.516576 TEM

219-08-D-C1-3 0.2125087 0.2975315 0.297302 0.4181305 TEM

219-08-D-C1-4 0.2799292 0.3913167 0.3909352 0.5399615 TEM

219-08-D-C1-5 0.4539258 0.6492403 0.6439413 0.8864768 TEM

219-08-D-C1-6 0.5570643 0.7611392 0.7631302 1.06919 TEM

219-08-D-C1-7 0.288569 0.4057738 0.4061266 0.5684096 TEM

219-08-D-C1-8 0.4935949 0.6783291 0.6783022 0.9309181 TEM

219-08-D-C1-9 0.3454888 0.4831738 0.4863275 0.6908217 TEM

222-03-C-C14-4 0.8348375 1.135947 1.125058 1.603355 TEM

222-03-C-C14-6 0.8132505 1.123873 1.117287 1.546472 TEM

222-03-C-C14-7 1.311534 1.827379 1.840375 2.590475 TEM

222-03-C-C17-10 0.5902701 0.8146818 0.8066418 1.127957 TEM

222-03-C-C17-11 0.6627241 0.9426486 0.9460574 1.300552 TEM

222-03-C-C17-8 1.921416 2.590014 2.566851 3.652698 TEM

222-03-C-C17-9 0.9090924 1.26829 1.248332 1.748737 TEM

231-22.2-D-C17-2 0.6669382 0.9046783 0.9075189 1.261648 TEM

231-22.2-D-C17-3 0.6709394 0.9522274 0.9493416 1.331909 TEM

231-22.2-D-C17-4 0.8696419 1.228541 1.226884 1.701167 TEM

231-22.2-D-C17-5 0.7080554 0.9698406 0.9794198 1.359208 TEM

__________________________________________________________________________________________________________________________________________


Isolate Iteration


231-22.2-D-C17-6 0.793189 1.10782 1.121165 1.552084 TEM

231-22.2-D-RC1-1 0.6320904 0.8741733 0.8888429 1.208631 TEM

231-22.2-D-RC1-2 0.596387 0.8280793 0.8321988 1.194582 TEM

231-22.2-D-RC1-3 0.6114462 0.8532692 0.8555951 1.197965 TEM

231-22.2-D-RC1-4 0.5895268 0.8409945 0.8350878 1.139866 TEM

231-22.2-D-RC15-6 0.7065424 0.9801624 0.9760315 1.360772 TEM

231-22.2-D-RC15-7 0.584377 0.8140584 0.8207414 1.137874 TEM

231-22.2-D-RC15-8 0.6732023 0.9115322 0.9138317 1.259447 TEM

236-20-D-C22-5 0.9509284 1.365487 1.36604 1.902902 TEM

236-20-D-C22-6 0.9912978 1.421837 1.414213 1.987421 TEM

236-20-D-C22-7 1.029001 1.44026 1.448942 1.975155 TEM

236-20-D-C22-8 1.721563 2.445298 2.445281 3.404829 TEM

236-20-D-C30-5 0.5282942 0.7522599 0.7552364 1.038398 TEM

236-20-D-C30-6 1.280619 1.818542 1.815038 2.536365 TEM

236-20-D-C30-7 0.6437154 0.9039261 0.9075192 1.275941 TEM

236-20-D-C30-8 0.8777967 1.248646 1.239708 1.765898 TEM a Relative gene copy number as determined from original CT data

β-LACTAMASE-MEDIATED RESISTANCE TO...

Documents

Transcript of β-LACTAMASE-MEDIATED RESISTANCE TO...