Published Ahead of Print 9 March 2009. 10.1128/AAC.01617-08.

2009, 53(6):2274. DOI:Antimicrob. Agents Chemother. Vocadlo and Brian L. MarkAzizah Asgarali, Keith A. Stubbs, Antonio Oliver, David J. 

aeruginosaPseudomonas-Lactam Resistance in

βNagZ Attenuates Antipseudomonal Inactivation of the Glycoside Hydrolase

http://aac.asm.org/content/53/6/2274Updated information and services can be found at:

These include:

REFERENCEShttp://aac.asm.org/content/53/6/2274#ref-list-1at:

This article cites 50 articles, 25 of which can be accessed free

CONTENT ALERTS more»articles cite this article),

Receive: RSS Feeds, eTOCs, free email alerts (when new

http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

on July 13, 2014 by S

UZ

AN

NE

RIC

HA

RD

http://aac.asm.org/

Dow

nloaded from

ANTIMICROBIAL AGENTS AND CHEMOTHERAPY, June 2009, p. 2274–2282 Vol. 53, No. 60066-4804/09/$08.00�0 doi:10.1128/AAC.01617-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Inactivation of the Glycoside Hydrolase NagZ AttenuatesAntipseudomonal �-Lactam Resistance in

Pseudomonas aeruginosa�

Azizah Asgarali,1 Keith A. Stubbs,2† Antonio Oliver,3 David J. Vocadlo,2 and Brian L. Mark1*Department of Microbiology, University of Manitoba, Winnipeg, Manitoba, Canada R3T 2N21; Department of Chemistry,

Simon Fraser University, 8888 University Drive, Burnaby, British Columbia, Canada V5A 1S62; andServicio de Microbiología, Hospital Son Dureta, Palma de Mallorca, Spain3

Received 5 December 2008/Returned for modification 25 January 2009/Accepted 1 March 2009

The overproduction of chromosomal AmpC �-lactamase poses a serious challenge to the successful treat-ment of Pseudomonas aeruginosa infections with �-lactam antibiotics. The induction of ampC expression by�-lactams is mediated by the disruption of peptidoglycan (PG) recycling and the accumulation of cytosolic1,6-anhydro-N-acetylmuramyl peptides, catabolites of PG recycling that are generated by an N-acetyl-�-D-glucosaminidase encoded by nagZ (PA3005). In the absence of �-lactams, ampC expression is repressed bythree AmpD amidases encoded by ampD, ampDh2, and ampDh3, which act to degrade these 1,6-anhydro-N-acetylmuramyl peptide inducer molecules. The inactivation of ampD genes results in the stepwise upregulationof ampC expression and clinical resistance to antipseudomonal �-lactams due to the accumulation of the ampCinducer anhydromuropeptides. To examine the role of NagZ on AmpC-mediated �-lactam resistance in P.aeruginosa, we inactivated nagZ in P. aeruginosa PAO1 and in an isogenic triple ampD null mutant. We showthat the inactivation of nagZ represses both the intrinsic �-lactam resistance (up to 4-fold) and the highantipseudomonal �-lactam resistance (up to 16-fold) that is associated with the loss of AmpD activity. We alsodemonstrate that AmpC-mediated resistance to antipseudomonal �-lactams can be attenuated in PAO1 and ina series of ampD null mutants using a selective small-molecule inhibitor of NagZ. Our results suggest that theblockage of NagZ activity could provide a strategy to enhance the efficacies of �-lactams against P. aeruginosaand other gram-negative organisms that encode inducible chromosomal ampC and to counteract the hyper-induction of ampC that occurs from the selection of ampD null mutations during �-lactam therapy.

Pseudomonas aeruginosa is a versatile gram-negative bacte-rium that is ubiquitous in the environment. Over the last cen-tury, it has emerged as one of the most significant opportunis-tic pathogens of humans and now accounts for over 10% of allhospital-acquired infections (10, 35, 41). P. aeruginosa exhibitshigh levels of intrinsic resistance to antibiotics, and P. aerugi-nosa infections are often persistent and associated with con-siderable morbidity and mortality (12, 36). P. aeruginosa is aleading cause of nosocomial pneumonia, urinary tract infec-tions, and secondary bacteremia associated with burn wounds(36, 46). Moreover, environmental reservoirs of P. aeruginosaplay a primary role in the morbidity and mortality of patientswith cystic fibrosis (CF) by chronically colonizing the lungs ofthese patients (35). Nearly 80% of patients with CF becomeinfected with this microbe by early adulthood (9, 13, 23).

Many antibiotics initially overcome the intrinsic drug resis-tance mechanisms of P. aeruginosa; however, all clinically rel-evant therapies can be compromised by the generation of drug-resistant genetic mutants (28). Intrinsic resistance to �-lactamantibiotics occurs via the induction of chromosomally encoded

AmpC �-lactamase (19, 29). The degree of resistance to �-lac-tams depends on the level of ampC gene induction; although theyare susceptible to hydrolysis by AmpC, some penicillins (such aspiperacillin) and cephalosporins (such as cefepime or ceftazi-dime) exhibit antipseudomonal activity because they are weakinducers of ampC expression (27). However, the prolonged use ofantipseudomonal �-lactams frequently selects for mutants thathyperproduce AmpC �-lactamase, which often leads to the fail-ure of treatment with these antibiotics (11, 28).

Inducible chromosomal ampC has been identified in a num-ber of enterobacteria and in P. aeruginosa. The regulation ofampC induction in these microorganisms is closely coupled tocell wall peptidoglycan (PG) recycling (Fig. 1) (27, 32, 33).During growth, periplasmic autolysins process a considerableamount of PG into GlcNAc-1,6-anhydromuropeptide (tri-,tetra-, and pentapeptide) fragments (for a review, see refer-ence 49). These fragments are transported into the cytosol (4,6), where the nonreducing GlcNAc residue is removed by afamily 3 (14) glycoside hydrolase encoded by nagZ (3, 50). Theresulting products are GlcNAc and a pool of cytosolic 1,6-anhydro-MurNAc peptides (tri-, tetra-, and pentapeptides) (3,50), which are normally recycled into UDP-MurNAc pen-tapeptide, a PG precursor that is exported to the periplasm andreincorporated back into the cell wall.

From the pool of 1,6-anhydro-MurNAc peptide catabolites,either the tripeptide species (17) or the pentapeptide species(7) is believed to be the signaling molecule that induces ampCtranscription, whereas the anabolic product UDP-MurNAc

* Corresponding author. Mailing address: Department of Microbi-ology, University of Manitoba, 418 Buller Building, Winnipeg, Mani-toba, Canada R3T 2N2. Phone: (204) 480-1430. Fax: (204) 474-7603.E-mail: brian_mark@umanitoba.ca.

† Present address: Chemistry M313, School of Biomedical, Biomo-lecular and Chemical Sciences, University of Western Australia, 35Stirling Highway, Crawley, WA 6009, Australia.

� Published ahead of print on 9 March 2009.

2274

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

pentapeptide acts to repress ampC transcription (Fig. 1).These metabolites are thought to competitively regulate ampCtranscription by directly binding to a LysR-type transcriptionalregulator encoded by ampR (17). Together, ampR and ampCform a divergent operon with overlapping promoter regions towhich AmpR binds and thereby regulates the transcription ofboth genes (2, 26). The relative levels of these metabolitesgovern whether ampC is transcribed.

Under normal growth conditions, the cytosolic concentra-tion of 1,6-anhydro-MurNAc peptide is suppressed by the ac-tivity of AmpD, a cytoplasmic N-acetyl-muramyl-L-alanineamidase that cleaves the stem peptide off from both GlcNAc-1,6-anhydro-MurNAc peptide and 1,6-anhydro-MurNAc pep-tide (16, 18). The low cellular level of these inducer moleculestherefore allows UDP-MurNAc pentapeptide to bind toAmpR and promote the formation of an AmpR-DNA complexthat represses ampC transcription. Exposure to �-lactams,however, elevates the level of PG fragmentation (6, 34, 48) tolevels that cannot be efficiently processed by endogenousAmpD activities, allowing the NagZ products 1,6-anhydro-MurNAc tripeptide (or pentapeptide) to accumulate and pre-sumably competitively displace UDP-MurNAc pentapeptide

from AmpR, generating a complex that acts as a transcrip-tional activator of ampC (17). Although antipseudomonal�-lactams, such as ceftazidime, piperacillin, and cefepime, arenot susceptible to this intrinsic resistance mechanism, the se-lection of loss-of-function mutations in ampD (20, 22, 25, 40)shunts PG recycling toward the accumulation of cytosolic 1,6-anhydro-MurNAc peptide and causes the derepression ofampC at a level of that is sufficient to confer resistance to eventhese �-lactams (16, 21).

P. aeruginosa has recently been found to encode three ampDhomologues: ampD, ampDh2, and ampDh3. All three appearto work in concert to repress ampC induction (21); the step-wise deletion of ampD, ampDh2, and ampDh3 results in athree-step upregulation mechanism of ampC expression, withthe triple null mutant exhibiting complete derepression ofchromosomal AmpC �-lactamase (21). The presence of mul-tiple ampD homologues appears to provide P. aeruginosa theability to acquire resistance to �-lactams through the partialderepression of ampC expression via loss-of-function muta-tions in ampD even while maintaining its fitness and virulenceby sustaining PG recycling via the activities of AmpDh2 andAmpDh3 (31). Recently, a �-lactam-resistant P. aeruginosaisolate from the lung of a CF patient was found to containloss-of-function mutations in both ampD and ampDh3 (37);however, the inactivation of multiple ampD homologues maybe uncommon, since the constitutive hyperexpression of ampChas been linked to reduced fitness (30, 31).

Given that NagZ catalyzes the formation of the inducermolecule 1,6-anhydro-MurNAc tripeptide (or pentapeptide),inhibition of the activity of this enzyme in P. aeruginosa mayprovide an effective strategy to prophylactically repress ampCexpression during �-lactam therapy or to enhance the efficacyof antipseudomonal penicillins and cephalosporins against re-sistant mutants containing ampD null mutations. We recentlydemonstrated that a series of selective small-molecules inhib-itors targeting NagZ could repress ampC induction in an Esch-erichia coli model system harboring the ampC-ampR operonfrom Citrobacter freundii (42). This model system was previ-ously used to demonstrate that the NagZ function is requiredfor the production of AmpC �-lactamase from a plasmid-borne ampC-ampR operon (50). The importance and func-tional role, however, of NagZ in gram-negative pathogens witha chromosomally encoded ampC-ampR operon have not yetbeen investigated.

To understand the role of NagZ in the AmpC �-lactamaseinduction pathway of P. aeruginosa, we have inactivated nagZ(PA3005) in P. aeruginosa reference strain PAO1 (41) and inan AmpD-deficient strain of PAO1 (strain PA�DDh2Dh3,in which ampD [D], ampDh2 [Dh2], and ampDh3 [Dh3] areinactivated) (21) (Table 1). We have measured the sensitivitiesof the nagZ null mutants to antipseudomonal �-lactams anddemonstrate that the inactivation of nagZ reduces both intrin-sic �-lactam resistance and the high antipseudomonal �-lactamresistance associated with the loss of AmpD activity. We alsodemonstrate that AmpC-mediated resistance to antipseudo-monal �-lactams can be suppressed in P. aeruginosa by using apotent and selective small-molecule inhibitor of NagZ. Theresults suggest that the blockage of NagZ activity could providean effective strategy to enhance the efficacies of �-lactamsagainst gram-negative pathogens encoding inducible chromo-

FIG. 1. Schematic of the PG recycling pathway and its role inAmpC �-lactamase induction. During growth, GlcNAc-1,6-anhydro-MurNAc tri-, tetra-, and pentapeptides (only the tripeptide species isshown) are excised from the PG and transported into the cytoplasm viathe AmpG permease. The removal of GlcNAc by NagZ produces1,6-anhydro-MurNAc peptide (boxed at the right), and either thetri- or pentapeptide species is believed to be responsible for the acti-vation of AmpR to express ampC from the ampC-ampR operon.AmpD clears the muropeptide from the cytoplasm by removing thestem peptides from both GlcNAc-1,6-anhydro-MurNAc and 1,6-anhy-dro-MurNAc. These PG degradation products are eventually recycledinto UDP-MurNAc pentapeptide (boxed at the left), a precursor mol-ecule of PG synthesis and a repressor of AmpR. Exposure to �-lactamscauses an increased cytosolic concentration of the 1,6-anhydro-MurNAc peptide that is sufficient to convert AmpR into an activator ofampC transcription.

VOL. 53, 2009 ATTENUATION OF P. AERUGINOSA �-LACTAM RESISTANCE 2275

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

somal AmpC and counteract the hyperinduction of AmpC�-lactamase that occurs from the selection of ampD mutantsduring �-lactam therapy.

MATERIALS AND METHODS

Bacterial strains, plasmids, and antibiotics and reagents. Pseudomonasaeruginosa PAO1 (41) was used as the wild-type strain for this work. Growthmedia were from Becton Dickinson Canada (Oakville, Ontario, Canada). Allmutant derivatives of PAO1, plasmid constructs, and E. coli strains are describedin Table 1. Etest strips were from AB Biodisk (Solna, Sweden), and antibioticpowders for liquid MIC measurements were from Sigma-Aldrich Canada(Oakville, Ontario, Canada). All additional chemicals and enzymes were oflaboratory reagent grade. P. aeruginosa NagZ was recombinantly expressed andpurified as previously described (43). The Ki value of O-(2-deoxy-2-N-2-ethyl-butyryl-D-glucopyranosylidene)amino N-phenylcarbamate (EtBuPUG) was de-termined against P. aeruginosa NagZ essentially as described previously (42).

Insertional inactivation of nagZ gene. By using purified PAO1 genomic DNAas the template, a 950-bp region upstream of and including the first 31 bp of nagZ(PA3005) (Entrez GeneID 880216) was amplified by PCR with primers NagZ-FH1 and NagZ-RP1 (Table 2) and restricted with HindIII and PstI. A second1,015-bp region containing the last 246 bp of nagZ and adjacent downstreamDNA was amplified with primers NagZ-FP2 and NagZ-RE2 (Table 2) andrestricted with PstI and EcoRI. The restricted amplicons were ligated togethervia a three-way reaction into pEX18Tc (15) that had been linearized withHindIII and EcoRI. The ligation reaction was used to transform chemicallycompetent E. coli NM522 cells, and transformants were selected on Luria-Bertani (LB) agar supplemented with 5 �g/ml tetracycline. Recombinant plasmidpEXNagZ was isolated from a single transformant, and its presence was verifiedby restriction analysis and DNA sequencing. To generate the mobilizable suicideplasmid pEXNagZGm, the gentamicin resistance cassette (aacC1) was excisedfrom plasmid pUCGm (38) by PstI restriction and ligated into the unique PstI

site that had been introduced by PCR into the truncated nagZ gene of pEXNagZ.Recombinant pEXNagZGm was isolated from a single transformant of E. coliNM522 that had been selected on LB agar supplemented with 20 �g/ml genta-micin. The presence of the plasmid was verified by restriction analysis and wasthen transferred into PAO1 and the triple ampD null mutant PA�DDh2Dh3(Table 1) by diparental mating on LB agar with E. coli S17-1 as the donor (39)to create PA�nagZ and PA�DDh2Dh3nagZ, respectively (Table 1). Merodip-loids were selected on Pseudomonas isolation agar supplemented with 50 �g/mlgentamicin, followed by the selection of double crossovers with 5% sucrose. Theexistence of mutants was verified by assaying for resistance to gentamicin andsusceptibility to tetracycline by replica plating. The presence of the insertion wasconfirmed by restriction analysis and sequencing of the PCR products generatedwith oligonucleotides which primed to sites on the genome flanking that whichwas cloned into suicide plasmid pEXNagZGm.

Cloning of wild-type nagZ for complementation studies. Full-length nagZ wasamplified from purified P. aeruginosa PAO1 genomic DNA by PCR with Pfupolymerase and oligonucleotide primers NagZ-FpUC and NagZ-RpUC (Table2). The PCR amplicon was restricted with PstI and BamHI and ligated intopUCP27 (51). The ligation reaction was used to transform chemically competentE. coli NM522 cells, and transformants were selected on LB agar supplementedwith 5 �g/ml tetracycline. The recombinant plasmid was isolated from a singletransformant, and its presence was verified by restriction analysis and DNAsequencing. The resulting nagZ expression plasmid, pUCPNagZ (Table 1), waselectroporated into the nagZ-deficient P. aeruginosa PAO1 mutants PA�nagZand PA�DDh2Dh3nagZ (Table 1). Transformants were selected on LB agarsupplemented with 100 �g/ml tetracycline to generate strains PA�nagZ-(pUCPNagZ) and PA�DDh2Dh3nagZ(pUCPNagZ), respectively (Table 1). Theinclusion of a His6 tag fused to the C terminus of the nagZ open reading framewas used to verify the expression of the recombinant protein by Western blotting(data not shown).

Antibiotic susceptibility testing. MICs were determined with Etest strips (ABBiodisk) on Mueller-Hinton agar plates, according to the manufacturer’s recom-

TABLE 1. Plasmids and bacterial strains

Plasmid or strain Genotype or description Reference or source

PlasmidspEX18Tc Tcr oriT� sacB�, gene replacement vector with MCS from pUC18 15pUCP27 Tcr pUC18-derived broad-host-range vector 51pUCPNagZ Tcr; pUCP27 containing wild-type PAO1 nagZ gene (PA3005) This workpUCGM Apr Gmr; source of Gmr cassette (aacC1 gene) 15pEXNagZGm pEX18Tc containing 5� and 3� flanking sequences of nagZ::Gm This work

E. coli S17-1 RecA pro (RP4-2 Tet::Mu Kan::Tn7) 39

P. aeruginosaPAO1 Reference strain, completely sequenced 41PA�DDh2Dh3 PAO1 �ampD::lox �ampDh2::lox �ampDh3::lox 21PA�nagZ PAO1 �nagZ::Gm This workPA�DDh2Dh3nagZ PAO1 �ampD::lox �ampDh2::lox �ampDh3::lox �nagZ::Gm This work

TABLE 2. Oligonucleotide primers

Primer Sequence (5�–3�)a Restrictionenzyme

PCR productlength (bp) Use

NagZ-FH1 CATATCAAGCTTCCAGTCGGAAACCGTCGAACGC HindIII 950 NagZ inactivationNagZ-RP1 GATATACTGCAGCGATGTCGAGCATCAGAGAGCC PstI

NagZ-FP2 GATATACTGCAGGCCCATGTGGTCGGCGAC PstI 1,015 NagZ inactivationNagZ-RE2 GATATAGAATTCTGGCCGCCTAGCCGGCCAGG EcoRI

NagZ-FpUC GATATACTGCAGAAGAAGGAGATATACATATGCAAGGCTCTCTGATGCTC

PstI 1,057 NagZ complementation

NagZ-RpUC GATATAGGATCCTCAGTGATGGTGATGGTGATGATCAATCAGTTGCGCAGC

BamHI

a Primer sequences were obtained from the published PAO1 genome (41). Sites for restriction endonucleases are underlined. The ribosome-binding site derived frompET vector T7 is shown in italics. The His6 fusion tag added to the C terminus of the nagZ open reading frame of the complementation plasmid pUCPnagZ is shownin boldface.

2276 ASGARALI ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

mendations, or by the broth microdilution method, as recommended by the CLSI(formerly the NCCLS) (5), with cation-adjusted Mueller-Hinton medium. Forbroth microdilution, appropriate serial dilutions of the �-lactam antibiotics wereprepared in 96-well plates, and each concentration was assayed in 200 �l of brothinoculated with �104 cells taken from starter cultures grown to an optical densityat 600 nm (OD600) of �0.5. MICs were determined after incubation of the platesat 37°C for 18 h in a shaker incubator. MIC measurements in the presence of theNagZ selective inhibitor EtBuPUG were carried out by preparing 96-well platescontaining serial dilutions of �-lactam antibiotics in 80 �l of Mueller-Hintonbroth. The volume was brought to 100 �l by addition of either 20 �l of EtBuPUG(5 mM in H2O) or 20 �l H2O. These broths were then inoculated with 100 �l ofthe desired culture and allowed to incubate at 37°C for 18 h. The MICs weredetermined from the antibiotic concentration in the wells in which no growth wasobserved. Susceptibility tests of strains transformed with pUCP27 or pUCPNagZwere performed as described above; however, to maintain the complementationplasmid, the broth was supplemented with 50 �g/ml tetracycline for the microdi-lution assays and the agar plates were supplemented with 75 �g/ml tetracyclinefor measurements made with Etest strips. All MICs were determined in tripli-cate.

Agar diffusion tests. The appropriate bacterial culture was prepared by inoc-ulating 5 ml of Mueller-Hinton broth with the appropriate glycerol stock, and theculture was allowed to grow at 37°C until the OD600 reached �0.5. The cells wereharvested by centrifugation and were then resuspended in 2 ml of Mueller-Hinton broth and streaked onto Mueller-Hinton agar plates. Antibiotic discs(diameter, 6 mm) that had previously been loaded with 10 �l of EtBuPUG (3mM) or H2O alone were placed on the agar plates. After incubation overnight at37°C, the diameter of the inhibition zone was measured. All determinations wereperformed in triplicate.

Assay for residual N-acetyl-�-glucosaminidase activity. Lysates of cells of P.aeruginosa null mutants PA�nagZ, PA�DDh2Dh3nagZ, and PA�DDh2Dh3 andwild-type P. aeruginosa (PAO1) (Table 1) were assayed for N-acetyl-�-glu-cosaminidase activity by using 4-methylumbelliferyl N-acetyl-�-D-glucosaminide(4-MUGlcNAc) as the substrate. For each strain, 3 ml of Mueller-Hinton brothwas inoculated with a few milligrams of glycerol stock and the strain was allowedto grow at 37°C to an OD600 of �0.5, at which time each culture was diluted toan OD600 of 0.25 with fresh Mueller-Hinton broth, allowed to grow for anadditional 1.5 h at 37°C, and then harvested by centrifugation. The pellets werewashed by resuspending them twice in phosphate-buffered saline (PBS) buffer(50 mM NaPi, pH 7.4, 100 mM NaCl), followed by centrifugation. The super-natants were discarded, and the washed pellets were stored at �80°C. The cellsin the pellets were lysed by sonication in 200 �l chilled PBS buffer, and 15 �g ofprotein from each lysate was assayed for N-acetyl-�-glucosaminidase activity at37°C in a total volume of 100 �l PBS supplemented with 2 mM 4-MUGlcNAc.The reactions were allowed to proceed for 1 h, 2 h, 4 h, and 8 h and were thenquenched by addition of 0.9 ml of 0.1 M glycine-NaOH buffer (pH 10.7). Lib-erated 4-methylumbelliferone (4-MU) was detected by measurement of thefluorescence by using an excitation wavelength of 360 nm and monitoring of theemission at 450 nm. The assays were carried out in triplicate; and controlsincluded thermally denatured lysates (heated to 100°C for 20 min), native lysatesin PBS lacking 4-MUGlcNAc, 2 mM 4-MUGlcNAc alone in PBS, and blankscontaining PBS only.

Quantification of �-lactamase activity. Strains PAO1, PA�nagZ, PA�DDh2Dh3, and PA�DDh2Dh3nagZ were grown in 5 ml of Mueller-Hinton broth at37°C to an OD600 of �0.5. As described previously (21), to determine the�-lactamase specific activity (nanomoles of nitrocefin hydrolyzed per minute permilligram of protein) postinduction, strains were cultured in the presence of 50�g/ml cefoxitin for 3 h at 37°C and the resulting �-lactamase activities werecompared to the same strains cultured under the same conditions without ce-foxitin. The �-lactamase specific activity was determined from crude sonic lysatesin triplicate at 37°C by using a continuous assay procedure by following the linearrate of liberation of 2,4-dinitrophenolate from nitrocefin (initial concentration,100 �M), as determined by measurement of the absorption at 485 nm. Thereactions (500 �l) were initiated by the addition of 5 �l of appropriately dilutedsupernatant and were monitored for 5 min.

RESULTS

To demonstrate the role of NagZ in antipseudomonal �-lactamresistance, we inactivated nagZ (PA3005) in strain PAO1 (41) andin the highly antipseudomonal �-lactam-resistant triple ampDnull mutant PA�DDh2Dh3 (21) via insertional inactivation, cre-

ating strains PA�nagZ and PA�DDh2Dh3nagZ, respectively (Ta-ble 1). Strains PA�nagZ and PA�DDh2Dh3nagZ did not exhibitany change in growth rate or morphology relative to the growthrate and morphology of the parental strains. Given that thereare multiple ampD homologues in P. aeruginosa, we speculatedthat there might be other enzymes with NagZ activity. Toinvestigate if nagZ (PA3005) was the only gene encoding anenzyme with N-acetyl-�-glucosaminidase activity, we assayedcellular extracts of PA�nagZ and PA�DDh2Dh3nagZ for re-sidual activity using the substrate 4-MUGlcNAc (Fig. 2). Wefound that both PA�nagZ and PA�DDh2Dh3nagZ were de-void of N-acetyl-�-glucosaminidase activity. The presence ofonly one protein with NagZ activity in PAO1 is in agreementwith the observations made for E. coli, in which only oneprotein with NagZ activity is found (3), and our finding thatonly one protein with NagZ activity was identified in PAO1 byusing an activity-based proteomics probe (43). NagZ appearsto be solely responsible for the removal of GlcNAc from theGlcNAc-1,6-anhydro-MurNAc peptide in these microbes.

NagZ activity is required to produce the AmpR inducermolecule 1,6-anhydro-MurNAc tripeptide (or pentapeptide);thus, the inactivation of nagZ in P. aeruginosa should block the�-lactam-mediated induction of AmpC �-lactamase expressionand thereby increase the susceptibility of the organism to theseantibiotics. Our findings are in accord with this hypothesis. Themost pronounced effect on �-lactam resistance was observedwhen nagZ was inactivated in PA�DDh2Dh3 (Table 3), a tripleampD null mutant previously shown to exhibit the completederepression of ampC and high, clinical-level resistance toantipseudomonal �-lactams (21) (Table 3). As shown previ-ously (21), PA�DDh2Dh3 displayed high-level resistance to allantipseudomonal �-lactams tested except imipenem (a carbap-enem resistant to hydrolysis by AmpC) compared to the levelof resistance of PAO1 (Table 3). The MICs of aztreonam,ceftazidime, piperacillin, and piperacillin-tazobactam weresignificantly above their respective CLSI resistance break-points when their activities against PA�DDh2Dh3 weretested. Despite a significant increase in the MIC (24-fold),however, we found that the MIC of cefepime remained

FIG. 2. NagZ activity assay of wild-type P. aeruginosa and deletionmutants. NagZ activity was determined from sonicated cultures by mon-itoring 4-MU liberation, as described in Materials and Methods. E,PAO1; f, PA�nagZ; ‚, PA�DDh2Dh3; }, PA�DDh2Dh3nagZ. Thelevel of 4-MU liberation from PA�nagZ (f) and PA�DDh2Dh3nagZ (})is the same as that from thermally denatured PAO1, PA�nagZ,PA�DDh2Dh3, and PA�DDh2Dh3nagZ, confirming the absence ofNagZ activity in these strains.

VOL. 53, 2009 ATTENUATION OF P. AERUGINOSA �-LACTAM RESISTANCE 2277

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

slightly below its CLSI resistance breakpoint when its activ-ity against PA�DDh2Dh3 was tested (Table 3). Notably, theinactivation of nagZ in PA�DDh2Dh3 yielded a mutant(PA�DDh2Dh3nagZ) with significantly increased susceptibilityto all antipseudomonal �-lactams tested. Compared to the sus-ceptibility of PA�DDh2Dh3, the nagZ null mutant PA�DDh2Dh3nagZ was 4- to 6-fold more susceptible to aztreonam, cefta-zidime, and cefepime and 10- to 16-fold more susceptible topiperacillin and piperacillin-tazobactam (Table 3). The in-creased susceptibility from the loss of NagZ activity was suffi-cient to reduce the MICs for all these antipseudomonal �-lac-tams to well below their respective CLSI resistance breakpointconcentrations (Table 3).

Wild-type P. aeruginosa (PAO1) is highly susceptible to an-tipseudomonal �-lactams; it is believed that in PAO1 theseantibiotics do not induce a sufficient amount of PG fragmen-tation to saturate endogenous AmpD activity and thereby in-crease the level of ampC expression. Accordingly, the inacti-vation of nagZ in PAO1 (PA�nagZ) resulted in smallerincreases in susceptibility to antipseudomonal �-lactams whenthe MICs were measured with Etest strips. To further investi-gate if PA�nagZ was exhibiting increased susceptibility to�-lactams, we reevaluated the antibiotic susceptibility of themutant by measuring the changes in the MICs of ceftazidimeand aztreonam for PA�nagZ compared to the MICs for PAO1using the broth microdilution method with a narrow serialdilution range (32 to 0.0625 �g/ml) and cefoxitin, a very stronginducer of AmpC �-lactamase expression. Using broth mi-crodilution and appropriate antibiotic dilutions, we confirmedthat, compared to the MIC for PAO1, PA�nagZ exhibitedtwofold (0.5 �g/ml) and fourfold (0.25 �g/ml) reductions inMICs for the antipseudomonal �-lactams ceftazidime and az-treonam, respectively, and a twofold reduction in the MIC forcefoxitin (Table 3). To confirm that the observed increases insusceptibility were due to reduced levels of AmpC production,we used the substrate analogue nitrocefin to measure the basaland the induced levels of �-lactamase specific activity inPA�nagZ and PA�DDh2Dh3nagZ and compared these valuesto the �-lactamase specific activities of the respective parentalstrains PAO1 and PA�DDh2Dh3 (Table 4). As expected, wefound significant reductions in the �-lactamase specific activi-

ties for both nagZ null mutants, and these were consistent withthe MICs presented in Table 3. To verify that the changes inthe MICs resulting from the loss of NagZ activity were specificto �-lactam antibiotics, we measured the MIC of the non-�-lactam ciprofloxacin against all four strains. We found that allstrains were equally susceptible to this antibiotic (MIC, 0.2�g/ml), further supporting the specific role of NagZ in theAmpC induction pathway. Finally, as shown in Table 3, anexpression plasmid harboring nagZ was found to completelytranscomplement the �-lactam resistance phenotypes of bothPA�DDh2Dh3nagZ and PA�nagZ, demonstrating that the ob-served changes in the �-lactam resistance profiles were duesolely to the loss of NagZ activity.

Given our findings that the genetic inactivation of nagZattenuates �-lactam resistance in both PAO1 and PA�DDh2Dh3,we speculated whether the NagZ selective inhibitor EtBuPUG(Fig. 3) could also be used to suppress antipseudomonal �-lac-tam resistance in PAO1 and in a series of ampD null mutantsof P. aeruginosa. EtBuPUG has been shown to suppress AmpCproduction in E. coli (harboring an ampC-ampR operon fromC. freundii) when it is coadministered with �-lactams, yetEtBuPUG itself does not exhibit antimicrobial properties (42).Consistent with this finding, we found the growth rates of bothEtBuPUG-treated P. aeruginosa and control cultures lackingantibiotic to be identical (data not shown). However, as shownin Table 5, EtBuPUG suppressed the resistance of PAO1 andAmpD-deficient strains of P. aeruginosa to the antipseudomo-

TABLE 3. MICs of antibiotics for strain PAO1 and nagZ and/or ampD null mutants of P. aeruginosa

Strain

MIC (�g/ml)a

ATM(�8–�16)

CAZ(�8–�16)

PIP(�64–�64)

PIP-TZ(�64–�64)

FEP(�8–�16)

IMP(�4–�8)

FOX(NA)

CIP(�1–�2)

PAO1 1b 1b 1 1 0.5 3 1,600b 0.2b

PA�nagZ 0.25b 0.5b 1 1.5 0.38 2 800b 0.2b

PA�DDh2Dh3 24 48 �256 �256 12 1.5 3,200b 0.2b

PA�DDh2Dh3nagZ 4 12 24 16 3 1.5 2,400b 0.2b

Complementation with wild-type nagZPA�nagZ(pUCP27) 600b

PA�nagZ(pUCPnagZ) 1,200b

PA�DDh2Dh3nagZ(pUCP27) 6 12 16PA�DDh2Dh3nagZ(pUCPnagZ) 24 48 256

a ATM, aztreonam; CAZ, ceftazidime; FEP, cefepime; PIP, piperacillin; PIP-TZ, piperacillin-tazobactam; IMP, imipenem; FOX, cefoxitin; CIP, ciprofloxacin; NA,not available. MICs were determined by using Etest strips, unless otherwise indicated. CLSI resistance breakpoints (in �g/ml) are shown in parentheses after theabbreviation for each antibiotic. All measurements were performed in triplicate.

b MICs were determined by broth microdilution, as recommended by the CLSI (see Results).

TABLE 4. Levels of �-lactamase specific activity under basal andcefoxitin-induced conditions

StrainAvg �-lactamase sp acta SD

Basal Inducedb

PAO1 2.8 0.4 230 20PA�nagZ 3.9 0.8 95 7.8PA�DDh2Dh3 3,792 121 3,935 11PA�DDh2Dh3nagZ 288 32 1,019 64

a Specific activity is in units of nanomoles of nitrocefin hydrolyzed per minuteper milligram of protein.

b Induction was carried out by culturing the strains in the presence of 50 �g/mlcefoxitin for 3 h 37°C.

2278 ASGARALI ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

nal �-lactams ceftazidime and aztreonam. The presence of 0.5mM EtBuPUG in the broth microdilution assays enhanced theefficacies of ceftazidime and aztreonam against PAO1 by two-fold and fourfold, respectively (Table 5). This finding agreeswith the twofold (ceftazidime) and fourfold (aztreonam) in-creases in the susceptibility of PA�nagZ to these antibioticscompared to the susceptibility of PAO1 (Table 3). Thus, theresults indicate that EtBuPUG can enter the PAO1 cytosol andblock a sufficient amount of NagZ activity to suppress AmpCproduction and enhance the antimicrobial efficacies of these�-lactams against PAO1. In contrast, however, we found thatEtBuPUG enhanced the efficacy only of aztreonam (twofoldreduction in MIC) and not that of ceftazidime against thetriple ampD null mutant (PA�DDh2Dh3) (Table 5).

The inactivation of all three ampD homologues is not re-quired for P. aeruginosa to develop clinical resistance to anti-pseudomonal �-lactams. The partial derepression of ampC vialoss-of-function mutations in ampD alone appears to be suffi-cient to provide clinical resistance and maintain the fitness anvirulence necessary to survive in the environment of the lungsof patients with CF (31). To determine if EtBuPUG couldenhance the antimicrobial efficacy of ceftazidime or aztreonamagainst P. aeruginosa mutants with partially derepressed ampCphenotypes, we tested the activity of the inhibitor againststrains with all combinations of ampD, ampDh2, and ampDh3inactivation. As shown previously (21), the inactivation ofampDh2 (PA�Dh2) or ampDh3 (PA�Dh3) alone or in com-bination (PA�Dh2Dh3) did not significantly increase the re-sistance of P. aeruginosa to ceftazidime or aztreonam, while the

inactivation of ampD (PA�D) increased the MICs of ceftazi-dime and aztreonam eight- and sixfold, respectively. Interest-ingly, a combination of 0.5 mM EtBuPUG with either ceftazi-dime or aztreonam resulted in a twofold reduction in the MICsfor both PA�D and PA�Dh3 and a fourfold reduction in theMICs for PA�Dh2. Thus, whereas EtBuPUG did not suppressthe resistance phenotype of the triple ampD null mutantPA�DDh2Dh3, it did enhance the efficacies of these antibioticsagainst the clinically relevant ampD null mutant PA�D andagainst PA�Dh2 and PA�Dh3. Although loss-of-function mu-tations in ampD alone, as opposed to its homologues, appearsto be the most common resistance-conferring mutation that isselected for clinically (20, 22, 25, 40), a clinical isolate of P.aeruginosa was recently reported to contain loss-of-functionmutations in both ampD and ampDh3 (37). This mutant withdouble mutations (PA�DDh3) has been shown to generate ahighly resistant phenotype with a level of resistance that iscomparable to that of triple ampD null mutant PA�DDh2Dh3.Interestingly, while 0.5 mM EtBuPUG could not suppress theresistance of PA�DDh3 to ceftazidime, it did cause a twofoldsuppression of resistance of this double mutant to aztreonam.Thus, EtBuPUG enhanced the efficacies of antispseudomonal�-lactams against two clinically relevant mutants of P. aerugi-nosa, PA�D and PA�DDh3.

DISCUSSION

Due to the constant and rapid evolution of bacterial antibi-otic resistance mechanisms and the limited efficacies of clini-cally available �-lactamase inhibitors against AmpC (27, 44),alternative approaches to surmount AmpC-mediated antibi-otic resistance are needed. Given that NagZ is highly con-served in gram-negative bacteria (3, 47) and is responsible forcatalyzing the formation of the ampC inducer molecule 1,6-anhydro-MurNAc tripeptide (or pentapeptide) (3), the block-age of NagZ activity may provide a novel strategy to enhancethe efficacies of �-lactams against bacteria encoding inducibleampC. The consequence of its inhibition would be the suppres-sion of intrinsic ampC induction and the hyperinduction thatoccurs from the selection of ampD null mutants. We now showthat blockage of the function of NagZ in P. aeruginosa via

FIG. 3. Structure of the NagZ selective inhibitor EtBuPUG. De-signed to resemble the putative oxocarbenium ion-like transition stateused by NagZ, EtBuPUG is a potent inhibitor of P. aeruginosa NagZ(Ki 3.5 �M) and is highly selective for this enzyme and other CAZyfamily 3 �-glucosaminidases (42).

TABLE 5. Susceptibilities of PAO1 and ampD null mutants to ceftazidime and aztreonam in the presence or absence of EtBuPUGa

Strain

MICb (mg ml�1) Antibiotic clearing radius (mm)c

Ceftazidime Aztreonam Ceftazidime Aztreonam

�I �I �I �I �I �I �I �I

PAO1 1 0.5 1 0.25 11.4 13.1 12.5 15.1PA�D 8 4 6 3PA�Dh2 0.75 0.19 1 0.25 10.1 12.3 11.8 14.0PA�Dh3 1 0.5 1.5 0.75PA�DDh2 12 6 16 8PA�DDh3 48 48 16 8PA�Dh2Dh3 0.75 0.75 0.5 0.25PA�DDh2Dh3 48 48 24 12 9.2 9.5 10.7 11.9

a The bacterial strains were treated with the NagZ selective inhibitor EtBuPUG (�I) or were not treated with EtBuPUG (�I).b The MIC was determined by the broth microdilution method. Measurements were performed in triplicate.c Sensitivity was determined by an agar diffusion assay. Filter discs (diameter, 6 mm) loaded with 30 �g of ceftazidime or aztreonam with or without the inhibitor

EtBuPUG were placed onto an agar plate inoculated with the indicated strain. After incubation overnight, the radius (from the center of the disc) of the zone ofclearance was measured.

VOL. 53, 2009 ATTENUATION OF P. AERUGINOSA �-LACTAM RESISTANCE 2279

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

genetic inactivation or by the use of a selective small-moleculeinhibitor can attenuate �-lactam resistance in a clinically sig-nificant pathogen that encodes an endogenous chromosomalampC-ampR operon. The two- to fourfold increase in suscep-tibility of PA�nagZ to �-lactam antibiotics is consistent withthe fourfold increase in susceptibility to �-lactams found whennagZ was deleted from E. coli harboring a plasmid-borneampC-ampR operon (50) and is also consistent with the reduc-tion in the level of AmpC production in this model system thatwas achieved by using the NagZ inhibitor EtBuPUG (42).Notably, the attenuation of �-lactam resistance was particu-larly profound (up to 16-fold) when nagZ was genetically in-activated in PA�DDh2Dh3, a strain that otherwise exhibitsextremely high levels of resistance to antipseudomonal �-lac-tams due to the inactivation of all three ampD homologues thatare required to coordinately repress ampC expression. Thisobservation highlights the requirement of NagZ activity for theinduction of AmpC production in P. aeruginosa and under-scores that the loss of NagZ activity can effectively reverse theextremely high antipseudomonal �-lactam resistance pheno-type of a mutant that is completely deficient in AmpD amidaseactivity.

Although loss-of-function mutations in ampD alone are aleading cause of antipseudomonal �-lactam resistance in P.aeruginosa (1, 20), it has recently been shown that additionalloss-of-function mutations can be selected for in ampDh3 (37)to yield a resistance phenotype very similar to that of strainPA�DDh2Dh3. Thus, it is encouraging to find that even in thePA�DDh2Dh3 background, the inactivation of nagZ could at-tenuate �-lactam resistance sufficiently to bring the MICs forall antipseudomonal �-lactams assayed to well below theirrespective CLSI resistance breakpoints. This profound effectarising from the inactivation of nagZ provides good support forthe targeting of NagZ with inhibitors as a method of reducingantibiotic resistance in antipseudomonal agent-resistant P.aeruginosa strains.

Despite our finding that the inactivation of nagZ inPA�DDh2Dh3 could significantly attenuate the resistanceof this strain to antipseudomonal �-lactams, the resultingMICs were not reduced to the values observed for PAO1(Table 3). This residual resistance in the absence of NagZactivity cannot be attributed to the presence of an additionalnagZ homologue, since we found that both PA�nagZ andPA�DDh2Dh3nagZ were devoid of N-acetyl-�-glucosamini-dase activity (Fig. 2). A possible reason for the residual �-lac-tam resistance observed in PA�DDh2Dh3nagZ may be ex-plained by an observation of Jacobs et al., who found that invitro, the apo form of AmpR constitutively activates ampCexpression and becomes a repressor of ampC transcriptiononly after the addition of UDP-MurNAc pentapeptide (17).The disruption of PG recycling by the removal of AmpD andNagZ activity may render the mutant reliant on the de novosynthesis of UDP-MurNAc pentapeptide. The consequence ofthis may be that although the production of the AmpR-acti-vating molecule 1,6-anhydromuropeptide has been blocked,the disruption of PG recycling may not allow the mutant tosustain sufficient cytoplasmic concentrations of UDP-MurNAcpentapeptide to fully repress AmpR. Consistent with this view,the suppression of inducible �-lactamase resistance has beenobserved in cell division mutants that accumulate cytosolic

UDP-MurNAc pentapeptide, presumably because increasedamounts of the molecule outcompete the incoming anhydro-muropeptide inducer and ensure the continued repression ofAmpR (45). Regardless, further studies will be required toclarify the precise molecular roles of these inducer and repres-sor molecules.

The genetic inactivation of nagZ in PAO1 and PA�DDh2Dh3 provides a useful benchmark against which the ability ofsmall-molecule inhibitors of NagZ to attenuate AmpC-medi-ated resistance in P. aeruginosa may be measured. We havepreviously shown that this resistance mechanism can be atten-uated in E. coli isolates harboring the ampC-ampR operon byblocking the formation of 1,6-anhydromuropeptide using po-tent and selective small-molecule inhibitors of NagZ derivedfrom O-(2-acetamido-2-deoxy-D-glucopyranosylidene)amino-N-phenylcarbamate (PUGNAc) (42). PUGNAc is a nonselectiveN-acetyl-�-hexosaminidase inhibitor that competitively inhib-its both NagZ and functionally related human enzymes belong-ing to glycoside hydrolase families GH20, GH84, and GH89(42) (8). However, the use of a three-dimensional crystal struc-ture of PUGNAc in complex with NagZ from Vibrio choleraefacilitated our development of 2-N-acyl derivatives of PUGNActhat were specific for NagZ over the functionally related hu-man enzymes from glycoside hydrolase families GH20 andGH84 (42). The recently determined crystal structure of an�-N-acetylglucosaminidase from GH89 reveals that, unlikeNagZ, GH89 glycosidases have a restrictive active-site pocket(8) that also precludes the binding of these PUGNAc deriva-tives. EtBuPUG was the derivative selected for use in thisstudy since it retains good potency and displays optimal selec-tivity for P. aeruginosa NagZ.

The use of EtBuPUG in combination with ceftazidime oraztreonam attenuated the resistance to these antibiotics (Table5) to levels comparable to the level of resistance observed forPA�nagZ (Table 3), and we hasten to add that EtBuPUG alsoenhanced the efficacies of these �-lactams against the clinicallyrelevant ampD deletion mutant PA�D (Table 5). AlthoughEtBuPUG was found to enhance the efficacy of aztreonamagainst PA�DDh3, it did not enhance the efficacy of either�-lactam against PA�DDh2Dh3 (Table 5). Comparison of thisresult to that achieved by our genetic inactivation of nagZ inPA�DDh2Dh3 (Table 3) suggests that EtBuPUG may not beable to inhibit a sufficient amount of endogenous NagZ, pos-sibly due to the limited entry of the inhibitor into the cytosol.Interestingly, however, the complete derepression of ampCexpression through loss-of-function mutations in all threeampD homologues has yet to be identified clinically, probablybecause the complete loss of AmpD appears to reduce theviability of P. aeruginosa in vivo (31), and so this may not be asignificant limitation to the strategy of inhibiting NagZ.

Our results demonstrate that the development of small-mol-ecule inhibitors to block NagZ activity shows promise as astrategy for suppressing the antipseudomonal �-lactam resis-tance that arises from the selection of loss-of-function muta-tions in ampD and its homologues. Possible complications thatmight hinder such a strategy are the selection of nagZ muta-tions that reduce the binding affinity of the enzyme to sugar-based inhibitors. Such mutations, however, would likelycompromise the catalytic efficiency of the enzyme and thusself-limit the formation of the inducer molecule that is re-

2280 ASGARALI ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

quired for the induction of ampC expression. Antipseudomo-nal �-lactam resistance-conferring mutations independent ofampD null mutations have also been identified in clinical iso-lates, and these may circumvent a strategy targeting NagZ.Such mutations, including those occurring in ampR, are com-paratively rare, however, perhaps because they are associatedwith the constitutive hyperproduction of AmpC, a conditionthat has been linked to reduced fitness (31). Finally, it is note-worthy that in addition to regulating ampC expression, AmpRalso modulates the expression of extracellular proteases andother virulence factors in P. aeruginosa (24). Thus, modulationof the activity of AmpR by inhibiting NagZ may have a wideeffect on the transcriptional regulation of the P. aeruginosagenome and disrupt multiple virulence pathways, in addition tosuppressing the induction of AmpC �-lactamase production, atopic that we are actively exploring.

ACKNOWLEDGMENTS

This work was supported by the Natural Sciences and EngineeringResearch Council of Canada.

We thank Teresa de Kievit for her technical advice and productivecomments on the manuscript.

REFERENCES

1. Bagge, N., O. Ciofu, M. Hentzer, J. I. Campbell, M. Givskov, and N. Hoiby.2002. Constitutive high expression of chromosomal beta-lactamase inPseudomonas aeruginosa caused by a new insertion sequence (IS1669) lo-cated in ampD. Antimicrob. Agents Chemother. 46:3406–3411.

2. Bartowsky, E., and S. Normark. 1991. Purification and mutant analysis ofCitrobacter freundii AmpR, the regulator for chromosomal AmpC beta-lactamase. Mol. Microbiol. 5:1715–1725.

3. Cheng, Q., H. Li, K. Merdek, and J. T. Park. 2000. Molecular characteriza-tion of the beta-N-acetylglucosaminidase of Escherichia coli and its role incell wall recycling. J. Bacteriol. 182:4836–4840.

4. Cheng, Q., and J. T. Park. 2002. Substrate specificity of the AmpG permeaserequired for recycling of cell wall anhydro-muropeptides. J. Bacteriol. 184:6434–6436.

5. Clinical and Laboratory Standards Institute. 2003. Methods for dilutionantimicrobial susceptibility tests for bacteria that grow aerobically; approvedstandard, sixth edition (M7-A6). Clinical and Laboratory Standards Institute,Wayne, PA.

6. Dietz, H., D. Pfeifle, and B. Wiedemann. 1996. Location of N-acetylmuramyl-L-alanyl-D-glutamylmesodiaminopimelic acid, presumed signal molecule forbeta-lactamase induction, in the bacterial cell. Antimicrob. Agents Che-mother. 40:2173–2177.

7. Dietz, H., D. Pfeifle, and B. Wiedemann. 1997. The signal molecule forbeta-lactamase induction in Enterobacter cloacae is the anhydromuramyl-pentapeptide. Antimicrob. Agents Chemother. 41:2113–2120.

8. Ficko-Blean, E., K. A. Stubbs, O. Nemirovsky, D. J. Vocadlo, and A. B.Boraston. 2008. Structural and mechanistic insight into the basis of muco-polysaccharidosis IIIB. Proc. Natl. Acad. Sci. USA 105:6560–6565.

9. FitzSimmons, S. C. 1993. The changing epidemiology of cystic fibrosis. J. Pe-diatr. 122:1–9.

10. Giamarellou, H. 2000. Therapeutic guidelines for Pseudomonas aeruginosainfections. Int. J. Antimicrob. Agents 16:103–106.

11. Giwercman, B., P. A. Lambert, V. T. Rosdahl, G. H. Shand, and N. Hoiby.1990. Rapid emergence of resistance in Pseudomonas aeruginosa in cysticfibrosis patients due to in-vivo selection of stable partially derepressed beta-lactamase producing strains. J. Antimicrob. Chemother. 26:247–259.

12. Hancock, R. E., and D. P. Speert. 2000. Antibiotic resistance in Pseudomo-nas aeruginosa: mechanisms and impact on treatment. Drug Resist. Updat.3:247–255.

13. Hansen, C. R., T. Pressler, and N. Hoiby. 2008. Early aggressive eradicationtherapy for intermittent Pseudomonas aeruginosa airway colonization incystic fibrosis patients: 15 years experience. J. Cyst Fibros. 7:523–530.

14. Henrissat, B., and A. Bairoch. 1996. Updating the sequence-based classifi-cation of glycosyl hydrolases. Biochem. J. 316:695–696.

15. Hoang, T. T., R. R. Karkhoff-Schweizer, A. J. Kutchma, and H. P. Schweizer.1998. A broad-host-range Flp-FRT recombination system for site-specificexcision of chromosomally-located DNA sequences: application for isolationof unmarked Pseudomonas aeruginosa mutants. Gene 212:77–86.

16. Holtje, J. V., U. Kopp, A. Ursinus, and B. Wiedemann. 1994. The negativeregulator of beta-lactamase induction AmpD is a N-acetyl-anhydromuramyl-L-alanine amidase. FEMS Microbiol. Lett. 122:159–164.

17. Jacobs, C., J. M. Frere, and S. Normark. 1997. Cytosolic intermediates forcell wall biosynthesis and degradation control inducible beta-lactam resis-tance in gram-negative bacteria. Cell 88:823–832.

18. Jacobs, C., L. J. Huang, E. Bartowsky, S. Normark, and J. T. Park. 1994.Bacterial cell wall recycling provides cytosolic muropeptides as effectors forbeta-lactamase induction. EMBO J. 13:4684–4694.

19. Jacoby, G. A., and L. S. Munoz-Price. 2005. The new beta-lactamases.N. Engl. J. Med. 352:380–391.

20. Juan, C., M. D. Macia, O. Gutierrez, C. Vidal, J. L. Perez, and A. Oliver.2005. Molecular mechanisms of beta-lactam resistance mediated by AmpChyperproduction in Pseudomonas aeruginosa clinical strains. Antimicrob.Agents Chemother. 49:4733–4738.

21. Juan, C., B. Moya, J. L. Perez, and A. Oliver. 2006. Stepwise upregulation ofthe Pseudomonas aeruginosa chromosomal cephalosporinase conferringhigh-level beta-lactam resistance involves three AmpD homologues. Anti-microb. Agents Chemother. 50:1780–1787.

22. Kaneko, K., R. Okamoto, R. Nakano, S. Kawakami, and M. Inoue. 2005.Gene mutations responsible for overexpression of AmpC beta-lactamase insome clinical isolates of Enterobacter cloacae. J. Clin. Microbiol. 43:2955–2958.

23. Koch, C. 2002. Early infection and progression of cystic fibrosis lung disease.Pediatr. Pulmonol. 34:232–236.

24. Kong, K. F., S. R. Jayawardena, S. D. Indulkar, A. Del Puerto, C. L. Koh, N.Hoiby, and K. Mathee. 2005. Pseudomonas aeruginosa AmpR is a globaltranscriptional factor that regulates expression of AmpC and PoxB beta-lactamases, proteases, quorum sensing, and other virulence factors. Antimi-crob. Agents Chemother. 49:4567–4575.

25. Lindberg, F., S. Lindquist, and S. Normark. 1987. Inactivation of the ampDgene causes semiconstitutive overproduction of the inducible Citrobacterfreundii beta-lactamase. J. Bacteriol. 169:1923–1928.

26. Lindquist, S., F. Lindberg, and S. Normark. 1989. Binding of the Citrobacterfreundii AmpR regulator to a single DNA site provides both autoregulationand activation of the inducible ampC beta-lactamase gene. J. Bacteriol.171:3746–3753.

27. Livermore, D. M. 1995. �-Lactamases in laboratory and clinical resistance.Clin. Microbiol. Rev. 8:557–584.

28. Livermore, D. M. 2002. Multiple mechanisms of antimicrobial resistance inPseudomonas aeruginosa: our worst nightmare? Clin. Infect. Dis. 34:634–640.

29. Lodge, J., S. Busby, and L. Piddock. 1993. Investigation of the Pseudomonasaeruginosa ampR gene and its role at the chromosomal ampC beta-lactamasepromoter. FEMS Microbiol. Lett. 111:315–320.

30. Morosini, M. I., J. A. Ayala, F. Baquero, J. L. Martinez, and J. Blazquez.2000. Biological cost of AmpC production for Salmonella enterica serotypeTyphimurium. Antimicrob. Agents Chemother. 44:3137–3143.

31. Moya, B., C. Juan, S. Alberti, J. L. Perez, and A. Oliver. 2008. Benefit ofhaving multiple ampD genes for acquiring �-lactam resistance without losingfitness and virulence of Pseudomonas aeruginosa. Antimicrob. Agents Che-mother. 52:3694–3700.

32. Normark, S. 1995. �-Lactamase induction in gram-negative bacteria is inti-mately linked to peptidoglycan recycling. Microb. Drug Resist. 1:111–114.

33. Park, J. T., and T. Uehara. 2008. How bacteria consume their own exoskel-etons (turnover and recycling of cell wall peptidoglycan). Microbiol. Mol.Biol. Rev. 72:211–227.

34. Pfeifle, D., E. Janas, and B. Wiedemann. 2000. Role of penicillin-bindingproteins in the initiation of the AmpC beta-lactamase expression in Entero-bacter cloacae. Antimicrob. Agents Chemother. 44:169–172.

35. Romling, U., J. Wingender, H. Muller, and B. Tummler. 1994. A majorPseudomonas aeruginosa clone common to patients and aquatic habitats.Appl. Environ. Microbiol. 60:1734–1738.

36. Rossolini, G. M., and E. Mantengoli. 2005. Treatment and control of severeinfections caused by multiresistant Pseudomonas aeruginosa. Clin. Micro-biol. Infect. 11(Suppl. 4):17–32.

37. Schmidtke, A. J., and N. D. Hanson. 2008. Role of ampD homologs inoverproduction of AmpC in clinical isolates of Pseudomonas aeruginosa.Antimicrob. Agents Chemother. 52:3922–3927.

38. Schweizer, H. D. 1993. Small broad-host-range gentamycin resistance genecassettes for site-specific insertion and deletion mutagenesis. BioTechniques15:831–834.

39. Simon, R., U. Priefer, and A. Puhler. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in gramnegative bacteria. Bio/Technology 1:784–791.

40. Smith, E. E., D. G. Buckley, Z. Wu, C. Saenphimmachak, L. R. Hoffman,D. A. D’Argenio, S. I. Miller, B. W. Ramsey, D. P. Speert, S. M. Moskowitz,J. L. Burns, R. Kaul, and M. V. Olson. 2006. Genetic adaptation by Pseudo-monas aeruginosa to the airways of cystic fibrosis patients. Proc. Natl. Acad.Sci. USA 103:8487–8492.

41. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J.Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L.Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L. Brody,S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D. Spencer,G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E. Hancock, S. Lory,

VOL. 53, 2009 ATTENUATION OF P. AERUGINOSA �-LACTAM RESISTANCE 2281

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from

and M. V. Olson. 2000. Complete genome sequence of Pseudomonas aerugi-nosa PAO1, an opportunistic pathogen. Nature 406:959–964.

42. Stubbs, K. A., M. Balcewich, B. L. Mark, and D. J. Vocadlo. 2007. Smallmolecule inhibitors of a glycoside hydrolase attenuate inducible AmpC-mediated beta-lactam resistance. J. Biol. Chem. 282:21382–21391.

43. Stubbs, K. A., A. Scaffidi, A. W. Debowski, B. L. Mark, R. V. Stick, and D. J.Vocadlo. 2008. Synthesis and use of mechanism-based protein-profilingprobes for retaining beta-D-glucosaminidases facilitate identification ofPseudomonas aeruginosa NagZ. J. Am. Chem. Soc. 130:327–335.

44. Tondi, D., F. Morandi, R. Bonnet, M. P. Costi, and B. K. Shoichet. 2005.Structure-based optimization of a non-beta-lactam lead results in inhibitorsthat do not up-regulate beta-lactamase expression in cell culture. J. Am.Chem. Soc. 127:4632–4639.

45. Uehara, T., and J. T. Park. 2002. Role of the murein precursor UDP-N-acetylmuramyl-L-Ala-gamma-D-Glu-meso-diaminopimelic acid-D-Ala-D-Alain repression of beta-lactamase induction in cell division mutants. J. Bacte-riol. 184:4233–4239.

46. Vincent, J. L. 2003. Nosocomial infections in adult intensive-care units.Lancet 361:2068–2077.

47. Vocadlo, D. J., C. Mayer, S. He, and S. G. Withers. 2000. Mechanism ofaction and identification of Asp242 as the catalytic nucleophile of Vibriofurnisii N-acetyl-beta-D-glucosaminidase using 2-acetamido-2-deoxy-5-fluoro-alpha-L-idopyranosyl fluoride. Biochemistry 39:117–126.

48. Vollmer, W., and J. V. Holtje. 2001. Morphogenesis of Escherichia coli. Curr.Opin. Microbiol. 4:625–633.

49. Vollmer, W., B. Joris, P. Charlier, and S. Foster. 2008. Bacterial peptidoglycan(murein) hydrolases. FEMS Microbiol. Rev. 32:259–286.

50. Votsch, W., and M. F. Templin. 2000. Characterization of a beta-N-acetyl-glucosaminidase of Escherichia coli and elucidation of its role in muropep-tide recycling and beta -lactamase induction. J. Biol. Chem. 275:39032–39038.

51. West, S. E., H. P. Schweizer, C. Dall, A. K. Sample, and L. J. Runyen-Janecky. 1994. Construction of improved Escherichia-Pseudomonas shuttlevectors derived from pUC18/19 and sequence of the region required for theirreplication in Pseudomonas aeruginosa. Gene 148:81–86.

2282 ASGARALI ET AL. ANTIMICROB. AGENTS CHEMOTHER.

on July 13, 2014 by SU

ZA

NN

E R

ICH

AR

Dhttp://aac.asm

.org/D

ownloaded from