1

Interaction of p38 and Sp1 in a mechanical force-induced, β1-integrin-mediated

transcriptional circuit that regulates the actin binding protein filamin-A.

Mario D’Addario, Pamela D. Arora,

Richard P. Ellen and Christopher A.G. McCulloch

CIHR Group in Matrix Dynamics

University of Toronto, Toronto, Ontario, Canada

Institute of Dental Research

Faculty of Dentistry, University of Toronto.

Correspondence: Christopher A.G. McCulloch University of Toronto Room 244, Fitzgerald Building 150 College Street Toronto, Ontario CANADA M5S 3E2 Telephone: 416-978-1258 FAX: 416-978-5956 e-mail: christopher.mcculloch@utoronto.ca Running Title: Mechanical force induces filamin-A by p38 and Sp1. Key Words: actin, p38, MAP kinase, filamin A, Sp1, fibroblasts

Copyright 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

JBC Papers in Press. Published on September 24, 2002 as Manuscript M207681200 by guest on N

ovember 14, 2020

http://ww

w.jbc.org/

Dow

nloaded from

2

ABSTRACT

Connective tissue cells in mechanically active environments survive applied physical forces by

modifying actin cytoskeletal structures that stabilize cell membranes. In fibroblasts, tensile forces

induce the expression of filamin-A, a mechanoprotective actin binding protein, but the mechanisms

and protein interactions by which force activates filamin-A transcription are not defined. We found

that in fibroblasts, application of tensile forces through collagen-coated magnetite beads to cell

surface β1-integrins induced filamin-A expression. This induction required actin filaments and

selective activation of the p38 MAP kinase. Force promoted the redistribution of p38 to the

integrin/bead locus and the nucleus as well as enhanced binding of the transcription factor Sp1 to

proximal, regulatory domains of the filamin-A promoter. Force application increased association of

Sp1 with p38 and phosphorylation of Sp1. Transcriptional activation of filamin-A in force-treated

fibroblasts was subsequently mediated by Sp1 binding sites on the filamin-A promoter. These

results provide evidence for a mechanically coupled transcriptional circuit that originates at the

magnetite bead/integrin locus, activates p38, tethers p38 to actin filaments, promotes binding of

p38 to Sp1 in the nucleus and induces filamin A expression.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

3

INTRODUCTION

Connective tissue cells are subjected to high-amplitude mechanical forces that in part are directed

through cell surface integrins to the cell interior (1). Some of the cellular responses to extracellular

forces include reorganization of subcortical actin and alteration of gene expression (reviewed in

2,3), suggesting that integrin-mediated signals can mediate adaptations to force that extend from

the plasma membrane to the nucleus. We have shown previously that mechanical forces directed

through β1-integrins promote redistribution of filamin-A to the integrin/bead locus (4) and enhance

filamin-A expression (5). While these findings support a role for integrin-based cell signaling in

response to physical forces, the protein interactions and transcriptional regulation involved in this

pathway have not been examined in detail.

Integrin-mediated forces activate several signaling pathways including phosphorylation of

focal adhesion structural proteins such as α-actinin, vinculin, talin, tensin, filamin and paxillin as

well as the focal adhesion kinase and Src family protein tyrosine kinases (rev. 2,3,6). Filamins are

actin-binding proteins originally isolated from chicken gizzard that organize actin filaments into

orthogonal networks and enhance the rigidity of the actin cytoskeleton (rev. 7). Filamins bind a

large number of membrane-associated and cytoplasmic proteins at their carboxy and amino

terminal-ends and help tether the actin cytoskeleton to numerous cytoplasmic structures (7). The

enhanced transcription and expression of filamin-A in response to mechanical force directed

through cell surface integrins is dependent on de novo protein synthesis, an intact actin

cytoskeleton and Sp1 transcription factor binding sites in the filamin-A promoter (5). These studies

suggested the outline of a mechanism in which extracellular mechanical forces can regulate the

expression of filamin-A.

The ability of cells to respond to exogenous and endogenously generated mechanical forces

has prompted the examination of integrin-matrix interactions and the organization of the actin

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

4

cytoskeleton. In this context, fibroblasts grown on fibronectin but not poly-L-lysine exhibit basal

ERK 1/2 activation (8), a response that requires intact filaments. Similarly, ERK 1/2 activation

occurs at focal adhesions in fibroblasts grown on laminin or fibronectin but not poly-L-lysine (9).

Mechanical force-induced DNA synthesis and down-regulation of the platelet derived growth

factor (PDGF) promoter also requires integrin ligation (10,11), processes which are mediated in

part by NF-κB and Sp1 binding sequences in the PDGF promoter (11). Force-induced filamin-A

expression is found in cells plated on collagen or fibronectin but not poly-L-lysine (5).

Collectively, these studies suggest that cellular adhesion to extracellular matrices affects the

organization of the actin cytoskeleton and accordingly regulates force-induced gene expression

through specific transcription factors and distinct signaling pathways.

While these studies indicate the existence of force-induced activation pathways that

originate at the cell membrane, the protein interactions that mediate downstream transcriptional

regulation of cytoskeletal genes have not been defined. In this report we examined the regulation of

the actin binding protein filamin-A in response to tensile forces applied through integrin receptors

(1,4). We describe a functional pathway that is initiated at the extracellular matrix-β1-integrin

locus, drives bi-directional migration of p38 and pp38 to integrins and to the nucleus and promotes

the interaction of p38 with actin filaments. The activation of this pathway enhances Sp1

phosphorylation and mediates the interaction of Sp1 with the p38 MAP kinase, processes that are

essential for force-induced filamin expression.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

5

EXPERIMENTAL PROCEDURES

Cell culture and reagents

Human gingival fibroblasts were derived from primary explant cultures as described (12). Cells

from passages 6-15 were grown as monolayer cultures in T-25 flasks (Falcon, Becton Dickinson,

Mississauga, ON) in α-MEM containing 10% fetal bovine serum (FBS) and antibiotics. Twenty-

four hours prior to each experiment, cells were harvested and plated at 75% confluence. The

experiments involving promoter analyses utilized Rat-2 fibroblasts as surrogates for gingival

fibroblasts as described previously (13). Cells were maintained in DMEM with 5% FBS and

antibiotics. Prior to transfection, the cells were cultured in OPTI-MEM (GIBCO/Invitrogen Corp.,

Mississauga, ON) at 75% confluence and then transfected as described below.

Mouse anti-filamin-A monoclonal antibody was obtained from Serotec (Cedarlane

Laboratories, Hornby, ON). Mouse monoclonal antibodies to β-actin, pp38, p38, Sp1 and

phosphoserine/threonine were obtained from Cell Signaling Technologies (New England Bioloabs,

Mississauga, ON). For immunoprecipitation of p38, a second monoclonal antibody to p38 was

obtained from BD Biosciences (Mississauga, ON). The anti-β1 integrin mAb 4B4 was obtained

from Beckman-Coulter (Burlington, ON). Latrunculin-B, SB203580 and PD98059 were obtained

from Calbiochem (VWR International, Mississauga, ON). Monoclonal antibodies to FLAG and

talin were obtained from Sigma-Aldrich (Mississauga, ON).

Force generation

Force generation through integrins was produced using a previously described model system (14).

Briefly, magnetite microparticles (Fe3O4, Sigma-Aldrich, St. Louis, MO) were incubated with

purified collagen (Vitrogen 100, Cohesion Technologies, Palo Alto, CA; 1 mg/ml), neutralized to

pH 7.4, rinsed with PBS and incubated with fibroblasts. Following 30 min incubation, excess non-

adherent microparticles were removed by vigorous washing and the cells were supplemented with

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

6

fresh α-MEM. A ceramic permanent magnet (Jobmaster, Mississauga, ON) was placed on top of

the dish to generate a perpendicular mechanical force of ~0.48 pN/µm2 cell area, a force that is

comparable to that which may be experienced by cells in vivo during normal function (14). The

incubation times were specific for each individual experiment as indicated.

RNA isolation, northern blot, reverse transcription (RT) and polymerase chain reaction (PCR)

analysis

RNA isolation was performed with RNeasy reagents (Qiagen, Mississauga, ON). All RNA

preparations were treated with RQ1 DNAse (Promega Corp., Madison, WI) for 30 min. The RT-

PCR protocol was performed as described in detail elsewhere (15). RT was conducted on total

RNA (1 µg) using 5 U of H-/Moloney Murine Leukemia Virus Reverse Transcriptase (Mo-MuLV-

RT, MBI Fermentas, Mississauga, ON) and 10 pmoles of oligo-(dT) primer. The cDNA product

was subjected to 30 cycles of amplification in a PTC 100 MJ Research Minicycler (Watertown,

MA). PCR amplified products were resolved via agarose gel electrophoresis. Quantification of

PCR products was performed using the Ofoto 1 system (Light Source Computer Images, Ferguson,

MO) and IP Lab Gel (Signal Analytics, Vienna, VA). The density of individual lanes was

normalized to the density of the PCR-amplified housekeeping gene glyceraldehyde-3-phosphate

dehydrogenase (GAPDH). Sequences of the oligonucleotides used in the RT-PCR analysis were:

Filamin-A forward primer: 5’-GAGTTCACTGTGGAGACCAGAAGT-3’;

Filamin-A reverse primer 5’-CTGTGACTTATCCACGTACACCTC-3’;

GAPDH forward primer 5'-CCATGGAGAAGGCTGGGG-3';

GAPDH reverse primer 5'-CAAAGTTGTCATGGAGCC-3'.

The semi-quantitative nature of the RT-PCR protocol, the precautions taken to avoid spurious

reaction products and the controls used have been described previously (15). In each experiment, a

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

7

non-RT control demonstrated the lack of DNA contamination. Northern blot analysis of filamin-A

and GAPDH has been previously described (5).

Western blotting, immunofluorescence, and immunoprecipitation

Cells were lysed and cellular proteins were separated by SDS-PAGE (8% gels were used for

filamin-A and β-actin westerns while 12% gels were used for pp38 and p38 blots) and transferred

to nitrocellulose (Schleicher and Schuell, Keene, NH) as previously described (4). Protein

concentrations were determined using the Bradford assay and bovine serum albumin as a standard.

Equal amounts of protein were loaded on individual lanes and nitrocellulose membranes were

analyzed as described previously (4,5). Chemiluminescent detection was performed according to

the manufacturer’s instructions (Amersham, Baie D’Urfe, QC). The radiographic films were

exposed for standardized lengths of time using conventional protocols.

For immunofluorescence, gingival fibroblasts were grown on glass cover slips, incubated

with collagen-coated microbeads and subjected to magnetic force application as described above.

Samples were collected at standardized time points and stained as previously described (5).

The protocol for the immunoprecipitation of p38, pp38 and Sp1 has been described

previously (16). Briefly, samples were treated with RIPA buffer containing sodium vanadate (1

mM) and a protease inhibitor cocktail (Sigma-Aldrich). Isolated proteins were incubated with

protein-G Sepharose (Zymed, Mississauga, ON) beads that had been pre-incubated with mAb’s to

pp38, p38 or Sp1 overnight at 4ºC. The precipitate was washed 6 times and proteins were separated

from beads by heating at 65ºC for 10 min in 2X sample buffer. Samples were run on a 5-20%

gradient SDS-PAGE and transferred to nitrocellulose. Blots were then probed with the specific

antibody indicated in each section of figure 6, and ECL was carried out according to the

manufacturer’s instructions (Amersham-Pharmacia).

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

8

Genomic DNA isolation, filamin-A promoter construction and transfection of Rat-2 fibroblasts

To generate the 3224 bp filamin-A luciferase promoter construct, we isolated intact fibroblast

genomic DNA using the protocol of Goelz et al. (17). Briefly, whole cell lysates were treated for

48 hr at 50°C with proteinase -K in buffer. Following verification of intact DNA on a 1% agarose

gel, 320 ng of DNA was incubated with PCR buffer containing oligonucleotide A1 (5’-

GTCGCTCTCAGGAACAGCAGGTGAGGT-3’) and oligonucleotide B1 (5’-

GGAGCTACTCATTTTGAGGCGCGAGAA-3’). The PCR reaction was performed in a MJ

Research PTC 100 Minicycler using 150 nM each of oligonucleotides A and B, 5% DMSO (v/v),

1.5 mM MgCl2, 200 µM of each dNTP and 1 U Expand High Fidelity PCR Enzyme System

(Roche Diagnostics, Laval, QC). The thermo-cycling procedure involved an initial 5 min

incubation at 95 °C, followed by 35 cycles of 0.5 min at 94 °C, 0.5 min at 64.5 °C and 3 min at 68

°C with a final extension at 68 °C for 7 min. The amplified fragment was used to generate a nested

PCR product that contained Bgl-II and Hind-III restriction sites for directional cloning into the

pGL2 Basic Vector (Promega). The nested PCR product used the same components with the

substitution of nested oligonucleotide A2 (5’-CGCTCTCAGGAACAGCAGGTGAGATCT-3’)

and B2 (5’-GCTGAAGCTTCGGCGAGGGGACGGCCCTTT-3’). The correctly amplified

product was verified through diagnostic restriction enzyme cleavage, ligated into the pGL2 basic

vector between Hind-III and Bgl-II and the correct orientation of the insert was verified through

diagnostic restriction enzyme digestion and sequencing performed at the DNA Sequencing Facility,

Center for Applied Genomics (Hospital for Sick Children, Toronto, ON).

To generate the final wild type 75bp filamin-A luciferase construct [pFil75(wt)luc], the

original 3.2kbp filamin-A luciferase vector was digested with Xho1-Pst1 (which effectively

removed 3.15kbp of upstream promoter). The fragments were blunt-ended, isolated from an

agarose gel and the portion containing the 75bp fragment fused to the luciferase reporter construct

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

9

was re-ligated. To fabricate the final 75bp promoter construct containing mutations at the Sp1

binding sites [pFil75(mut)luc], two complementary oligonucleotides (described below and made by

MWG Biotech) were boiled independently and allowed to slowly cool to room temperature in

equimolar amounts. Promoter scanning was used to determine the location of potentially important

transcription factor binding sites (18). The Sp1 mutations are indicated in bold lettering: (-75; 5’-

TGCAGCATTCGCAGAGACTGCAATTCTCGCGCCTCAAAATGAGTAGCTCCCACTTTTG

CCGAGACAGAGCGCAGCAGG-3’). The hybridized oligonucleotides were ligated into the

pGL2Basic luciferase vector (Promega) and the correctly ligated vector was verified through

restriction enzyme digestion.

Nuclear extract preparation and electrophoretic mobility shift assay (EMSA)

Nuclear extracts were isolated to determine Sp1 binding activity in force treated and control

fibroblasts according to a previously established isolation protocol (19). Briefly, cells were treated

as indicated for each individual experiment, rinsed and scraped off the dish with a rubber

policeman. The cell pellet was lysed in buffer containing 10 mM Hepes (pH 8.0), 1.5 mM MgCl2,

10 mM KCl, 0.5 mM DTT, 0.5 mM PMSF, 200 mM sucrose, 0.5% NP-40 and 1 mg/ml of both

aprotinin and leupeptin (both from Sigma-Aldrich). Nuclei were lysed in buffer containing 20 mM

Hepes pH 8.0, 1.5 mM MgCl2, 420 mM NaCl, 0.2 mM EDTA, 0.5 mM PMSF, and 1 mg/ml of

both aprotinin and leupeptin. The refined nuclear proteins were diluted in equal volume of buffer

containing 20 mM Hepes pH 8.0, 100 mM KCl, 0.2 mM EDTA, 20% glycerol, 1 mM DTT, 0.5

mM PMSF, and aprotinin/leupeptin. The concentrations of the diluted extracts were determined

using the BioRad Protein Assay (BioRad, Mississauga, ON).

For EMSA analysis, double-stranded DNA oligonucleotides corresponding to the Sp1

binding site (at position –15) in the filamin-A promoter were used (5’-

CTCTCTCGGGCGGGGAGCTCAG-3’) and were synthesized by MWG Biotech (High Point,

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

10

NC). Control experiments using NF-κB/c-Rel, wild type Sp1, mutant Sp1, CREB, AP-1 and p53

oligonucleotides were all obtained from Santa Cruz Biotech (Santa Cruz, CA). EMSA binding has

been previously described (19). In competition assays, molar excess of the unlabelled

oligonucleotides was used. For supershift assays, 1 µg of anti-Sp1, anti-NF-κB p50 or anti-CREB

monoclonal antibodies (all from Santa Cruz Biotech) were used. After incubation, the samples

were separated on a 6% native Tris-glycine PAGE, electrophoresed at 125 V for 5 hours, dried and

exposed to X-ray films for different lengths of time.

Cell transfections

Rat 2 fibroblast cells were transfected using the Effectene transfection reagent (Qiagen). Briefly,

following titration experiments to determine the optimum concentration of vector needed, cells

were transfected, left for 36-48 hr and then subjected to various treatments (described for each

individual experiment). Following each treatment, cells were processed for luciferase activity using

the manufacturer’s instructions (Luciferase Assay System, Promega Corp). The vectors used in the

transfection are the following and their source is indicated in brackets; pCMV-MKK6+

(constitutively active) and pCMV-MKK6AL (pCMV-MKK6AL-dominant repressor; both from

Dr. J. Woodgett, U. of Toronto), pCMV-p38FLAG (constitutively active; Dr. R.J. Davis, U. of

Massachusetts); pCMV-Sp1, pCMV-Sp1(SA21) (positive and negative Sp1 controls, respectively;

both from Dr. R. Tjian, U. of California), pCMV-NF-κBp50 and pCMV-NF-κBp65 (both from Dr.

N. Rice, National Cancer Institute, Frederick, MD). All vectors have been described elsewhere (20-

22) and a dominant negative MKK6 (pCMV-MKK6AL) has been described (23). The luciferase

vectors pFil3.2luc, pFil75(wt)luc and pFil75(mut)luc are described above. To establish transfection

efficiency and as a control, a green fluorescent protein vector (pEGFPluc) was used (Clontech).

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

11

Statistical analysis

For continuous variable data, means and standard errors of the means were computed. Unpaired

Student’s t-tests were used for statistical testing and significance was set at p<0.05. In each assay

n=3.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

12

RESULTS

Induction of filamin-A expression by force application

We assessed the requirement of cell surface β1-integrins in force-mediated filamin-A gene

regulation. Fibroblasts were incubated with either collagen- or BSA-coated magnetite beads and

were pretreated with either integrin blocking antibodies (mAb 4B4) or vehicle prior to force

application (Figure 1A). Densitometric analysis of the RT-PCR products showed a 5-6-fold

induction of filamin-A gene expression following 6 hr of force application. This response was not

detected when cells were pretreated with the mAb 4B4 or subjected to force through BSA-coated

beads (Fig. 1A) or beads coated with poly-L-lysine (5). We found a comparable, 5-7-fold induction

of filamin-A gene by northern blot analysis (Fig. 1A). Consequently, we were confident that with

these RT-PCR conditions, we could detect experimentally induced alterations in filamin-A mRNA

content.

Actin filaments are important for transmission of extracellular signals to the nucleus

required for transcriptional activation (24). Accordingly, we assessed if force-induced filamin-A

induction required intact filaments. Fibroblasts were pretreated for 20 min with latrunculin-B (an

actin monomer-sequestering toxin that depolymerizes actin filaments, 1 µM) prior to force

application. RT-PCR analysis of RNA isolated from these cells showed that disruption of the actin

cytoskeleton inhibited the force-induced stimulation of filamin-A (Fig. 1A).

Mechanical stretching activates the p38 MAP kinase in rat ventricular myocytes (25). In

contrast to other MAP kinases which are not affected by tensile forces, p38 is also selectively

activated in force-treated cardiac fibroblasts (24). Accordingly we examined the role of p38 in

force-induced activation of filamin-A. Inhibition of the p38 kinase pathway by SB203580 (2 µM)

suppressed the transcriptional activation of filamin-A while the ERK-specific inhibitor PD98059 (5

µM) had no effect (Fig. 1A). Within 15 min of force, there was a 3-4-fold increase in pp38 when

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

13

lysates were analyzed by immunoblotting. Similar increases of pp38 were also found in cells

pretreated with PD98059 but not in cells pre-incubated with SB203580 (Fig. 1B). To assess the

involvement of other MAP kinase pathways in this force model system, we analyzed lysates for

force-induced phosphorylation of ERK and JNK but found no increases following force application

(data not shown).

We determined if force would also increase filamin-A protein content. Whole cell extracts

were prepared from fibroblasts treated with force for increasing lengths of time and examined by

western blot. There was a 5-7-fold increase in filamin-A protein content (Fig. 1B). Similar to our

findings for filamin-A mRNA, the force-induced increase of filamin-A was eliminated by

pretreatment with SB203580 but not by PD98059. We also evaluated the role of other, non-

collagen receptors in force-mediated activation of filamin-A. Magnetite beads were coated with

bone sialoprotein (1 mg/ml) which binds αvβ3 integrin subunits. After several hours, force

application did not appreciably increase protein levels of filamin A (data not shown). As these

results indicated that force-mediated increases of filamin were not obtained when force was

delivered through ? v? 3 integrins, there is an apparent requirement for ? 1 integrins in this

process.

Force induces p38 and pp38 redistribution within the cell

As activated ERK translocates to newly-established focal adhesions in freshly plated fibroblasts

(9), we assessed pp38 and p38 MAP kinase localization by immunofluorescence in bead-loaded

cells that were bead-loaded with or without force (Figure 2). In cells fixed with methanol to permit

nuclear access for antibodies, immunostaining for pp38 in UV-irradiated fibroblasts showed

redistribution of pp38 to the nucleus (Fig. 2Ai). Equivalent nuclear aggregation of Flag-tagged p38

has been detected in UV-irradiated COS cells (20). In untreated cells, p38 and pp38 were diffusely

distributed throughout the cytoplasm (Fig. 2Aii-b), but after 1 hr of force, both p38 and pp38

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

14

aggregated to the nucleus (Fig. 2Aii-e,h). When we fixed cells with paraformaldehyde (i.e. without

nuclear permeabilization), immunostaining showed that force caused selective recruitment of pp38

and p38 to the integrin/magnetite bead locus (Fig. 2B). These results demonstrate force-induced

migration of p38 and its active phosphorylated form (pp38) to cell nuclei and the

integrin/magnetite bead locus in a manner analogous to the localization of activated ERK at newly

formed focal adhesions (9). We also assessed the relative enrichment of p38 and pp38 to focal

adhesions after force application using isolated, bead-associated proteins. With the use of a

previously established protocol (4,26) followed by immunoblotting, we found that pp38, talin,

filamin A were increased by force while β-actin was relatively constant (Fig. 2B), results which

were consistent with the immunofluorescence data.

We assessed the role of actin filaments in the localization of filamin-A and the activation of

p38 by treatment of cells with latrunculin-B prior to application of force. In view of the apparent

migration of pp38 and p38 in force-treated cells, we examined pp38 and p38 localization by

immunofluoresence. Rhodamine phalloidin staining of control cells demonstrated characteristic

actin stress fibers that were disrupted by pre-treatment with latrunculin-B (Fig. 3A). Latrunculin-B-

treated cells also showed diffuse pp38 and p38 staining patterns, a distribution that did not change

appreciably following force application (compare with Fig. 1C). Quantitative evaluation of filamin-

A protein content after force application showed a 5-fold increase after 12 hours (p<0.01) that was

consistent with data from figure 1B. After treatment with latrunculin-B followed by force, filamin-

A protein content was not increased significantly above baseline, demonstrating a requirement for

intact actin filaments (Fig. 3B). The restricted movement of pp38 and p38 with latrunculin-B

pretreatment after force parallels the results of Aplin et al. (27) in cytochalasin-D pretreated

fibroblasts in which nuclear localization of ERK and phosphorylation of Elk-1 was suppressed by

actin filament depolymerization.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

15

Activation of filamin-A transcription by the MKK6-p38 kinase pathway

Functional, Sp1 transcription factor binding sites in the filamin-A promoter are necessary for force-

mediated activation of a filamin-A reporter vector (5). However, the signaling mechanisms

required for transmitting a tensile force-mediated signal from cell surface integrins to the nucleus

have not been defined. In view of previous studies describing a role for the MKK6 (MAP kinase

kinase 6)/p38 MAP kinase in force-induced gene regulation (28), we assessed the involvement of

this pathway using MKK6 or p38 expression vectors. The introduction of pCMV-MKK6+ and

pCMV-p38+ expression vectors by transfection increased endogenous filamin-A mRNA (Figure 4)

while transfection of the dominant negative pCMV-MKK6AL had no effect. Further, application of

force following transfection with either MKK6+ or p38+ did not significantly (p>0.2) increase the

levels of filamin-A mRNA and did not abrogate the inhibitory effects of the dominant negative

MKK6AL (Fig. 4).

To determine the effects of these expression vectors on protein expression, we assessed the

cellular content of filamin-A, Sp1 and pp38 in transfectants and force-treated transfectants (Fig.

5A-C). Notably, in CHO cells, introduction of pCMV-MKK6+ causes specific phosphorylation of

p38 without any effect on JNK or ERK (20). We found that transfection with pCMV-MKK6+

augmented the production of filamin-A, Sp1 and pp38; there were further increases when cells

were subsequently treated with force (Fig. 5A). A similar pattern was observed when the

constitutively active p38+ vector was introduced into fibroblasts (Fig. 5C). In both experiments,

pretreatment with SB203580 significantly decreased production of filamin-A and Sp1 while

treatment with PD98059 had no effect (data not shown). We are aware that the effects of

SB203580 on pCMV-MKK6+ driven expression of filamin, Sp1 and pp38 may be due to over-

expression and auto-regulatory feedback mechanisms involving kinase activation downstream of

MKK6 and p38 since several downstream kinases are stimulated (29-32). Our assays required 24-

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

16

36 hrs for full expression following transfection, as determined by the production of FLAG from

pCMV-p38FLAG. Accordingly, the over-expression of MKK6 may lead to the subsequent

activation or suppression of downstream kinases that stimulate p38 indirectly leading to the results

observed in our experiments. Further, as the efficiency of transfection was ~50-60%, we also

detected endogenous filamin, Sp1 or p38 in the untransfected cell populations. Notably,

transfection with the dominant negative MKK6AL vector reduced filamin-A, Sp1 and pp38 content

in those cells that were subsequently treated with force (Fig. 5B). Collectively, these data

demonstrate that constitutive activation of the MKK6/p38 MAP kinase pathway enhances the basal

levels of filamin-A, pp38 and Sp1.

Regulation of the filamin-A promoter by MKK6 and p38 MAP kinase

The data from figures 1 and 5 suggested that the MKK6/p38 MAP kinase pathway regulates

filamin-A expression in response to tensile force. Further, previous results (5) indicated that a

reporter vector containing 3.2kbp of the filamin-A upstream sequence is regulated by Sp1

transcription factor binding sites. Accordingly, MKK6+, MKK6AL or p38+ expression vectors

were transiently transfected into Rat-2 fibroblasts in conjunction with reporter vectors specific for

the filamin-A promoter. Using the full-length 3.2kbp filamin-A reporter vector (pFil3.2luc), we

assessed baseline levels of luciferase activity and found a 4-6-fold induction by force application

that was inhibited by SB203580 but not by PD98059 (Figure 6A). When MKK6+ and p38+

expression vectors were co-transfected with pFil3.2luc, we noted a reproducible 6-8-fold induction

that was further augmented following force application. A control assay using the dominant

negative MKK6 (MKK6AL) suppressed basal luciferase activity and decreased force-induced

activation of pFil3.2luc. Control co-transfection experiments with expression vectors for wild-type

Sp1 (pCMV-Sp1- 24-fold increase of pFil3.2luc activity) and a Sp1 DNA binding mutant pCMV-

Sp1 (SA21-no induction of pFil3.2luc) showed the specificity of Sp1-dependent activation.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

17

Notably, SA21 dimerizes, but is unable to bind DNA and is therefore an ideal Sp1 negative control

(from Dr. R. Tjian).

The specificity of the MKK6/p38 MAP kinase pathway was assessed using SB203580. This

agent specifically inhibited MKK6+ and p38+ dependent activation of the pFil3.2luc reporter

vector while the ERK-specific inhibitor PD98059 produced no similar inhibition (Fig. 6). We have

previously reported that a truncated version of the filamin-A promoter containing 75bp of upstream

sequence contains several transcription factor-binding sites based on a promoter scan analysis (18).

This 75bp filamin-A reporter vector (pFil75(wt)luc) was regulated by force in a manner similar to

the 3.2kbp sequence: mutation of Sp1 binding sites in pFil75(wt)luc abolished force induction (5).

To assess the involvement of the p38 MAP kinase pathway in the force-induced regulation of

pFil75(wt)luc, co-transfection experiments were performed with MKK6AL, MKK6+ and p38+

expression vectors (Fig. 6B). The pFil75(wt)luc was equally responsive to constitutively active

MKK6+ and p38+ expression vectors and was similarly enhanced by force application. The use of

SB203580 strongly suppressed all basal and force-induced activation of pFil75(wt)luc alone and in

co-transfection assays while PD98059 had little effect. Similar to pFil3.2luc, the use of pCMV-

MKK6AL alone or with force strongly reduced all luciferase activity to minimal levels (Fig. 6B).

Control co-transfection experiments with pCMV-Sp1 or pCMV-Sp1(SA21) (described above)

demonstrated the specificity of Sp1-dependent activation in pFil75(wt)luc (i.e. <30% induction

above background; data not shown). Further, co-transfection of pFil75(wt)luc with expression

vectors for NF-κB subunit p50 (pCMV-NF-κBp50) and NF-κB subunit p65 (pCMV-NF-κBp65,

both provided by Dr. N. Rice) demonstrated minimal luciferase activity with or without force

application (data not shown). These findings indicated a specific requirement of pFil(wt)luc for

Sp1-dependent activation.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

18

To establish the importance of the Sp1 sites at position –15 and –25, we generated a 75bp

filamin-A reporter vector with mutations at these sites (described in the materials and methods as

pFil75(mut)luc). The Sp1 sites mutated in pFil75(mut)luc were chosen based on their predicted

impact on transcriptional regulation according to methods described by Prestridge (18). This

mutated 75 bp filamin reporter vector however still possesses several heterologous upstream

transcription factor binding sites when examined with a promoter scan analysis (18) and hence

could potentially be regulated by other transcription factors. When pFil75(mut)luc was transfected

into Rat-2 cells either alone or co-transfected with MKK6/p38 expression vectors, a decrease in

luciferase activity was detected (Fig. 6C). pFil75(mut)luc demonstrated a basal level of activity

that was inducible by force application or after co-transfection with pCMV-MKK6 and pCMV-p38

expression vectors. However, the relative levels of induction were significantly lower than the

luciferase levels obtained with pFil75(wt)luc (compare the relative levels of induction along each

X-axis). The residual inducibility of pFil75(mut)luc by force, pCMV-MKK6 or pCMV-p38 may be

explained by the presence of other transcription factor binding elements upstream of the mutated

Sp1 sites at positions –15 and –25.

Force induces binding of Sp1 to the filamin-A promoter

Our previous results demonstrated that force-induced filamin-A expression is mediated through

Sp1 sites on the filamin-A promoter (5). While the pFil75luc vector contains several potential

transcription factor binding sites (18), we specifically examined the role of Sp1 since up to six

binding sites for this factor exist and are located immediately upstream of the transcription start site

of filamin A. Nuclear extracts (NE, 5 µg) were isolated from bead-loaded controls and force-

treated cells and analyzed by EMSA (Figure 7). The migration patterns of Sp1/DNA complexes in

show that while control cells exhibited basal Sp1 binding levels, force application for increasing

lengths of time induced a 4-6-fold increase in Sp1 binding within 2 hr (Fig. 7A). To determine the

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

19

specificity of the interaction of Sp1 with the filamin-A oligonucleotide, competition assays were

performed. These experiments established that authentic wild -type Sp1 and not sequences

corresponding to NF-κB or CREB, could diminish or eliminate Sp1 binding to the –15 filamin-A

oligonucleotide (Fig. 7B). To determine if the enhanced Sp1 binding following force application

was a generalized phenomenon for other transcription factors; CREB and AP-1 binding assays

were performed. The results showed <5% increase in binding of either CREB or AP-1 following 8

hr of force application. To confirm the authenticity of Sp1 in the binding complex, supershift

analyses were performed. The addition of mAb’s specific to Sp1 (75 ng and 1 µg) was sufficient to

create a protein-DNA complex that migrated more slowly; these complexes were not detected

when antibodies to NF-κB or CREB were used (Fig. 7C).

Tensile force induces p38 association with Sp1 and β-actin and Sp1 phosphorylation

The data above suggested that the p38 MAP kinase pathway is involved in the transcriptional

activation of filamin-A. Further, tensile forces evidently induce the migration of both pp38 and p38

to the integrin/magnetite bead locus and the nucleus (Fig. 2) through as yet an undefined

mechanism. To provide information on potentially important protein associations involved in this

signal transduction pathway, we immunoprecipitated proteins interacting with p38 or pp38. Force

application caused a 3-4-fold increase in the association of p38 and pp38 with β-actin (Figure 8), a

cytoskeletal protein enriched in focal adhesions (Fig. 2Bii). Control immunoblotting for p38

confirmed that equivalent amounts of p38 were immunoprecipitated in the force and no-force

samples. Other controls using an irrelevant immunoprecipitating antibody (anti-nebulin) showed no

immunoprecipitation of actin (data not shown) thereby establishing the specificity of the

association. To confirm the physical association between actin and p38/pp38, we transfected

pCMV-p38FLAG into fibroblasts, immunoprecipitated lysates with anti-β-actin mAb and

immunoblotted these extracts with an antibody to FLAG. The results confirmed that extracts from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

20

force-treated cells showed much more abundant association of p38 with actin than cells without

force (Fig. 8).

To assess whether Sp1 is activated following force application, we analyzed total Sp1

protein content and the level of serine/threonine phosphorylated residues on Sp1, a modification

which has been shown to be indicative of Sp1 transcription factor activation (33-35). We found that

in response to force, there was increased phosphorylation of Sp1 in cell lysates that were initially

immunoprecipitated with anti-Sp1 antibody and then immunoblotted with antibody to

phosphoserine/threonine (Fig. 9). Immunoblotting of the immunoprecipitates with a different Sp1

antibody showed equal amounts of immunoprecipitated protein in force-treated and untreated cells

(Fig. 9). These results show that force application induces an increase in phosphorylation of Sp1 at

serine/threonine residues.

As force application enhanced the movement of p38 and pp38 into the nucleus (Fig. 2Ai),

we assessed the ability of p38 to interact with Sp1 since p38 can activate other transcription factors

including ATF-2, NF-κB, Elk-1 and MEF-2C (2,3,22,25). To examine the involvement of p38 in

Sp1 activation, we assessed Sp1 protein interactions with p38 and pp38. We immunoprecipitated

p38 and pp38-bound material, divided these materials into two sets of blots and immunoblotted

with either anti-Sp1 or anti-phosphoserine/threonine antibodies. There was a 2-3-fold increase in

the association of p38 and pp38 with Sp1 in force-treated cells (Fig. 10i). Force treatment also

increased the amount of phosphoserine/threonine phosphorylated protein that co-migrated with Sp1

in the immunoprecipitates obtained with p38 and pp38 antibodies (Fig. 10ii). These results confirm

that p38 and pp38 associated at greater levels with Sp1 and its activated phosphoserine/threonine

form in fibroblasts stimulated with mechanical force.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

21

DISCUSSION

We have previously shown that application of mechanical force through cell surface β1-integrins

increases filamin-A production (5) and that the expression of this protein protects cells against

force-induced apoptosis (36). Here we demonstrate that force-mediated filamin-A expression

involves activation of p38 and its localization to nuclei and integrin/magnetite beads at the plasma

membrane. Further, we show that activation of filamin-A is dependent on Sp1 transcription factor

binding elements in the filamin-A promoter and that the p38 MAP kinase-signaling pathway

mediates this activation through interactions with Sp1. These data provide evidence for a novel,

force-induced transcriptional response that promotes cell survival by elaboration of a

mechanoprotective protein, filamin-A. This response involves the association of the actin

cytoskeleton with force-sensitive signaling molecules of which the p38 MAP kinase is apparently a

critical element.

Many signaling proteins involved in responses to extracellular stimuli are sequestered into

discrete macromolecular complexes. The spatiotemporal organization of these aggregates can

determine the specificity and the intensity of responses to a wide range of extracellular stimuli

including force (37). The MAP kinases are a group of serine/threonine kinases that transduce

signals from cell membrane receptors into intracellular regulatory signals that control gene

expression. Our present analysis showed that intact actin filaments were required for force-induced

activation of p38 and the migration of p38 to nuclei and integrin/magnetite bead loci. In addition,

tensile forces promoted interactions of p38 and pp38 with actin, suggesting that the cytoskeleton

may tether signaling molecules into protein complexes that participate in mechanically induced

signaling. These complexes can increase the efficiency of signaling by decreasing the distance over

which intermediates must interact to exert their effects. Thus ERK is activated at actin filament-

enriched focal adhesions in response to spreading (9,27) while disruption of actin filaments

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

22

abrogates ERK activation (8) and blocks nuclear translocation/phosphorylation of the transcription

factor Elk-1 (27). Notably, as filamin-A cross-links actin filaments and is recruited to the

submembrane cortex after mechanical stimulation (4), filamin-A may also provide a scaffolding

role in p38 signaling as has been shown for MKK4 and TRAF2 (38). Although we have not

determined the mechanisms underlying the migration of p38 to the nucleus, the Ran GTPases may

be involved based on their contribution to nuclear localization of ERK (39,40). Further, Whitehurst

et al. (41) recently demonstrated that GFP-ERK2 enters the nucleus in a saturable, time and

temperature-dependent manner through its interaction with nucleoporin.

Activation and nuclear localization of MAP kinases can regulate gene expression by

phosphorylation of a number of transcription factors including SAP-1, Elk-1, c-Jun, ATF-2,

MEF2C, CHOP and NF-κB (22,42,43). The p38 MAP kinase is particularly responsive to cellular

stressors and can specifically phosphorylate Elk-1, ATF2 and MEF2C (38). Our data show that

application of tensile force promotes a 3-5-fold increase in Sp1 serine/threonine -phosphorylation

and concomitant association with p38, the first demonstration of a mechanically induced signaling

system involving this transcription factor and activation by p38. Sp1 is a zinc-finger DNA-binding

protein that binds a putative GC rich element; originally thought to be ubiquitously present in core

promoter elements (rev in 35,44). Following phosphorylation by protein kinases including DNA-

dependent protein kinase, casein kinase II, protein kinase A and the cell cycle-regulated Sp1-

associated protein kinase (34), Sp1 binds DNA and regulates transcription. Here we show that Sp1

can regulate an important mechanoprotective gene after stimulation by tensile forces. We have

previously identified several binding sites for Sp1 on the filamin-A promoter (5) and we show here

that these binding sites contribute to regulation of force-induced filamin-A expression. Ablation of

critical Sp1 binding sites in the filamin-A promoter strongly decreased the tensile-force- and p38-

mediated activation of a filamin-A reporter vector. Further, we demonstrate that both CREB and

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

23

AP-1 are not equally activated by force application demonstrating the specific activation of Sp1.

Notably, Sp1 may not regulate filamin-A transcription alone. Sp1 may interact with other

transcription factors including the insulin-responsive binding protein (IRBP), NF-κB and c-Jun

(45-48) to regulate a multitude of genes. Further, Sp1 shares DNA binding elements with NF-κB,

NF-1 and p53 proteins, indicating that co-operative or obstructive binding to specific promoter

sequences may confer additional transcriptional regulation (49-52).

In the tensile force model system described here, we demonstrate the activation of filamin-

A gene expression through phosphoserine/threonine-mediated stimulation of Sp1. Our proposed

model therefore describes a mechanistic circuit that originates at the integrin-magnetite bead locus

and induces the activation of p38 and pp38 (Fig. 7). The activation of p38/pp38 enhances its

interaction with the actin cytoskeleton and promotes their localization to the nucleus and the

integrin-magnetite bead locus. In the nucleus, we propose that p38/pp38 phosphorylate Sp1 and

enhance its interaction with the filamin-A promoter to augment gene transcription. In this manner,

filamin-A production in our mechanical stress model protects the cells against lethal applied forces

by promoting the re-distribution of the actin cytoskeleton through a cytoprotective mechanism.

Depending on the target gene, activation of Sp1 could occur through either phosphorylation

or dephosphorylation. For example, serine/threonine phosphorylation of the amino terminus of Sp1

enhances the CDK activity of cyclin A by 3-4 fold (34). Phosphorylation also increases Sp1-

mediated activation of the platelet derived growth factor B-chain and tissue factor genes by shear

stress (11,19). However, terminal liver cell differentiation is downregulated by Sp1

phosphorylation (53) while glucose-mediated activation of the acetyl-CoA carboxylase gene is

enhanced after Sp1 dephosphorylation (54), demonstrating that cell and gene-specific mechanisms

are involved in Sp1-mediated gene regulation. Our data clearly indicate however that for force-

induced regulation of filamin A, p38-mediated phosphorylation of Sp1 is a crucial regulatory step.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

24

Indirect confirmation of our results was recently produced in other cell systems in which Sp1 was

found to be directly phosphorylated on threonine residues 453 and 739 by p42/44 MAP kinase in

the regulation of vascular endothelial growth factor (55). Moreover, p38 phosphorylates NFATc4

(nuclear factor of activated T cells, subunit c4) on serine residues at position 168 and 170 (56).

In conclusion, we have demonstrated that tensile force applied to fibroblasts through

collagen receptors activates filamin-A transcription through the p38 MAP kinase and that this

regulatory pathway involves phosphorylation of the transcription factor Sp1 and its interaction with

p38. These results provide a mechanotranscriptional circuit by which cells from physically loaded

environments can couple extracellular mechanical stimuli into signals that induce cytoprotective

proteins.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

25

ACKNOWLEDGMENTS

This work was supported by a CIHR Group grant to Dr. R. Ellen and to Dr. C. McCulloch

(Operating Grant, [CIHR MOP-37783] and a Major Equipment Maintenance Grant). The Heart and

Stroke Foundation also supported this work (CM). Mario D’Addario is supported by a CIHR

Fellowship. The vectors pCMV-MKK6+ and pCMV-MKK6AL were generously provided by Dr.

J. Woodgett and pCMV-p38FLAG was provided by Dr. R.J. Davis. Control vectors pCMV-Sp1

and pCMV-Sp1(SA21) were provided by Dr. R. Tjian. Additional NF-κB control vectors were

provided by Dr. N. Rice.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

26

REFERENCES.

1. Critchley, D. R. (2000) Curr. Opin. Cell Biol., 12, 133-139

2. Chien, S., Li, S. and Shyy, J. Y. (1997) Hypertension, 31, 162-169

3. Shyy, J. Y. and Chien, S. (1997) Curr. Opin. Cell Biol., 9, 707-713

4. Glogauer, M., Arora, P. D., Chou, D., Janmey, P. A., Downey, G. P. and McCulloch, C. A. G.

(1998) J. Biol. Chem., 273, 1689-1698

5. D’Addario, M., Arora, P. D., Fan, J., Ganss, B., Ellen, R. P. and McCulloch, C. A. G. (2001) J.

Biol. Chem., 276, 31969-31977

6. Aplin, A. E., Howe, A. K. and Juliano, R. L. (1999) Curr. Opin Cell Biol., 11, 737-744

7. Stossel, T. P., Condeelis, J., Cooley, L., Hartwig, J. H., Noegel, A., Schleicher, M. and Shapiro,

S. (2001) Nature Revs. Mol. Cell Biol., 2, 138-145

8. Takahashi, M. and Berk, B. C. (1996) J. Clin. Invest. 11, 2623-2631

9. Fincham, V. J., James, M., Frame, M. and Winder, S. J. (2000) EMBO J., 19, 2911-2923

10. Wilson, E., Sudhir, K. and Ives, H. E. (1995) J. Clin. Invest., 96, 2364-2372

11. Khachigian, L. M., Santiago, F. S., Rafty, L. A., Chan, O. L., Delbridge, G. J., Bobik, A.,

Collins, T. and Johnson, A. C. (1999) Circ. Res., 84, 1258-1267

12. Pender, N. and McCulloch, C. A. G. (1991) J. Cell Sci., 100, 187-193

13. Hui, M. Z., Tenenbaum, H. C. and McCulloch, C. A. G. (1997) J. Cell. Physiol., 172, 323-333

14. Glogauer, M., Arora, P .D., Yao, G., Sokholov, I., Ferrier, J. and McCulloch, C. A. G. (1997) J.

Cell Sci., 110, 11-21

15. D’Addario, M., Ahmad, A., Xu, J. W. and Menezes, J. (1999) FASEB J., 13, 2203-2213

16. Arora, P. D. and McCulloch, C. A. G. (1996). J. Biol. Chem., 271, 20516-20523

17. Goelz, S., Hamilton, S. and Vogelstein, B. (1985) Biochem. Biophys. Res. Comm., 130, 118-

126

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

27

18. Prestridge, D. S. (1995) J. Mol. Biol., 249, 923-932

19. Rafty, L. A. and Khachigian, L. M. (2001) Nucleic Acid Res., 29, 1027-1033

20. Raingeaud, J., Gupta, S., Rogers, J. S., Dickens, M., Han, J., Ulevitch, R. J. and Davis, R. J.

(1995) J. Biol. Chem., 270, 7420-7426

21. Raingeaud, J., Whitmarsh, A. J., Barrett, T., Derijard, B. and Davis, R. J. (1996) Mol. Cell.

Biol., 16, 1247-1255

22. Enslen, H., Raingeaud, J. and Davis, R. J. (1998) J. Biol. Chem., 273, 1741-1748

23. Zanke, B., Rubie, E., Winnett, E., Chan, J., Randall, S., Parsons, M., McInnis, M., Yan, M.,

Templeton, D. and Woodgett, J.R. (1996) J. Biol. Chem. 271, 29876-29881

24. Wang, J., Seth, A. and McCulloch, C. A. G. (2000) Am. J. Physiol. Heart Circ. Physiol., 279,

H2776-H2785

25. Liang, F. and Gardner, D. G. (1999) J. Clin. Invest., 104, 1603-1612

26. Plopper, G. and Ingber, D. E. (1993) Biochem. Biophys. Res. Comm., 193, 571-578.

27. Aplin, A., Stewart, S. A., Assoian, R. K. and Juliano, R. L. (2001) J. Cell Biol., 153, 273-281.

28. Chang, L. and Karin, M. (2001) Nature, 410, 37-40

29. McLauglin, M., Kumar, S., McDonnell, P. C., Van Horn, S., Lee, J. C., Livi, G. and Young, P.

R. (1996) J. Biol. Chem., 271, 8488-8492

30. Tan, Y., Rouse, J., Cariati, S., Cohen, P. and Comb, M. (1996) EMBO J., 15, 4629-4642

31. Waskiewicz, A. J., Flynn, A., Proud, C. G. and Cooper, J. (1997). EMBO J., 16, 1909-1920

32. New, L., Jiang, Y., Zhao, M., Liu, K., Zhu, W., Kato, Y., Parry, G. and Han, J. (1998) EMBO

J., 17, 3372-3384

33. Jackson, S. P., MacDonald, J. J., Miller, S. L. and Tjian, R. (1990) Cell, 63, 155-165

34. Fojas de Borja, P., Collins, N., Clifford, J. A. and Mudryi, M. (2001) EMBO J., 20, 5737-5747

35. Brivanlou, A. H. and Darnell, Jr., J. E. (2002) Science, 295, 813-818

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

28

36. Kainulainen, T., Pender, N., D'Addario, M., Feng, Y., Lekic, P. and McCulloch, C. A. G.

(2002) J. Biol. Chem., 277, 21998-22009

37. Dimitratos, S. D., Woods, D., Stathakis, D. and Bryant, P. J. (1999) Bioessays, 21, 912-921

38. Weston, C. R. and Davis, R. J. (2002) Curr. Opin. Gen. Dev., 12, 14-21

39. Gorlich, D. and Kutay, U. (1999) Ann. Rev. Cell Dev. Biol., 15, 607-660

40. Cyert, M. (2001) J. Biol. Chem., 276, 20805-20808

41. Whitehurst, A.W., Wilsbacher, J., You, Y., Phelps, K. L., Moore, M. S., and Cobb, M. (2002)

Proc. Natl. Acad. Sci. USA, 99, 7496-7501

42. Brent-Carter, A., Knudtson, K. L., Monick, M. M. and Hunninghake, G. W. (1999) J. Biol.

Chem., 274, 30858-30863

43. Craig, R., Larkin, A., Mingo, A. M., Thuerauf, J., Andrews, C., McDonough, P. and

Glembotski, C. (2000) J. Biol. Chem., 275, 23814-23824

44. Lemon, B. and Tjian, R. (2000) Genes & Dev., 14: 2551-2569

45. McDonough, P., Hanford, D., Sprenkle, A. B., Mellon, N. R. and Glembotski, C. (1997) J.

Biol. Chem., 272, 24046-24053.

46. Kardassis, D., Papakosta, P., and Moustakas, A. (1999) J. Biol. Chem., 274, 29572-29581

47. Kaytor, E. N., Zhu, J., Pao, I. and Phillips, L. S. (2001) J. Biol. Chem., 276, 36896-36901

48. Melnikova, I. N. and Gardner, P. D. (2001) J. Biol. Chem., 276, 19040-19045

49. Hirano, F., Tanaka, H., Hirano, Y., Hiramoto, M., Handa, H., Makino, I. and Scheidereit, C.

(1998) Mol. Cell Biol., 18, 1266-1274

50. Koutsodontis, G., Tentis, I., Papakosta, P., Moustakas, A. and Kardassis, D. (2001) J. Biol.

Chem., 276, 29116-29125

51. Laniel, A. M., Poirier, G. G. and Guerin, S. L. (2001) J. Biol. Chem., 276, 20766-20773

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

29

52. Saito, T., Takahashi, Y., Hashimoto, H. and Kamataki, T. (2001) J. Biol. Chem., 276, 38010-

38022

53. Leggett, R., Armstrong, S., Barry, D. and Mueller, C. (1995) J. Biol. Chem., 270, 25879-25884

54. Daniel, S., Zhang, S., Roach, A. D. and Kim, K. H. (1996) J. Biol. Chem., 271, 14692-14697

55. Mongiat, J., M., Pouyssegur, J., and Pages, G. (2002) J. Biol. Chem., 277, 20631-20639

56. Yang, T., Xiong, Q., Enslen, H., Davis, R. J., and Chow, C. W. (2002) Mol. Cell Biol. 22,

3892-3904

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

30

Figure Legends

Figure 1: Mechanical force-induced activation of filamin-A. A) Adherent fibroblasts were

cultured in normal serum-containing medium, incubated with collagen coated magnetite

beads at a ratio of ~10 beads/cell and subjected to vertically directed tensile forces (0.48

pN/µm2). Total RNA was isolated after 6 hr of force and 1 µg was subjected to RT-PCR

analysis for filamin-A and GADPH. Lane 1: indicates bead loading without force; lane 2:

cells were subjected to force application; lane 3: same as lane 2 but cells were pretreated

with mAb 4B4 (anti-β1 integrin); lane 4: cells were incubated with BSA covered beads (1

mg/ml) and force applied; lane 5: same as lane 2 but cells were pretreated with

latrunculin-B (1.0 µM) prior to force application; lane 6: same as lane 2 but cells were

pretreated with SB203580 (2.0 µM) and lane 7: same as lane 2 but cells were pretreated

with PD98059 (5 µM). Histograms show data from n=3 independent experiments and are

densitometric analyses relative to the levels of GAPDH in each lane. For the northern blot

analysis shown below; lane 1 indicates bead-loaded cells without force application and

lane 2 demonstrates RNA from force treated cells. On the graph, the northern blot data is

shown in solid black bars. B) Western blot analysis of filamin-A, β-actin, pp38, and p38

protein content in untreated (-) and force-treated fibroblasts. In samples treated with

force, cells were untreated (force alone) or pre-incubated with SB203580 or PD98059

prior to force application for the times indicated below each blot. Equal amounts of total

cellular protein were loaded in each lane, separated on denaturing polyacrylamide gels

that were subsequently scanned, quantified and shown on the graphs below each section.

Data are means and standard errors from n=3 experiments.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

31

Figure 2: Force application causes pp38 and p38 localization to the nucleus and magnetite

bead/integrin locus. Cells were grown on glass slides and in section A were fixed with

methanol and in B cells were fixed with paraformaldehyde and permeabilized with

Triton-X. Ai) Cells were untreated or UV-irradiated for 30 min and stained for pp38. Aii,

B Cells were incubated with collagen-coated magnetite beads and treated with force (d-i

in Aii and c-f in B) or without force (a-c in Aii and a, b in B) and then stained for pp38 (e

in Aii and d in B) or p38 (h in Aii and f in B). Nuclei were localized with DAPI staining

(Aii-c, f, i). B) Force application increases the levels of pp38 and filamin at the focal

adhesion/magnetite beads. Magnetite beads with the associated focal adhesion complexes

were isolated from untreated and force-treated cells and were immunoblotted for pp38,

talin, filamin and actin. Mechanical force induced pp38/p38 migration to focal adhesion

complexes and increased filamin content at these sites.

Figure 3: Mechanical force induction of filamin-A is dependent on an intact actin cytoskeleton.

A) Fibroblasts were grown on glass slides, pre-incubated with latrunculin-B for 20 min

and then either untreated or subjected to force. Cells were fixed with paraformaldehyde

and stained for pp38 or p38. Rhodamine phalloidin was used to stain actin filaments.

Note that disruption of the actin cytoskeleton by latrunculin-B blocked mobilization of

p38 and pp38 to the integrin/magnetite bead locus (compare these results with those of

Fig. 2B). Note that beads shown in right panel correspond to cells treated with force

shown in middle panel. Control cell at top was not treated with latrunculin B and was

stained with rhodamine actin. B) Filamin-A and pp38 western blot analysis of untreated

and force-treated fibroblasts. Equal amounts of total cellular protein were isolated from

force treated cells pre-incubated for 20 min with latrunculin-B (1 µM) and analyzed for

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

32

filamin-A, β-actin, pp38 and p38 protein. The relative levels of each protein were

determined by densitometry and plotted as means and standard errors of ratios relative to

the levels of β-actin. The data were derived from 3 independent experiments. Note the

difference in time scale between the right side and left side histograms in B. Disruption of

the actin cytoskeleton abrogated the induction of filamin-A protein by force (p<0.05).

Figure 4: Filamin-A gene transcription is increased in p38 and MKK6 transfected cells.

Fibroblasts were cultured at 75% confluence in 6 well plates and transfected with the

vectors indicated below. Total RNA was isolated and 1 µg was subjected to RT-PCR

analysis for filamin-A and GADPH. Lane 1: bead-loaded cells, no force (mock

transfected); lane 2: bead-loaded cells with force (mock transfected); lane 3: cells

transfected with pCMV-MKK6AL; lane 4: cells transfected with pCMV-MKK6+; lane 5:

cells transfected with pCMV-p38; lane 6: cells transfected with pCMV-Sp1; lane 7: cells

transfected with pCMV-p38 and treated with SB203580 and lane 8: cells transfected with

pCMV-p38 and treated with PD98059. Data are the mean values and standard errors from

n=3 experiments.

Figure 5: Filamin-A and Sp1 protein contents are augmented in fibroblasts transfected by MKK6

and p38 expression vectors. Cells were transfected with pCMV-MKK6+ (A), pCMV-

MKK6AL (B) or pCMV-p38+ (C) and total cellular protein was analyzed 48 hr later for

filamin-A, Sp1 by immunoblotting and densitometry. In addition, the ratios of pp38/p38

blot densities were computed and presented as means±standard errors of the ratios. For

the left panel graphs: lane 1: bead-loaded, no force; lane 2: bead-loaded with force; lane

3: cells transfected with each respective vector; lane 4: cells transfected and subjected to

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

33

force application. For the right side graphs, the relative induction was plotted as pp38/p38

and the four lanes are; lane 1: bead-loaded, no force; lane 2: bead-loaded, force

application; lane 3: transfected cells and lane 4: transfected cells subjected to force

application. Each plotted bar graph shows the result of three individual experiments (n=3;

data are mean±standard errors of the mean).

Figure 6: MKK6/p38 activate a filamin-A promoter construct containing Sp1-dependent

transcription factor binding sites. Rat-2 fibroblasts were cultured at 70% confluence the

day prior to transfection. Following transfection (36-48 hours later), cells were loaded

with beads, treated with force (or not), lysed and whole cell protein was analyzed for

luciferase activity. In all single and co-transfection assays, preliminary titration

experiments were performed to determine the optimal amount of each vector needed. In

addition, all relative induction values were determined in comparison to the basal

transfection luciferase level of pFil3.2luc (arbitrarily chosen as 1; n= 3 individual). For

assays requiring the use of either SB203580 or PD98059, these reagents were added 20

min prior to the application of force (6-8 hrs). All expression vectors and reporter vectors

(denoted above each bar graph) are described in the materials and methods. In those

transfection experiments requiring additional treatments, the specific treatments are

described in the central panel. Note the difference in the relative increases of induction on

the X-axis in the three graphs. Data are means and standard errors of means from 3

independent experiments. pFil3.2luc is the full-length filamin A promoter construct while

pFil75(wt)luc is a 75 bp minimal construct for assessing promoter activity. The

pFil75(mut)luc contains 2 mutated Sp1 binding sites.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

34

Figure 7: Force application enhances binding of Sp1 to filamin-A proximal promoter elements.

A) Fibroblasts were plated on 100 mm culture dishes and subjected to vertically applied

forces for various lengths of time. Cells were lysed, nuclear extracts (NE) were prepared

and 5 µg of nuclear protein was bound to the filamin-A Sp1 binding site (-15, described

in the materials and methods). Lane 1: bead-loaded, no force; lane 2: 4 hr of force

application; lane 3: 8 hr of force application; lane 4: 12 hr of force application and lane 5:

24 hr of force application. B) Competition assays were performed on NE isolated from

force-treated fibroblasts. Lane 1: NE from bead-loaded control cells; lane 2: NE from

force-treated cells; lane 3: same as lane 2, but competition with 200-fold molar excess of

unlabelled mutant Sp1 filamin oligonucleotide (5’-

CTCTCTCGGGCGGGGAGCTCAG-3’); lane 4: same as lane 2, but competition with

100 fold molar excess of unlabelled wild type Sp1 oligonucleotide; lane 5: same as lane

2, but competition with 200-fold molar excess of unlabelled wild type Sp1

oligonucleotide; lane 6: same as lane 2, but competition with 200-fold molar excess of

unlabelled wild type Igγ NF-κBp50 oligonucleotide. C) Supershift detection of Sp1 in the

filamin-A promoter of force-treated fibroblasts. Fibroblasts were subjected to force,

nuclear proteins were prepared and subjected to EMSA analysis. Five micrograms of NE

were bound to the filamin-A Sp1 oligonucleotide and run on a native Tris-glycine gel.

Bound extracts were lane 1: untreated cell extracts; lane 2: 75 ng of anti-Sp1 mAb; lane

3: 1 µg of anti-NF-κB50 mAb; lane 4: 1 µg of anti-CREB mAb and lane 5: 1 µg of anti-

Sp1 mAb.

Figure 8: Fibroblasts subjected to force exhibit increased Sp1 phosphorylation and enhanced

binding of p38 to β-actin and Sp1. Fibroblasts were cultured in 6 well dishes and were

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

35

untreated (-) or subjected to force (+). Cell extracts were immunoprecipitated with

antibody to either pp38, p38 or FLAG. The immunoprecipitated material was separated

on a 5-20% gradient-denaturing PAGE, transferred to nitrocellulose and then

immunoblotted for β-actin. Lysates were immunoprecipitated (with antibody to FLAG)

from cells transfected with pCMV-p38FLAG, separated on a 5-20% gradient-denaturing

PAGE and immunoblotted for β-actin. Force application increased the interaction of

p38/pp38 with β-actin. Each histogram shows the mean and range from two independent

experiments.

Figure 9: Force application to fibroblasts increases levels of phosphorylated Sp1. Cell extracts

from untreated (-) and force-treated (+) cells were immunoprecipitated with antibody to

Sp1, separated on a 5-20% gradient denaturing PAGE, transferred to nitrocellulose and

immunoblotted with anti-phosphoserine/threonine antibody. As a standard,

immunoprecipitated material from force-treated and untreated cells was immunoblotted

for Sp1 with a different Sp1 antibody (ii). Each histogram shows the mean and range

from two independent experiments.

Figure 10: Sp1 and pp38 associated at higher levels in force treated fibroblasts. Cell extracts

from untreated and force-treated cells were immunoprecipitated with pp38 and p38

antibodies, separated on a gradient denaturing PAGE and immunoblotted for Sp1 (i) or

for phosphoserine/threonine in adjacent lanes (ii). In all experiments, compared to

untreated cells, extracts from force-treated cells showed enhanced p38 and pp38

interaction with Sp1 and phosphoserine/threonine residues that co-migrated with Sp1.

Histograms are mean and range from two independent experiments.

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from

Mario D'Addario, Pamela D Arora, Richard P Ellen and Christopher A. G. McCullochfilamin-A

proteinb1-integrin-mediatedtranscriptional circuit that regulates the actin binding Interaction of p38 and Sp1 in a mechanical force-induced,

published online September 24, 2002J. Biol. Chem. 

  10.1074/jbc.M207681200Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

by guest on Novem

ber 14, 2020http://w

ww

.jbc.org/D

ownloaded from