Accepted Manuscript

Effect of dietary β-glucan on growth, survival and regulation of immune processes inrainbow trout (Oncorhynchus mykiss) infected by Aeromonas salmonicida

Liqin Ji, Guoxiang Sun, Jun Li, Yi Wang, Yishuai Du, Xian Li, Ying Liu

PII: S1050-4648(17)30134-1

DOI: 10.1016/j.fsi.2017.03.015

Reference: YFSIM 4484

To appear in: Fish and Shellfish Immunology

Received Date: 17 December 2016

Revised Date: 3 March 2017

Accepted Date: 4 March 2017

Please cite this article as: Ji L, Sun G, Li J, Wang Y, Du Y, Li X, Liu Y, Effect of dietary β-glucan ongrowth, survival and regulation of immune processes in rainbow trout (Oncorhynchus mykiss) infectedby Aeromonas salmonicida, Fish and Shellfish Immunology (2017), doi: 10.1016/j.fsi.2017.03.015.

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service toour customers we are providing this early version of the manuscript. The manuscript will undergocopyediting, typesetting, and review of the resulting proof before it is published in its final form. Pleasenote that during the production process errors may be discovered which could affect the content, and alllegal disclaimers that apply to the journal pertain.

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Effect of dietary β-glucan on growth, survival and regulation of 1

immune processes in rainbow trout (Oncorhynchus mykiss) infected 2

by Aeromonas salmonicida 3

Liqin Jia, b, Guoxiang Suna, Jun Lic, Yi Wangd, Yishuai Dua, Xian Lia, Ying Liud, * 4

a Institute of Oceanology, Chinese Academy of Sciences, Qingdao, 266071, China 5

b University of Chinese Academy of Sciences, Beijing, 100039, China 6

c School of Biological Sciences, Lake Superior State University, Sault Ste. Marie, MI, 49783 7

d School of Marine Science and Environment Engineering, Dalian Ocean University, Dalian, 116023, China 8

ABSTRACT 9

The present study evaluated the effects of dietary β-glucan (0, 0.05%, 0.1%, and 0.2%) on 10

growth performance after 42 days of feeding. Thereafter, rainbow trout (Oncorhynchus 11

mykiss) were infected with Aeromonas salmonicida, and survival rates as well as the 12

regulating processes of stress- and immune-related factors were analyzed. In general, 13

higher dietary β-glucan levels obviously improved specific growth rate (SGR), weight gain 14

(WG) and feed efficiency (FE) (P ≤ 0.05). Survival rates in β-glucan groups increased 15

significantly compared with the control group after A. salmonicida infection (P ≤ 0.05). 16

Serum total superoxide dimutase (T-SOD), peroxidase (POD) as well as catalase (CAT) 17

activities, and their mRNA expressions in the head kidney of fish in the β-glucan groups 18

generally increased to higher levels after infection, and more quickly, compared with in the 19

control group. Serum lysozyme (LSZ) and its expression in the head kidney in β-glucan 20

groups reached a higher peak earlier than in the control group. 21

22

*Corresponding author. Tel.: +86-411-84762010; Fax. : +86-411-84763520 23

E-mail address: yingliu@dlou.edu.cn (Y. Liu) 24

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Serum glutamic oxalacetic transaminase (GOT) and glutamic pyruvic transaminase (GPT) 25

levels in the β-glucan groups were significantly lower than in the control group (P ≤ 0.05). 26

The peak of heat shock protein 70 (HSP70) expression in the 0.2% β-glucan group was 27

higher and occurred earlier than in other groups (P ≤ 0.05). These results confirm that 0.1% 28

and 0.2% dietary β-glucan are beneficial for promoting growth in rainbow trout and 29

enhancing resistance against A. salmonicida. Furthermore, β-glucan could play an 30

important role in regulating stress- and immune-related factors in rainbow trout to more 31

quickly fight against bacterial infection. 32

Keywords: β-glucan; Oncorhynchus mykiss; growth; survival; immune-related factors; 33

Aeromonas salmonicida 34

1. Introduction 35

Rainbow trout (Oncorhynchus mykiss) is one of the most widely cultured fish 36

species worldwide for its fast growth and adaptation to low temperature [1]. Despite 37

the large market demand, natural resources are limited. These factors have led to the 38

intensification of aquaculture production systems. Intensive farming, along with 39

overcrowding and poor water quality, is likely to alter fish physiological status and 40

therefore increase the susceptibility of pathogen infection [2]. In the last few years, 41

abuse of antibiotics to prevent the uncontrolled spread of pathogens has resulted in 42

the emergence of several resistant pathogens in aquaculture. Therefore, it is urgent 43

to find suitable ways to control disease outbreaks [3]. Immunostimulants are the 44

current primary approach for enhancing resistance against pathogens in aquaculture. 45

Although numerous substances have been investigated as immunostimulants, only a 46

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

few of these are appropriate for use in aquaculture [4, 5]. 47

In recent years, the effective immunomodulatory properties of β-1,3/1,6-glucan 48

derived from yeast have been extensively proved, not only in mammals but also in 49

fish [6, 7]. β-glucan naturally form polysaccharides with glucose linked by 50

β-glycosidic bonds [8] and can stimulate macrophages to actively fight against fish 51

pathogens [9]. They can also enhance the activity of non-specific immune factors 52

such as lysozyme and the complement system [10, 11]. Altering immune 53

cytokine-like gene expression, such as tumor necrosis factor-ɑ (TNF-ɑ) and 54

interleukin-1β (IL-1β), is a primary channel through which β-glucan improves 55

innate immunity in various fish [12-14]. 56

Immune efficacy can vary according to several factors such as the dietary dose of 57

glucan, feeding regime, and glucan type [15]. Although the immunostimulatory 58

effects of various derivations of β-glucan have been studied against a diverse range 59

of pathogens, such as Yersinia ruckeri [16], A. hydrophila [17], and bacterial 60

lipopolysaccharides [18], few studies have investigated its disease resistance against 61

A. salmonicida. 62

Therefore, the aim of the present study was to evaluate the effects of dietary 63

β-glucan derived from yeast cells on growth promotion, disease resistance and 64

immune response to A. salmonicida in rainbow trout. Furthermore, the manner in 65

which β-glucan regulates the continuous process of immunity after A. salmonicida 66

infection was investigated. 67

2. Materials and Methods 68

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2.1. Fish husbandry and experimental facilities 69

This trial was conducted at Shandong Oriental Ocean Sci-Tech Co., Ltd 70

(Shandong, China). The average initial body weight of rainbow trout was 293.0 ± 71

18.3 g. At the farming trial, 1200 farmed individuals were randomly placed into a 72

100-m3 tank containing 80-m3 seawater (average parameters: water flow 7 L/min, 73

water temperature 12 ℃, oxygen saturation 7.2 mg/L, pH 7.8, and salinity 30‰). 74

Fish were fed with commercial dry pellets without β-glucan inclusion (Beijing 75

HanYe Science & Technology Co., Ltd., Beijing, China) prior to the start of the trial. 76

They were fed 2% of their body weight every day. The feed was divided into five 77

portions and distributed automatically per day using automatic feeders 78

(Hangzhou Ecological Environmental Engineering Co., Ltd). 79

2.2. Experimental diets 80

β-1, 3-glucan produced by Saccharomyces cerevisiae was purchased from 81

Angel Yeast Co., Ltd (Hubei, China). The basal diet (commercial diet) was used as 82

the control diet. For the experimental diets, the basal diet was supplemented with 83

different levels of β-1, 3-glucan (0.05%, 0.1% and 0.2%). The formulation of the 84

basal diet is listed in Table 1. 85

Table 1 86

Composition of the experimental basal diet. 87

Ingredients Percentage (%)

Fish meala 42.8

Soybean meala 21.2

DL-methionineb 2.65

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

Fish oilc 15.7

Wheat flourd 10.8

Wheat starchd 2.5

ɑ-Cellulosee 3.5

Vitamin and mineralf

0.85

Proximate composition

Crude protein 42.18

Crude lipid

Ash

11.23

11.51

a Fish meal: crude protein 75.3% dry matter, crude lipid 2.5% dry matter; soybean meal: 51.7% crude 88

protein dry matter, 2.0% crude lipid of dry matter. Both meals were from Qingdao Fusen Co., Ltd., 89

Qingdao, China. 90

b DL-methionine: Guangzhou Shuomu biological technology Co., Ltd., Guangzhou, China. 91

c Fish oil: Qingdao Fusen Co., Ltd., Qingdao, China. 92

d Wheat flour and wheat starch: Haixing Huicheng feed marketing Co., Ltd., Cangzhou, China.

93

e ɑ-Cellulose: Sahn chemical technology Co., Ltd., Shanghai, China.f Vitamin (mg or g/kg diet): thiamin, 94

25 mg; riboflavin, 45 mg; pyridoxine-HCl, 20 mg; vitamin B12, 0.1mg; vitamin K3, 10 mg; inositol, 800 95

mg; pantothenic acid, 60 mg; niacin acid, 200 mg; folic acid, 20 mg; biotin, 1.20 mg; retinol acetate, 32 96

mg; cholecalciferol, 5 mg; alpha-tocopherol, 120 mg; ascorbic acid, 2000 mg; choline chloride, 2000 mg; 97

ethoxyquin, 150 mg; microcrystalline cellulose, 14.52 g. 98

Mineral (mg or g/kg diet): NaF, 2 mg; KI, 0.8 mg; CoCl2·6H2O(1%), 50 mg; CuSO4·5H2O, 10 mg; 99

FeSO4·H2O, 80 mg; ZnSO4·H2O, 50 mg; MnSO4·H2O, 60 mg; MgSO4·7H2O, 1200 mg; Ca 100

(H2PO4)2·H2O, 3000 mg; NaCl, 100 mg; Zoelite, 15.448 g. 101

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

2.3. Trial design 102

The trial consisted of two stages: the first stage comprised fish culturing, which 103

was performed in 12 100-m3 concrete tanks of a commercial land-based 104

recirculating aquaculture system. The 12 tanks were randomly divided into four 105

groups with triplicate tanks. The four groups consisted of a control group and three 106

experimental groups corresponding to the three levels of β-glucan (0.05%, 0.1%, 107

and 0.2%). Fish were fed with the corresponding pellets at a feeding rate of 2% body 108

weight with a feeding frequency of five times daily for 42 days. A total of 400 109

healthy individuals were randomly selected in each tank, and weighed at the 110

beginning and the end of the first stage. 111

The second trial stage was performed to study the role of β-glucan in regulating 112

immune-related functions in individuals infected with A. salmonicida. When the 113

first stage was completed, 100 individuals from each 100-m3 tank were injected with 114

A. salmonicida, and then transferred to each corresponding small tank. One hundred 115

individuals injected with 100 µl 0.9% NaCl from each control tank were transferred 116

to each of three small tanks as the non-infection control. The number of fish dying 117

from A. salmonicida was recorded daily. Every other day post infection (dpi) at 2, 4, 118

and 6 dpi, five live individuals were sampled from each tank to study the process of 119

metabolic change after infection. At 7 dpi, the survival rate was analyzed and the 120

results were used as an indication of the ability of rainbow trout fed with different 121

dosage β-glucan diets to resist bacterial challenge. 122

2.4. Challenge test and survival rate 123

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

The second trial stage was carried out in 15 small round tanks (radius 1.2 m, 124

height 1.8 m, and volume 8.14 m3) of a commercial land-based recirculating 125

aquaculture system containing 7-m3 seawater (average parameters: water flow 3 126

L/min, water temperature 12 ℃, oxygen saturation 72%, pH 7.8, and salinity 127

30‰). The 15 round tanks included five groups with triplicate tanks: non-infected 128

control group (NCG), infected control group (ICG), and three infected experiment 129

groups (0.05%, 0.1% and 0.2% β-glucan). According to the preliminary 130

experiment, 100 µl 3×105 A. salmonicida resulted in fish mortality in 7 days. 131

Before transferring to small tanks, with the exception of the non-infected control, 132

fish were injected with 100 µl 3×105 A. salmonicida. In this experiment, 100 133

individuals from the previous experiment were initially added to each small tank. 134

The survival rate of fish in each group was calculated at 7 dpi as follows: 135

Survival rate = the number of live fish total fish-sampled fish ×100 136

2.5. Sampling 137

Sampling (n=5) occurred at the beginning and the end of the first experiment. For 138

the second experiment, sampling (n=5) took place at every other day after infection 139

(day 2, 4, and 6 dpi). Fish for dissection were anesthetized with tricaine 140

methanesulfonate before sampling. Blood samples for subsequent biochemical 141

analysis were drawn using non-heparinized 5 ml syringes through the caudal vein 142

and kept at 4 °C for 5 h. After that, the blood samples were centrifuged at 4000 g for 143

20 min to obtain serum, which was stored at -80 °C until use. Furthermore, head 144

kidney tissue was also sampled, frozen quickly in liquid nitrogen and stored at 145

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

-80 °C for subsequent gene expression tests. 146

2.6. Growth measurements 147

Four hundred individuals randomly selected from each tank were weighed 148

individually at the beginning and the end of the feeding trial. After the first stage, 149

the specific growth rate (SGR), weight gain (WG), feed efficiency (FE) in all groups 150

were calculated according to previously published methods [19] as follows: 151

SGR= ln final weight-ln initial weigh

Total duration of the experiment ×100 152

WG= final weight- initial weight

initial weight ×100 153

Feed efficiency= final weight-initial weight

feed consumed (g, dry weight) 154

2.7. Analysis of serum enzyme activities 155

The activities of total superoxide dismutase (T-SOD), catalase (CAT), peroxidase 156

(POD), lysozyme (LSZ), glutamate pyruvate transaminase (GPT), glutamic 157

oxalacetic and transaminase (GOT) in serum were detected by reagent kit (NanJing 158

JianCheng Bio Inst, Nanjing, China) and guided by the manufacturer's instruction. 159

2.8. RNA extraction, cDNA synthesis and qRT-PCR analysis 160

Total RNA from head kidney tissue was extracted with RNAfast kit 161

(FASTAGEN, Shanghai, China) following the manufacturer's instruction. A 162

Biodropsis BD-1000 spectrophotometer (OSTD, Beijing Co., Ltd., China) was used 163

to assess the purity of RNA by determining the ratio of the absorbance at 260/280 164

nm and quantify the concentration of RNA. All samples had 260/280 nm ratios 165

between 1.8 and 2.0. Additionally, the integrity of the RNA samples was verified by 166

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1.0% agarose gel electrophoresis. A sample of 1 µg of RNA was used as the 167

template for synthesis of the first strand of cDNA in a final reaction volume of 20 168

µL using the PrimeScript RT Reagent Kit with gDNA Eraser (TaKaRa, Dalian, 169

China). The cDNA was diluted 10-fold for qRT-PCR. 170

2.9. RNA extraction, cDNA synthesis and qRT-PCR analysis 171

The primers designed for β-actin, LSZ, Cu/Zn-SOD, CAT and POD were listed in 172

Table 2. β-actin was chosen as a reference housekeeping gene. Real-time PCR was 173

performed using an ABI 7500 Fast instrument and 7500 software v2.0.1 (Applied 174

Biosystems, USA). The PCR mixture contained 2 µL diluted cDNA, 10 µL 2 × 175

SYBR Green PCR Mix (Takara, Dalian, China), 4 µM of each gene-specific primer, 176

0.4 µL ROX Reference Dye and 6.8 µL distilled water in a final volume of 20 µL. 177

Cycling parameters were: 95 ℃ for 30 s, followed by 40 cycles of 95 ℃ for 5 s and 178

specific annealing temperature for 30 s and then a melt curve stage after the cycling 179

stage. Specificity of qRT-PCR was analyzed by agarose gel and melting curve 180

analysis. The expression levels of target gene were calculated by (target gene/β-actin) 181

using the 2 ( -∆∆Ct ) method [20]. Finally, data were expressed as fold change to 182

control group. 183

Table 2 184

Primers designed in the qRT-PCR 185

Gene name Primer name Accession no. Primer sequence Amplification

β-actin ACTINF1 NM_001124235.1 ATGGGCCAGAAAGACAGCTACGTG 140 bp

β-actin ACTINR1 NM_001124235.1 CTTCTCCATGTCGTCCCAGTTGGT 140 bp

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

LSZ LSZF1 BT073234 GGTTATAGCGGGGTGACTGC 228 bp

LSZ LSZR1 BT073234 TAGCCCAAAGCCTCTTCCAT 228 bp

Cu/Zn-SOD SODF1 NM_001160614 GAGATGGTGCTGAAGGCTGTT 226 bp

Cu/Zn-SOD SODR1 NM_001160614 GTCCTCCGTGGGTCTTGTTG 226 bp

POD PODF2 NM_001165188 GTCCCAAACGTCCAGAAGAG 128 bp

POD PODR2 NM_001165188 GTCAGCGATCCAGCTAACAA 128 bp

HSP70

HSP70

HSP70F2

HSP70R2

AB062281.1

AB062281.1

GACGCTGACAAATACAAAGCT

TGTTCTCCAACCAGGAAATG

190 bp

190 bp

2.10. Statistical analysis 186

The results were analyzed by one-way analysis of variance using SPSS 19.0 187

(SPSS, Chicago, IL, USA). Significant differences were indicated by Duncan's 188

multiple range test. Data were presented as mean ± SD (standard deviation of the 189

mean) and considered to be significantly different at P ≤ 0.05 level. 190

3. Results 191

3.1. Growth performance 192

In general, the SGR, WG and FE were significantly higher (P ≤ 0.05) when the 193

dietary β-glucan level increased. After administration of dietary β-glucan for 42 194

days, the SGR, WG and FE of the 0.1% and 0.2% β-glucan groups were 195

significantly higher than the control group (P ≤ 0.05). These three indicators in the 196

0.05 group have no significant difference with the control group (P > 0.05) (Tab. 3). 197

Table 3 Growth performance indices of rainbow trout fed different dietary β-glucan for 6 198

weeks. 199

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

CG 0.05 0.1 0.2 WG (%)

61.57±1.62a 63.43±1.13a 73.29±1.60b 81.43±3.78c

SGR (%) 1.24±0.03a 1.3±0.02a 1.47±0.03b 1.62±0.05c

FE (%)

0.61±0.02a

0.63±0.01a

0.73±0.02b

0.81±0.04c

Tab. 3. CG denotes control group, 0.05 denotes experiment group fed 0.05% dietary β-glucan, 200

0.10 denotes experiment group fed 0.1% dietary β-glucan and 0.20 denotes experiment group 201

fed 0.2% dietary β-glucan. Data are expressed as mean ± standard deviation. Different 202

superscripts indicate significant (P ≤ 0.05) difference between groups. 203

3.2. Survival rate 204

Overall, the survival rate was significantly affected by different dosages of dietary 205

β-glucan. In the NCG, survival rate was 92%, which was significantly higher (P ≤ 206

0.05) than in the other groups. The ICG had the lowest survival rate (32%) that was 207

significantly lower than other groups (P ≤ 0.05). As shown in Fig. 1, the survival 208

rate was significantly (P ≤ 0.05) improved by increasing the dosage of dietary 209

β-glucan. Among the experimental groups, the survival rate of 0.2% the β-glucan 210

group was significantly higher than the other groups (P ≤ 0.05). However, there was 211

no significant difference between the 0.05% and 0.1% β-glucan groups (P ≤ 0.05) 212

(Fig.1). 213

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

214

Fig. 1. Survival rate (%) of rainbow trout infected by A. salmonicida after feeding for 42 days. 215

NCG denotes control group, ICG denotes infected control group, 0.05 denotes experiment 216

group fed 0.05% dietary β-glucan, 0.10 denotes experiment group fed 0.1% dietary β-glucan 217

and 0.20 denotes experiment group fed 0.2% dietary β-glucan. Data are expressed as mean ± 218

standard deviation. Different superscripts indicate significant (P ≤ 0.05) difference between 219

groups. 220

3.3. Effect of dietary β-glucan in different dosages on stress- and immune-related 221

index of rainbow trout after infection by A. salmonicida 222

3.3.1. Serum T-SOD activity and relative Cu-Zn/SOD mRNA expression in the 223

head kidney 224

After feeding for 42 days, T-SOD activity in all groups decreased significantly 225

compared with day 0 (P ≤ 0.05); it was higher in the 0.1% and 0.2% groups than in 226

the other groups (P ≤ 0.05). At 2 dpi, the T-SOD activity reached lowest level in the 227

ICG and reached highest point in the 0.2% group (P ≤ 0.05). In all β-glucan groups, 228

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

T-SOD activity was significantly higher than in the NCG and there was no 229

difference between 0.05% and 0.1% groups (P > 0.05). At 4 dpi, the T-SOD activity 230

in the 0.1% group was significantly higher than in the other groups (P ≤ 0.05). The 231

T-SOD activity in the 0.2% group was significantly lower than in the ICG (P ≤ 0.05); 232

however, there was no significant difference between the ICG and 0.05% group (P > 233

0.05). At 6 dpi, T-SOD activity in the β-glucan groups was significantly higher than 234

in the ICG. T-SOD activity in the ICG decreased to minimum at 2 dpi (P ≤ 0.05), 235

increased to maximum at 4 dpi (P ≤ 0.05). In the 0.05% and 0.1% groups, T-SOD 236

activity improved to maximum at 4 dpi (P ≤ 0.05). In the 0.2% group, T-SOD 237

activity improved to maximum at 2 dpi (P ≤ 0.05) (Fig. 2A). 238

After feeding for 42 days, Cu-Zn/SOD gene expression in the 0.05% and 0.1% 239

groups was considerably higher than in the other groups; however, in the 0.2% 240

group it was significantly lower than in the other groups (P ≤ 0.05). At 2 dpi, 241

Cu-Zn/SOD expression in the 0.1% and 0.2% groups was higher than in other 242

groups while it reached the lowest point in the 0.05% group (P ≤ 0.05). At 4 dpi, 243

Cu-Zn/SOD expression in dietary β-glucan groups was remarkably higher than in 244

the ICG (P > 0.05). At 6 dpi, Cu-Zn/SOD expression in 0.2% group was 245

considerably higher than in the ICG (P ≤ 0.05). Cu-Zn/SOD expression in the ICG, 246

0.1%, and 0.2% groups reached a maximum at 2 dpi, while in the 0.05% group it 247

increased to the highest at 4 dpi (Fig. 2B). 248

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

249

250

Fig. 2. T-SOD activity (A) and relative Cu-Zn/SOD expression (B) in the head kidney of 251

rainbow trout at different times. NCG denotes control group, ICG denotes infected control 252

group, 0.05 denotes experiment group fed 0.05% dietary β-glucan, 0.10 denotes experiment 253

group fed 0.1% dietary β-glucan, 0.20 denotes experiment group fed 0.2% dietary β-glucan, 254

and dpi denotes days post infection. Data are expressed as mean ± standard deviation. Different 255

lowercases indicate significant differences (P ≤ 0.05) among time points in the same group. 256

Different uppercases indicate significant differences (P ≤ 0.05) among the groups at the same 257

time points. 258

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3.3.2. Serum POD activity and relative POD mRNA expression in the head kidney 259

After 42 days of feeding, POD decreased significantly compared with 0 day in all 260

groups (P ≤ 0.05), and no significant difference was found among the different 261

groups (P > 0.05). At 2 dpi, the POD activity in the dietary β-glucan groups was 262

significantly higher than in the NCG (P ≤ 0.05) and it was the highest in the 0.05% 263

group. At 4 dpi, POD activity in the 0.1% and 0.2% groups was significantly higher 264

than others (P ≤ 0.05). At 6 dpi, POD activity in the NCG and 0.05% group was 265

significantly higher than in the other groups (P ≤ 0.05). 266

POD activity in the ICG and 0.05% group increased to its maximum at 6 dpi 267

while POD increased to its maximum at 4 dpi in the 0.1% and 0.2% groups (P ≤ 268

0.05) (Fig. 3A). 269

After feeding for 42 days, POD expression in the 0.1% and 0.2% groups was 270

considerably higher than in the other groups (P ≤ 0.05). At 2 dpi, POD expression in 271

the 0.05% and 0.2% groups was higher than in the other groups (P ≤ 0.05). At 4 dpi, 272

POD expression in the 0.1% and 0.2% groups was markedly higher than in the ICG 273

and 0.05% group (P > 0.05). At 6 dpi, POD expression in the ICG was significantly 274

higher than in the other infected groups (P ≤ 0.05). POD expression in the 0.1% and 275

0.2% groups reached a maximum at 4dpi while in the 0.05% group and ICG it was 276

the highest at 6dpi (Fig. 3B). 277

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

278

279

Fig. 3. POD activity (A) and relative POD expression (B) in the head kidney of rainbow trout 280

at different times. NCG denotes control group, ICG denotes infected control group, 0.05 281

denotes experiment group fed 0.05% dietary β-glucan, 0.10 denotes experiment group fed 0.1% 282

dietary β-glucan, 0.20 denotes experiment group fed 0.2% dietary β-glucan, and dpi denotes 283

days post infection. Data are expressed as mean ± standard deviation. Different lowercases 284

indicate significant differences (P ≤ 0.05) among time points in the same group. Different 285

uppercases indicate significant differences (P ≤ 0.05) among the groups at the same time 286

points. 287

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

3.3.3. Serum CAT activity and relative CAT mRNA expression in the head kidney 288

After 42 days of feeding, CAT activity decreased significantly compared with 0 289

day in all groups (P ≤ 0.05), and no significant difference was found among groups 290

(P > 0.05). At 2 dpi, CAT activity was the lowest in the ICG and the highest in the 291

0.1% group. It was significantly higher in the 0.05% and 0.2% groups than in the 292

NCG (P ≤ 0.05); At 4 dpi, CAT activity in all three β-glucan groups was higher than 293

in the ICG (P ≤ 0.05) and it was highest in the 0.2% group (P ≤ 0.05). It was 294

significantly higher in the 0.05% and 0.2% groups than in the 0.1% group (P ≤ 0.05). 295

At 6 dpi, CAT activity was the highest in the ICG, significantly higher in the 0.05% 296

group than in 0.1% and 0.2% groups (P ≤ 0.05). 297

CAT activity in the ICG and 0.05% group increased to its maximum at 6 dpi, while 298

in the 0.1% and 0.2% groups, it increased to its maximum at 4 dpi (P ≤ 0.05) (Fig. 299

4A). 300

CAT mRNA expression was not significantly different among groups after 301

feeding for 42 days (P ≤ 0.05). At 2 dpi, CAT expression in the dietary β-glucan 302

groups was higher than in the ICG; it was highest in the 0.1% group (P ≤ 0.05). At 4 303

dpi, CAT expression in the 0.2% group was significantly higher than in the other 304

groups (P ≤ 0.05), but there was no difference among the infected groups (P > 0.05). 305

At 6 dpi, CAT expression in the ICG was considerably higher than in other groups 306

(P ≤ 0.05). 307

CAT expression in the 0.05% and 0.1% groups reached a maximum at 2 dpi and 308

was the highest in the 0.2% group at 4 dpi, while the ICG group reached its highest 309

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

level at 6 dpi (Fig. 4B) 310

311

312

Fig. 4. CAT activity (A) and relative CAT expression (B) in the head kidney of rainbow trout 313

at different times. NCG denotes control group, ICG denotes infected control group, 0.05 314

denotes experiment group fed 0.05% dietary β-glucan, 0.10 denotes experiment group fed 0.1% 315

dietary β-glucan, 0.20 denotes experiment group fed 0.2% dietary β-glucan, and dpi denotes 316

days post infection. Data are expressed as mean ± standard deviation. Different lowercases 317

indicate significant differences (P ≤ 0.05) among time points in the same group. Different 318

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

uppercases indicate significant differences (P ≤ 0.05) among the groups at the same time 319

points. 320

3.3.4. Serum LSZ activity and relative LSZ mRNA expression in the head kidney 321

Dietary β-glucan had no significant effect on serum LSZ in rainbow trout after 42 322

days of feeding (P > 0.05). At 2 dpi, LSZ activity in groups infected by A. 323

salmonicida was significantly lower than in the NCG (P ≤ 0.05) and was the lowest 324

in the ICG. At 4 dpi, LSZ activity in the dietary β-glucan groups was remarkably 325

higher than control groups (P ≤ 0.05) and it was the highest in the 0.1% group. At 6 326

dpi, LSZ in the NCG was significantly higher than in the other groups (P ≤ 0.05). It 327

was significantly higher in the 0.01% group than the other β-glucan groups (P ≤ 328

0.05). LSZ activity in the ICG group increased to its maximum at 6 dpi, while LSZ 329

in the dietary β-glucan groups reached maximum at 4 dpi (P ≤ 0.05) (Fig. 5A). 330

LSZ expression was not significantly different among groups (P ≤ 0.05) before 331

infection. At 2 dpi, LSZ expression in the 0.1% group was higher than in the 0.05% 332

group (P ≤ 0.05). At 4 dpi, LSZ expression in 0.1% group was the highest (P ≤ 0.05), 333

and significantly higher in the 0.1% and 0.2% groups compared with the other 334

groups (P ≤ 0.05). At 6 dpi, LSZ expression in the ICG was significantly higher than 335

in other groups while the 0.2% group had the lowest value (P ≤ 0.05). 336

LSZ in the dietary β-glucan groups reached its maximum at 4 dpi and the ICG group 337

reached its highest level at 6dpi (Fig. 5B). 338

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

339

340

Fig. 5. LSZ activity (A) and relative LSZ expression (B) in head kidney of rainbow trout at 341

different times. NCG denotes control group, ICG denotes infected control group, 0.05 denotes 342

experiment group fed 0.05% dietary β-glucan, 0.10 denotes experiment group fed 0.1% dietary 343

β-glucan, 0.20 denotes experiment group fed 0.2% dietary β-glucan, and dpi denotes days post 344

infection. Data are expressed as mean ± standard deviation. Different lowercases indicate 345

significant differences (P ≤ 0.05) among time points in the same group. Different uppercases 346

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

indicate significant differences (P ≤ 0.05) among the groups at the same time points. 347

3.3.5. GPT activity in serum 348

GPT in dietary β-glucan groups was significantly higher than in the control group 349

after 42 days of feeding (P > 0.05). At 2 dpi, GPT activity in infected groups was 350

significantly lower than in the NCG and was significantly higher in the ICG than in 351

other groups (P ≤ 0.05). At 4 dpi, GPT activity in the 0.05% group was remarkably 352

higher than in other groups (P ≤ 0.05). With the exception of the NCG, GPT activity 353

was lower in the 0.2% group compared with the other groups (P ≤ 0.05). At 4 dpi, 354

GPT activity in the ICG was significantly higher than in the other groups (P ≤ 0.05), 355

but had returned to the initial levels in the other groups (P ≤ 0.05). GPT activity in 356

the ICG group showed an increasing trend until 6 dpi. In dietary β-glucan groups, it 357

increased up to 4 dpi and then decreased to initial level at 6dpi (P ≤ 0.05) (Fig. 6). 358

359

Fig. 6. GPT activity in serum of rainbow trout at different times. NCG denotes control group, 360

ICG denotes infected control group, 0.05 denotes experiment group fed 0.05% dietary β-glucan, 361

0.10 denotes experiment group fed 0.1% dietary β-glucan, 0.20 denotes experiment group fed 362

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

0.2% dietary β-glucan, and dpi denotes days post infection. Data are expressed as mean ± 363

standard deviation. Different lowercases indicate significant differences (P ≤ 0.05) among time 364

points in the same group. Different uppercases indicate significant differences (P ≤ 0.05) 365

among the groups at the same time points. 366

3.3.6. GOT activity in serum 367

GOT activity improved significantly in all groups (P ≤ 0.05) after feeding for 42 368

days, but no significant difference was recorded among them (P > 0.05). At 2 dpi, 369

with the exception of the 0.2% group, GOT activity in the infected groups was 370

significantly higher than in the NCG, and was significantly higher in the ICG than in 371

the other groups (P ≤ 0.05). At 4 dpi, GOT activity in the ICG and 0.05% group was 372

markedly higher than others and that in 0.2% group was significantly lower than 373

other groups (P ≤ 0.05). 6 days post-infection, GOT in 0.05% group was 374

significantly higher than in the other groups (P ≤ 0.05). 375

GOT activity in the ICG group reached to its maximum at 2 dpi and was at a 376

higher level than the dietary β-glucan groups. In the 0.2% β-glucan group, the GOT 377

level remained at a low level comparable with the control group (P ≤ 0.05) (Fig. 7). 378

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

379

Fig. 7. GOT activity in serum of rainbow trout at different times. NCG denotes control group, 380

ICG denotes infected control group, 0.05 denotes experiment group fed 0.05% dietary β-glucan, 381

0.10 denotes experiment group fed 0.1% dietary β-glucan, 0.20 denotes experiment group fed 382

0.2% dietary β-glucan, and dpi denotes days post infection. Data are expressed as mean ± 383

standard deviation. Different lowercases indicate significant differences (P ≤ 0.05) among time 384

points in the same group. Different uppercases indicate significant differences (P ≤ 0.05) 385

among the groups at the same time points. 386

3.3.7. HSP70 mRNA expression in the head kidney 387

HSP70 expression was not significantly different among groups (P ≤ 0.05) before 388

infection. At 2 dpi, HSP70 expression in the 0.1% group was significantly higher 389

than in the other groups (P ≤ 0.05). At 4 dpi, HSP70 expression in the 0.2% group 390

reached the highest level (P ≤ 0.05) and there was no significant difference between 391

the other groups (P > 0.05). At 6 dpi, HSP70 expression in the ICG was 392

considerably higher than in the other groups, while it was lower in the 0.05% group 393

compared with other infected groups (P ≤ 0.05). 394

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

HSP70 expression in the 0.2% group reached its maximum at 4dpi, while in all 395

other infected groups it reached the highest level at 6dpi (Fig. 8). 396

397

Fig. 8. Relative HSP70 expression in head kidney of rainbow trout at different times. NCG 398

denotes control group, ICG denotes infected control group, 0.05 denotes experiment group fed 399

0.05% dietary β-glucan, 0.10 denotes experiment group fed 0.1% dietary β-glucan, 0.20 400

denotes experiment group fed 0.2% dietary β-glucan, and dpi denotes days post infection. Data 401

are expressed as mean ± standard deviation. Different lowercases indicate significant 402

differences (P ≤ 0.05) among time points in the same group. Different uppercases indicate 403

significant differences (P ≤ 0.05) among the groups at the same time points. 404

4. Discussion 405

Fish are more prone to infection by various pathogens in industrial aquaculture 406

due to high stocking density and management practices leading to an adverse 407

farming environment [21]. β-glucan, as one of the commonly known 408

immunostimulants, has been demonstrated to enhance the innate response with little 409

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

impairment to the development of animal [22, 23]. However, to the best of the 410

experts’ knowledge, little has been published on the process of how β-glucan 411

regulates the innate response during pathogen infection. In the present study, 412

changes in serum enzyme activities and a series of stress- and immune-related genes 413

expression in the head kidney of rainbow trout were assessed during the challenge 414

period. 415

The present findings revealed that dietary β-glucan can promote the growth of 416

rainbow trout. Within the range of 0.2% β-glucan concentration, growth 417

performance improved with increased dosage. The survival rate of rainbow trout 418

infected by A. salmonicida was significantly higher in the dietary β-glucan groups, 419

and the 0.2% group had a stronger level of protection than both the 0.5% and 0.1% 420

groups. This result is consistent with many other studies in which β-glucan was 421

shown to increase the growth performance and the survival rate in numerous aquatic 422

species, such as koi carp (Cyprinus carpio koi) [24], large yellow croaker 423

(Pseudosciaena crocea) [15], and juvenile pompano (Trachinotus ovatus) [25]. 424

Besides dosage, feeding duration and the mode of administration among several 425

other factors can influence the effectiveness of β-glucan [26]. Therefore, further 426

studies are required to determine the contributing factors and mechanism involved in 427

the enhancement of growth performance. 428

In an adverse setting such as pathogens infection or cold stress, respiratory 429

burst can occur in the immune cells and NADPH oxidase is activated. After 430

activation, NADPH oxidase generates the production of a series of reactive 431

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

oxygen species (ROS) such as superoxide anion (O2-) and hydrogen peroxide 432

(H2O2) which are effective antimicrobial substances. However, excessive ROS 433

can the membranes and DNA [27, 28]. The antioxidant system consisting of SOD, 434

CAT, and POD can effectively eliminate ROS in order to maintain a stable 435

internal environment [29]. Therefore SOD, CAT, and POD can indirectly reflect 436

the ability of the host to remove ROS, and are generally recognized as indicators 437

of the immune potential [30]. In Atlantic salmon, serum SOD, POD, and CAT 438

activities, along with their mRNA expression, have been shown to significantly 439

decrease after bacterial challenge [31]. However, in the present study, serum T- 440

SOD, POD, and CAT activities, and their mRNA expression in the head kidney 441

generally increased to a higher level after infection. This indicates that during 442

infection in rainbow trout, β-glucan can enhance the host’s antioxidant ability to 443

clear more excessive ROS triggered by bacteria. 444

Lysozyme, in the serum, mucus, and ova [32], can attack the peptidoglycan layer 445

of bacterial cell walls causing lysis either directly or together with the complement 446

system [11]. Lysozyme in rainbow trout have a strong bactericidal effect on a few 447

Gram-negative fish pathogenic bacteria, such as Y. ruckeri [33]. In the present study, 448

serum LSZ and LSZ mRNA expression in the head kidney after infection were 449

higher than baseline levels (P ≤ 0.05). In the dietary β-glucan groups, serum LSZ 450

and its expression in the head kidney reached a higher peak earlier than in the 451

control group which was in accordance with the findings of other studies [11, 34]. 452

Such enhancement might be related to improved phagocytic activity of phagocytic 453

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

cells [35]. After activation by β-glucan, the in vivo phagocytic cells might trigger 454

other antimicrobial mechanisms such as the release of lysosomal enzymes, the 455

complement system and production of ROS [36]. In a murine model, orally 456

administered β-glucan could be transferred to the bone marrow by macrophages 457

where they appeared 4 days post β-glucan administration [37]. As the head kidney 458

of fish is equivalent to mammalian bone marrow [38, 39], it is deduced that the 459

lysozyme gene regulations in the rainbow trout head kidney could be the 460

consequence of the same type of mechanism [37]. However, this needs to be 461

investigated further. 462

GPT and GOT are serum non-functional enzymes. They are normally 463

distributed in the cells of the liver, kidneys, heart, and other organs [40]; however, 464

the activities of these two enzymes in serum increase significantly when tissue 465

cells, especially those in the liver and heart, are impaired. Therefore, these 466

enzymes are considered to be important for assessing the state of liver [41]. In 467

the present study, serum GPT and GOT activity was considerably increased after 468

infection; however, in the dietary β-glucan groups, they were lower than in the 469

control group. This indicates that β-glucan can protect the liver of rainbow trout 470

from damage by bacteria especially at higher dosages. 471

In aquatic animals, the HSP family has been shown to play an important part 472

in the host response to environmental stressors, along with specific and 473

non-specific immune responses to bacterial and viral infections in both fish and 474

shrimp. Regulation of HSP genes relating to infection has also been reported in 475

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

many aquatic species such as Penaeus monodon [42] and sea bass [43]. In the 476

present study, HSP70 expression in all groups increased considerably after 477

infection; the most dramatical and earlier increase was found in the 0.2% 478

β-glucan group than others. The HSP response has been shown to regulate the 479

mammalian immune response and, in particular, the T-cell-mediated response 480

[44]. This produces inflammatory products such as cytokines and adhesins. 481

Despite insufficient evidence, it has been deduced that HSPs also play a similar 482

role in regulating the fish immune response and correlate with the T-cell function 483

in immune response. Therefore HSPs may be a vital factor in immunity [45]. In 484

the present study, earliest and highest levels of expression of HSP70 in the high 485

dosage β-glucan group indicate that β-glucan is likely to alter the immune 486

response of rainbow trout via regulation of HSP70 expression. 487

This study confirms that dietary β-glucan is beneficial for promoting growth 488

and enhancing resistance to A. salmonicida in rainbow trout. According to the 489

analysis of stress- and immune-related factors, it can be assumed that β-glucan 490

helps the organism to resist bacterial infection in two ways. It can stimulate 491

stress- and immune-related factors at higher levels and quickly it can trigger the 492

immune reaction to fight against bacterial infection. The present findings indicate 493

that the optimal level of dietary β-glucan concentration for rainbow trout is 0.2%. 494

However, the regulating mechanism of β-glucan in the immune response requires 495

further research. 496

Ethics statement 497

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

The use of non-human primates in research. All fish in this study were handled 498

in strict accordance with China legislation on scientific procedures on living 499

animals. The protocol was approved by the ethics committee at University of 500

Chinese Academy of Science (permit number: 20021101). 501

Conflict of interest 502

No potential conflict of interest. 503

Acknowledgment 504

This work was financially supported by the National Natural Science 505

Founds (grant nos. 41306152, 31472312, 31402283), the Jiangsu Province key 506

R&D Project (BE2015325), the National Key Technologies R&D 507

Program (2014BAD08B09), the 56th China Postdoctoral Science Foundation 508

(2014M560580), Postdoctoral Innovation Project Special Funds of Shandong 509

Province (201402005), and Independent Innovation and Achievements 510

Transformation Special Foundation of Shandong Province (2014ZZCX06204). 511

We particularly thank Dr Zaki Zaki Sharawy for carefully revising the paper. 512

Reference 513

[1] Q. Liu, Z. Hou, H. Wen, J. Li, F. He, J. Wang, et al., Effect of stocking density on water quality and 514

(Growth, Body Composition and Plasma Cortisol Content) performance of pen-reared rainbow trout 515

(Oncorhynchus mykiss), J. Ocean U. China 15 (2016) 667-675. 516

[2] C.E. Trenzado, A.E. Morales, M. de la Higuera, Physiological changes in rainbow trout held under 517

crowded conditions and fed diets with different levels of vitamins E and C and highly unsaturated fatty 518

acids (HUFA), Aquaculture 277 (2008) 293-302. 519

[3] D.K. Meena, P. Das, S. Kumar, S.C. Mandal, A.K. Prusty, S.K. Singh, et al., Beta-glucan: an ideal 520

immunostimulant in aquaculture (a review), Fish phy. Biochem. 39 (2013) 431-457. 521

[4] J. Raa, G. Roerstad, R. Engstad, B. Robertsen, The use of immunostimulants to increase resistance of 522

aquatic organisms to microbial infections, I.M. Shariff, R.P. Subasinghe, J.R. Arthur (Eds.), Diseases in 523

Asian aquaculture, Health Fish Section, Asian Fisheries Society, Manila, Philippines (1992), pp. 39–50 524

[5] A. Siwicki, M. Morand, E. Terech‐Majewska, W. Niemczuk, K. Kazuń, E. Glabski, Influence of 525

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

immunostimulants on the effectiveness of vaccines in fish: in vitro and in vivo study, J. Appl. Ichthyol. 14 526

(1998) 225-227. 527

[6] J.J. Volman, J.D. Ramakers, J. Plat, Dietary modulation of immune function by β-glucans, Physiol. Behav. 528

94 (2008) 276-284. 529

[7] S. Soltanian, E. Stuyven, E. Cox, P. Sorgeloos, P. Bossier, Beta-glucans as immunostimulant in vertebrates 530

and invertebrates, Crit. Rev. Microbiol. 35 (2009) 109-138. 531

[8] K. Tokunaka, N. Ohno, Y. Adachi, S. Tanaka, H. Tamura, T. Yadomae, Immunopharmacological and 532

immunotoxicological activities of a water-soluble (1→3)-β-D-glucan, CSBG from Candida spp, Int. J. 533

Immunopharmac 22 (2000) 383-394. 534

[9] M.T. Cook, P.J. Hayball, W. Hutchinson, B.F. Nowak, J.D. Hayball, Administration of a commercial 535

immunostimulant preparation, EcoActiva™ as a feed supplement enhances macrophage respiratory burst 536

and the growth rate of snapper (Pagrus auratus, Sparidae (Bloch and Schneider)) in winter, Fish Shellfish 537

Immunol 14 (2003) 333-345. 538

[10] R.E. Engstad, B. Robertsen, E. Frivold, Yeast glucan induces increase in lysozyme and 539

complement-mediated haemolytic activity in Atlantic salmon blood, Fish Shellfish Immunol 2 (1992) 540

287-297. 541

[11] S.M. Paulsen, R.E. Engstad, B. Robertsen, Enhanced lysozyme production in Atlantic salmon (Salmo 542

salar L.) macrophages treated with yeast β-glucan and bacterial lipopolysaccharide, Fish Shellfish Immunol 543

11 (2001) 23-37. 544

[12] N. Chansue, M. Endo, T. Kono, M. Sakai, The Stimulation of Cytokine-like Proteins in Tilapia 545

(Oreochromis niloticus) Orally Treated with beta-1, 3-glucan, Asian Fish Sci. 13 (2000) 271-278. 546

[13] R.M.C. Udayangani, S.H.S. Dananjaya, B. Fronte, C.H. Kim, J. Lee, M. De Zoysa, Feeding of nano scale 547

oats β-glucan enhances the host resistance against Edwardsiella tarda and protective immune modulation 548

in zebrafish larvae, Fish Shellfish Immunol 60 (2017) 72-77. 549

[14] J.J. Miest, C. Arndt, M. Adamek, D. Steinhagen, T.B.H. Reusch, Dietary β-glucan (MacroGard®) 550

enhances survival of first feeding turbot (Scophthalmus maximus) larvae by altering immunity, metabolism 551

and microbiota, Fish Shellfish Immunol 48 (2016) 94-104. 552

[15] Q. Ai, K. Mai, L. Zhang, B. Tan, W. Zhang, W. Xu, et al., Effects of dietary β-1, 3 glucan on innate 553

immune response of large yellow croaker, Pseudosciaena crocea, Fish Shellfish Immunol 22 (2007) 554

394-402. 555

[16] J. Skov, P.W. Kania, L. Holten-Andersen, B. Fouz, K. Buchmann, Immunomodulatory effects of dietary 556

β-1, 3-glucan from Euglena gracilis in rainbow trout (Oncorhynchus mykiss) immersion vaccinated against 557

Yersinia ruckeri, Fish Shellfish Immunol 33 (2012) 111-120. 558

[17] S. Bilen, S. Ünal, H. Güvensoy, Effects of oyster mushroom (Pleurotus ostreatus) and nettle (Urtica 559

dioica) methanolic extracts on immune responses and resistance to Aeromonas hydrophila in rainbow trout 560

(Oncorhynchus mykiss), Aquaculture 454 (2016) 90-94. 561

[18] B. Djordjevic, S. Škugor, S.M. Jørgensen, M. Øverland, L.T. Mydland, A. Krasnov, Modulation of 562

splenic immune responses to bacterial lipopolysaccharide in rainbow trout (Oncorhynchus mykiss) fed 563

lentinan, a beta-glucan from mushroom Lentinula edodes, Fish Shellfish Immunol 26 (2009) 201-209. 564

[19] W.E. Ricker, 11 Growth Rates and Models, Fish Physiology, 8 (1979) 677-743. 565

munology of Fish, eLS, John Wiley & Sons, Ltd, Aberdeen, 2015, pp. 1-9. 566

[20] K.J. Livak, T.D. Schmittgen, Analysis of Relative Gene Expression Data Using Real-Time Quantitative 567

PCR and the 2−∆∆CT Method, Methods 25 (2001) 402-408. 568

[21] V. Selvaraj, K. Sampath, V. Sekar, Administration of yeast glucan enhances survival and some 569

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

non-specific and specific immune parameters in carp (Cyprinus carpio) infected with Aeromonas 570

hydrophila, Fish Shellfish Immunol 19 (2005) 293-306. 571

[22] I. Bricknell, R.A. Dalmo, The use of immunostimulants in fish larval aquaculture, Fish Shellfish Immunol 572

19 (2005) 457-472. 573

[23] M. Sakai, Current research status of fish immunostimulants, Aquaculture 172 (1999) 63-92. 574

[24] S. Lin, Y. Pan, L. Luo, L. Luo, Effects of dietary β-1,3-glucan, chitosan or raffinose on the growth, innate 575

immunity and resistance of koi (Cyprinus carpio koi), Fish Shellfish Immunol 31 (2011) 788-794. 576

[25] H. Do Huu, H.M. Sang, N.T. Thanh Thuy, Dietary β-glucan improved growth performance, Vibrio counts, 577

haematological parameters and stress resistance of pompano fish, Trachinotus ovatus Linnaeus, 1758, Fish 578

Shellfish Immunol 54 (2016) 402-410. 579

[26] R.A. Dalmo, J. Bøgwald, β-glucans as conductors of immune symphonies, Fish Shellfish Immunol 25 580

(2008) 384-396. 581

[27] A. Castellanos-González, L.a. Jiménez, A. Landa, Cloning, production and characterisation of a 582

recombinant Cu/Zn superoxide dismutase from Taenia solium, Int. J. Parasitol. 32 (2002) 1175-1182. 583

[28] A.I. Campa-Córdova, N.Y. Hernández-Saavedra, R. De Philippis, F. Ascencio, Generation of superoxide 584

anion and SOD activity in haemocytes and muscle of American white shrimp (Litopenaeus vannamei) as a 585

response to β-glucan and sulphated polysaccharide, Fish Shellfish Immunol 12 (2002) 353-366. 586

[29] R.M. Martínez-Álvarez, A.E. Morales, A. Sanz, Antioxidant Defenses in Fish: Biotic and Abiotic Factors, 587

Rev. Fish Biol. Fisher 15 (2005) 75-88. 588

[30] J. Rodrı́guez, G. Le Moullac, State of the art of immunological tools and health control of penaeid shrimp, 589

Aquaculture 191 (2000) 109-119. 590

[31] Y. Du, M. Yi, P. Xiao, L. Meng, X. Li, G. Sun, et al., The impact of Aeromonas salmonicida infection on 591

innate immune parameters of Atlantic salmon (Salmo salar L), Fish Shellfish Immunol 44 (2015) 307-315. 592

[32] A.E. Ellis, Immunity to bacteria in fish, Fish Shellfish Immunol 9 (1999) 291-308. 593

[33] B. Grinde, Lysozyme from rainbow trout, Salmo gairdneri Richardson, as an antibacterial agent against 594

fish pathogens, J. Fish Dis. 12 (1989) 95-104. 595

[34] J. Skov, P.W. Kania, L. Holten-Andersen, B. Fouz, K. Buchmann, Immunomodulatory effects of dietary 596

β-1,3-glucan from Euglena gracilis in rainbow trout (Oncorhynchus mykiss) immersion vaccinated against 597

Yersinia ruckeri, Fish Shellfish Immunol 33 (2012) 111-120. 598

[35] C.K. Misra, B.K. Das, S.C. Mukherjee, P. Pattnaik, Effect of long term administration of dietary β-glucan 599

on immunity, growth and survival of Labeo rohita fingerlings, Aquaculture 255 (2006) 82-94. 600

[36] J.K. Kwak, S.W. Park, J.G. Koo, M.G. Cho, R. Buchholz, P. Goetz, Enhancement of the Non-Specific 601

Defence Activities in Carp (Cyprinus carpio) and Flounder (Paralichthys olivcaces) by Oral 602

Administration of Schizophyllan, Acta Biotechnol. 23 (2003) 359-371. 603

[37] F. Hong, J. Yan, J.T. Baran, D.J. Allendorf, R.D. Hansen, G.R. Ostroff, et al., Mechanism by Which 604

Orally Administered β-1,3-Glucans Enhance the Tumoricidal Activity of Antitumor Monoclonal 605

Antibodies in Murine Tumor Models, J. Immunol. 173 (2004) 797-806. 606

[38] C.M. Press, Ø. Evensen, The morphology of the immune system in teleost fishes, Fish Shellfish Immunol 607

9 (1999) 309-318. 608

[39] J. Meseguer, A. López-Ruiz, A. Garcí-Ayala, Reticulo-endothelial stroma of the head-kidney from the 609

seawater teleost gilthead seabream (Sparus aurata L.): An ultrastructural and cytochemical study, Anat. 610

Rec. 241 (1995) 303-309. 611

[40] J. Li, X.-F. Liang, Q. Tan, X. Yuan, L. Liu, Y. Zhou, et al., Effects of vitamin E on growth performance 612

and antioxidant status in juvenile grass carp Ctenopharyngodon idellus, Aquaculture 430 (2014) 21-27. 613

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

[41] R. Coz-Rakovac, I. Strunjak-Perovic1, M. Hacmanjek, N.T. Popovic, Z. Lipej, B. Sostaric, Blood 614

Chemistry and Histological Properties of Wild and Cultured Sea Bass (Dicentrarchus labrax) in the North 615

Adriatic Sea, Vet. Res. Commun. 29 (2005) 677-687. 616

[42] R. Wu, Y. Sun, L.M. Lei, S.T. Xie, Molecular identification and expression of heat shock cognate 70 617

(HSC70) in the pacific white shrimp Litopenaeus vannamei, Mol. Microbiol. 42 (2008) 234-242. 618

[43] E.E. Deane, N.Y.S. Woo, Evidence for disruption of Na+-K+-ATPase and hsp70 during vibriosis of sea 619

bream, Sparus (=Rhabdosargus) sarba Forsskål, J. Fish Dis. 28 (2005) 239-251. 620

[44] M.E. Feder, G.E. Hofmann, Heat-shock proteins, molecular chaperones, and the stress response: 621

Evolutionary and ecological physiology, Annu. Rev. Physiol. 61 (1999) 243-282. 622

[45] C.-W. Dong, Y.-B. Zhang, Q.-Y. Zhang, J.-F. Gui, Differential expression of three Paralichthys olivaceus 623

Hsp40 genes in responses to virus infection and heat shock, Fish Shellfish Immunol 21 (2006) 146-158. 624

MANUSCRIP

T

ACCEPTED

ACCEPTED MANUSCRIPT

1

Highlight: 2

1、 Dietary β-glucan in dosage of 0.1% and 0.2% can enhance growth 3

performance of rainbow trout. 4

2、 Dietary β-glucan (from 0.05% to 0.2%) is able to significantly 5

enhance resistance to A. salmonicida in rainbow trout. 6

3、 It can stimulate stress- and immune-related factors at higher levels 7

and it can trigger the immune reaction more quickly to fight against 8

bacterial infection. 9

4、 In this paper, the optimal level of dietary β-glucan concentration for 10

rainbow trout is 0.2%. 11

12