1

Characteristics of CTX-M Extended-Spectrum β-Lactamase-Producing E. 1 coli Isolated from Multiple Rivers in Southern Taiwan 2 3 4 Po-An Chena,b, Chih-Hsin Hungc , Ping-Chih Huangd, Jung-Ren Chene, I-Fei Huanga,b, 5 Wan-Ling Chena,b,f, Yee-Hsuan Chioua,b,g, Wan-Yu Hungc, Jiun-Ling Wangh*, Ming-Fang 6 Chenga,b,g# 7 8 Department of Pediatrics, Kaohsiung Veterans General Hospital, Kaohsiung, Taiwana; 9 School of Medicine, National Yang-Ming University, Taipei, Taiwanb; Department of 10 Chemical Engineering and Institute of Biotechnology and Chemical Engineering, I-Shou 11 University, Kaohsiung, Taiwanc; Cheng-Shiu University, Kaohsiung, Taiwand; 12 Department of Biological Science and Technology, I-Shou University, Kaohsiung, 13 Taiwane; Department of Pediatrics, Pingtung Branch of Veterans General 14 Hospital-Kaohsiung, Pingtung, Taiwanf; Fooyin University, Kaohsiung, Taiwang; 15 Department of Internal Medicince, National Cheng Kung University Hospital, Tainan, 16 Taiwanh 17 18

AEM Accepted Manuscript Posted Online 15 January 2016Appl. Environ. Microbiol. doi:10.1128/AEM.03222-15Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

2

Running Head: ESBL-producing E. coli in Multiple Rivers 19 20 #Address correspondence to Ming-Fang Cheng, mfcheng@vghks.gov.tw. 21 * Present address of alternate corresponding author: Jiun-Ling Wang, Department of 22 Internal Medicine, National Cheng Kung University Hospital, Tainan, Taiwan 23 24 Po-An Chen and Chih-Hsin Hung contributed equally to this work. 25 26 27 28 29 30 31 32 33 34 35 36

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

3

ABSTRACT 37 Background 38

Extended-spectrum β-lactamase (ESBL)-producing Escherichia coli sequence type 39 ST131 has emerged as the leading cause of community-acquired urinary tract infections 40 and bacteremia worldwide. Whether environmental water is a potential reservoir of these 41 strains remains unclear. 42 Methods 43

River water samples were collected from 40 stations in Southern Taiwan from 44 February to August of 2014. Polymerase chain reaction assay and multilocus sequence 45 typing (MLST) analysis were conducted to determine the CTX-M group and sequence 46 type, respectively. In addition, we identified the seasonal frequency of ESBL-producing E. 47 coli and their geographical relationship with runoffs from livestock and poultry farms 48 between February and August of 2014. 49 Results 50

ESBL-producing E. coli accounted for 30% of 621 E. coli strains isolated from river 51 water in Southern Taiwan. ESBL-producing E. coli ST131 was not detected among the 52 isolates. The most commonly detected strain was E. coli CTX-M-group 9. Among the 92 53 isolates selected for MLST analysis, the most common ESBL-producing clonal 54

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

4

complexes were ST10 and ST58. The proportion of ESBL-producing E. coli was 55 significantly higher in areas with a lower river pollution index (P = 0.025) and regions 56 with a large number of chicken farms (P = 0.013). 57 Conclusion 58 ESBL-producing E. coli strains were commonly isolated from river waters in 59 Southern Taiwan. The most commonly isolated ESBL-producing clonal complexes were 60 ST10 and ST58, which were geographically related to chicken farms. ESBL-producing E. 61 coli ST131, the major clone causing community-acquired infections in Taiwan and 62 worldwide, was not detected in river waters. 63 64 65 66 67 68 69 70 71 72

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

5

INTRODUCTION 73 Escherichia coli sequence type ST131 (O25:H4), associated with CTX-M-15 74

extended-spectrum β-lactamase (ESBL), is the leading cause of community-acquired 75 urinary tract infections (UTIs) and bacteremia worldwide (1–7). This clonal group is 76 virulent, and carries a broad range of resistance genes on transferable plasmids (1, 3–9). 77 Studies conducted in Southern Taiwan have reported that several clinical isolates of the 78 ESBL-producing E. coli belonged to the ST131-O25b lineage. The most prevalent 79 ESBL-encoding gene is blaCTX-M-14 (10, 11). Most patients with bacteremia or UTIs 80 were previously healthy and did not exhibit any apparent risk factors. Only 30% of 81 infants with UTIs caused by this clone had identifiable potential risk factors (e.g., 82 previous antimicrobial use, hospitalization, neonatal infection, or underlying disease), 83 suggesting that these UTIs were mostly community acquired, not hospital acquired (10–84 12). 85

The established reservoirs of the ST131 E. coli clone are humans, companion 86 animals, noncompanion animals, and foods (7). Adequate studies have not been conducted 87 for evaluating whether environmental water is a potential reservoir of this 88 multidrug-resistant clone (13–15). Outbreaks of enteric infections are caused by various 89 bacteria, protozoa, fungi, and viruses present in contaminated drinking water (16, 17). In 90

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

6

addition, E. coli in irrigation water contaminates fresh produce (18, 19). The 91 contamination of rivers can occur through different sources, including human fecal 92 contamination from humans (sewer overflow during heavy rain or inadequate wastewater 93 treatment), animals (particularly livestock), and runoffs from pastures and sewages. In 94 this study, we determined whether river water is a potential reservoir of ESBL-producing 95 E. coli in Southern Taiwan, focusing on the blaCTX-M clone found in human infections. 96

97 98 99 100 101 102 103 104 105 106 107 108

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

7

MATERIALS AND METHODS 109 Sampling of river water 110 The Taiwan Environmental Protection Administration (TEPA) routinely examines 111

river water in Southern Taiwan for the presence of heavy metals and E. coli. Figure 1 112 displays 99 stations located in the upper and lower streams in Southern Taiwan that are 113 monitored every month, including the Puzi, Bazhang, Jihsui, Tsengwen, Yanshui, Linbian, 114 Donggang, Fenggang, Fangshan, Gaoping, Erren, Agongdian, and Shihchung Rivers and 115 the Paoli and Gangkou streams. One hundred milliliters of river water were sampled each 116 time and analyzed in accordance with the standard procedures of the Environmental 117 Analysis Laboratory of the TEPA (20). All of the sampling procedures followed the rules 118 established by the Environmental Analysis Laboratory of the TEPA. “River, Lake, 119 Reservoir water quality sampling general rule (TPEA Method NIEA W104.51C)” was 120 used as the standard basis for sampling. Water samples were analyzed immediately after 121 sample collection; the time required from sample collection to laboratory work 122 completion was <24 h. To perform cluster sampling for each river and county, we used a 123 random-number generator in selecting 40 of the 99 stations. One water sample was 124 collected at each sampled station per month. In total, 280 river water samples were 125 collected between February and August of 2014 in Southern Taiwan. The normal mean 126

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

8

daily temperature in the study area varied between 20.3 °C in February and 28.7 °C in 127 August. The monthly precipitation ranged between 20.5 mm in February and 416.7 mm 128 in August (21). 129

Parameters of sample collection 130 Information on sampling sites, weather, human population grade, rainfall season, the 131

river pollution index (RPI), distance to the river origin, and livestock and poultry 132 densities around the sampling site were evaluated. In addition, the relationship between 133 ESBL-producing E. coli isolates and these parameters was analyzed. 134

In accordance with the climate statistics provided by the Central Weather Bureau of 135 Taiwan, the period from February to April was defined as the spring and dry season, 136 during which the mean temperature and precipitation of each month were <25 °C and 137 <100 mm, respectively. The period from May to August was defined as the summer and 138 rainy season, during which the mean temperature and precipitation of each month were 139 >25 °C and >100 mm, respectively. The human population around the sampling site and 140 the population grade of each county or town were provided by the Ministry of the Interior 141 of Taiwan. The population of a county or town was categorized as Grade 1 for <49,000, 142 Grade 2 for between 49,000 and 93,000, Grade 3 for between 93,000 and 137,000, and 143 Grade 4 for >137,000 people. The RPI was graded according to the definitions provided 144

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

9

by the TEPA, which include the concentrations of 4 parameters in water: dissolved 145 oxygen (DO), biochemical oxygen demand (BOD5), suspended solids (SS), and 146 ammonia nitrogen (NH3-N). We defined the RPI as the average of these 4 parameters, 147 wherein an RPI <2, 2–3, 3–6, and >6 was determined as nonpolluted, lightly polluted, 148 moderately polluted, and severely polluted, respectively. (22) We defined the upper, 149 middle, and lower streams of a river based on the distance from the sampling site to the 150 river origin, wherein the upper, middle, and lower streams were the first third, middle 151 third, and final third of the river length, respectively. We collected information on 152 livestock and poultry distribution from the Council of Agriculture, Taiwan. We defined 153 the number of chickens being raised as <100,000, between 100,000 and 500,000, and 154 >500,000 as low, middle, and high densities of chicken farming, respectively. In a similar 155 manner, we defined the number of pigs being farmed as <10,000, between 10,000 and 156 50,000, and >50,000 as the low, middle, and high densities of pig farming, respectively. 157 We included 128 districts or countries in our study region. After excluding the area 158 without chicken farms, we selected the tertiles as the cut points, which are 159 approximately 100,000 and 500,000, for categorization. For pig farms, we selected 160 10,000 and 50,000 as the cut points, because the chicken-farming scale is 161 approximately 10 times more compared with the pig-farming scale in Southern 162

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

10

Taiwan. 163 Identification and purification of E. coli 164 The river water samples were tested for E. coli by using the membrane filtration 165

method. We used the decimal serial dilutions of river water filtered through 0.45-μm pore 166 size membranes, and followed the official method published by the TEPA (TPEA Method 167 NIEA E202.55B). A series of 10-fold dilutions of the water sample were conducted using 168 a sterile phosphate buffer–magnesium chloride solution as dilution blanks. The 169 membranes were placed on an LES (Lawrence Experimental Station) endo agar plate 170 (Bottle M Endo Agar LES 500G, Becton Dickson and Company, US) and incubated at 35 171 °C ± 1 °C for 24 h. The E. coli was extracted from colonies with a green metallic sheen 172 and suspended in 1 mL of PBS. We selected as many samples as possible and up to 10 173 colonies from each LES endo agar plate. One-hundred microliters of the highest dilution 174 displaying growth was spread on Luria-Bertani–ampicillin agar plates and incubated at 175 37 °C overnight. Each of these colonies was subcultured 3 additional times. The purified 176 isolates were inoculated on E. coli CHROMagar (ECC) plates (CHROMagar 4, Paris, 177 France) (23) and further incubated overnight at 37 °C to confirm the identification of E. 178 coli. 179 CHROMagarTM ESBL plates (CHROMagar 4, Paris, France) were used to identify 180

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

11

ESBL-producing E. coli according to the manufacturer instructions. 181 Detection of O25b-ST131, MLST, and blaCTX-M gene groups 182 For chromosomal DNA preparation, a single colony of E. coli was suspended in 183

200-μL of sterile double-distilled water and heated to 100 °C for 10 min. After cooling, 184 the samples were centrifuged, and 2 μL of the supernatant containing chromosomal DNA 185 was used as a template for PCR amplification. 186

The O25b serotype was determined by employing the methods by Clermont et al. 187 (24), and the screening primers used were as follows: rfb.1bis 188 (5ʹ-ATACCGACGACGCCGATCTG-3ʹ) and rfbO25b.r 189 (5ʹ-TGCTATTCATTATGCGCAGC-3ʹ) (25, 26). 190

According to the stratification of the O25b status (Figure 2), we used a 191 random-number generator in selecting 92 isolates for multilocus sequence typing (MLST) 192 analysis. All isolates with the O25b serotype (12 ESBL producing and 34 nonESBL 193 producing) were evaluated through MLST analysis. Twelve O25-positive ESBL-positive 194 and 34 O25-positive ESBL-negative E. coli were matched for randomly selecting 195 O25-negative ESBL-positive and O25-negative ESBL-negative E. coli isolates. 196

The MLST grouping of E. coli was determined by analyzing 8 housekeeping gene 197 sequences (adk, fumC, gyrB, icd, mdh, purA, and recA) on the MLST database Web site 198

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

12

(http://mlst.warwick.ac.uk/mlst/dbs/Ecoli) (27). The eBURST (http://eburst.mlst.net/) 199 algorithm was used to determine the clonal complexes of sequence types (STs) and 200 sequence-type complexes (STCs), where STs sharing at least 5 loci in common with at 201 least one other member of the group were assigned to define STCs; STs with the highest 202 number of single-locus variants (SLVs) were assigned as the founder. In addition, 203 blaCTX-M of all ESBL-producing E. coli isolates was investigated. The CTX-M Groups 1, 204 2, 8, and 9, as well as SHV and TEM were detected by performing multiplex PCR with 205 specific primers, as shown in Table 1 (27, 28). Specific PCR reactions were performed to 206 detect CTX-M-14 and CTX-M-15 by employing the methods by Sidjabat et al. and Chia et 207 al. (26, 27). 208

Statistical analysis 209 All statistical analyses were performed using the Statistical Package for Social 210 Sciences (version 22.0) software package for Windows (SPSS Inc., Chicago, IL, USA). 211 Data concerning patients with ESBL-producing and nonESBL-producing E. coli were 212 expressed as percentages of each subgroup of patients, and were compared by conducting 213 the χ2 test for categorical variables. 214

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

13

RESULTS 215 Identification of ESBL-producing E. coli in river water 216 The ESBL-producing E. coli accounted for 186 (30%) of the 621 E. coli strains 217

isolated from 280 river samples in Southern Taiwan over the 7-month study period. All 218 621 E. coli isolates were screened for the O25b serotype through PCR assay. Serotype 219 O25b accounted for 46 (7.4%) of the 621 isolates (Table 2). Although this serotype was 220 more frequently observed among the ESBL-producing E. coli than among the 221 nonESBL-producing E. coli [12/186 (6.5%) vs 34/435 (2.8%)], the difference was 222 statistically nonsignificant (P = 0.55). 223 As shown in Table 3, among the 12 ESBL-producing E. coli isolates belonging to 224 the O25b serotype, 4 strains carried genes encoding for CTX-M ESBLs, including 2 225 carrying the CTX-M Group 2 gene, one carrying CTX-M Group 9 gene, and one carrying 226 the CTX-M (3, 15) gene. Among the 186 ESBL-producing E. coli isolates, 18 carried the 227 CTX-M Group 1 gene, 3 carried the CTX-M Group 2 gene, 6 carried the CTX-M Group 8 228 gene, and 43 carried the CTX-M Group 9 gene. 229

Among the 24 ESBL-producing E. coli isolates and 68 nonESBL-producing E. coli 230 isolates selected for MLST analysis, the sequence types were identified for 83 isolates. 231 Genetic relatedness within each clonal complex is shown in Figure 3 [based on data from 232

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

14

the MLST database (29)]. Among the 83 E. coli isolates, the eBURST diagram revealed 233 that the clustering of E. coli STs belonged to 6 main complexes (A: STC10, B: STC58, C: 234 STC46, D: STC4623, E: STC641, and F: STC336); 15 isolates belonged to the ST10 235 clonal complex, and 18 belonged to the ST58 clonal complex (including 7 ST58 strains 236 and 5 ST155 strains). No ST131 clonal complex was detected among all 92 E. coli 237 isolates. 238

Among the identifiable 83 isolates detected from MLST analysis, 7 isolates 239 belonged to the ST10 or ST18 clonal complex in the ESBL-producing group, and 26 240 isolates belonged to the ST10 or ST58 clonal complex in the nonESBL-producing group. 241

Relationship between water river samples and evaluated parameters 242 The geographic distribution of the proportion of ESBL-producing E. coli in relation 243

to the number of chicken farming and RPI in Southern Taiwan is displayed in Figure 4. 244 As shown in Table 4, no significant differences in the proportion of ESBL-producing E. 245 coli were observed among the seasons, stream site, population, and the number of pigs. 246 The proportion of ESBL-producing E. coli was significantly higher in the low-RPI group 247 (P = 0.025). In addition, the proportion of ESBL-producing E. coli was significantly 248 higher in regions with a large number of chicken farming (P = 0.013). No significant 249 difference was observed in the proportion of the ST10 or ST58 clonal complex between 250

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

15

the high- and low-density chicken farming areas (P = 0.67). 251

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

16

DISCUSSION 252 Several studies have been conducted on the isolation of ESBL-producing E. coli 253

from river water (13–15). The difference in the abundance of human and animal 254 ESBL-producing E. coli clones in various river waters may be related to the nature of 255 their drainage basins, the intensity of antibiotic use, and the relative amount of fecal 256 contamination from humans and farm animals. Clonal groups similar to those found in 257 human infections have been isolated from contaminated rivers adjacent to large cities 258 (13–15). By contrast, nonhuman clonal groups are more frequently isolated from rural 259 streams (30–32). The isolation rate of ESBL-producing E. coli was approximately 30% in 260 our study, indicating their high numbers in environmental water. Zurfluh et al. reported an 261 isolation rate of 36.2% for ESBL-producing E. coli from a river and lake water in 262 Switzerland. (15) In a Chinese study, an isolation rate of 14.8% was reported for 263 ESBL-producing E. coli from downstream water (33). However, research investigating 264 river water as a potential reservoir of ESBL-producing E. coli is limited. 265

In our previous study, we observed that most ESBL-producing clinical E. coli 266 isolated from infants belonged to CTX-M-14 in either ST131 or nonST131 clones (10). 267 In the current study, the most predominant clones observed were ST10 and ST58 clonal 268 complexes. These ESBL-producing clones are associated with chickens, and are 269

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

17

unrelated to those found in human infections. 270 Colomer-Lluch et al. isolated quinolone-resistant E. coli belonging to the clonal 271

groups O25b-H4 B2-ST131 and O25b:H4-D-ST69 from raw sewage and river water in 272 Spain (13). By contrast, Dhanji et al. did not detect CTX-M-15, the most common 273 ESBL-encoding gene in clinical E. coli in the United Kingdom, in the Thames in London 274 (14, 34). Geser et al. (35) identified CTX-M-1ESBL-encoding genes in 275 Enterobacteriaceae isolates from food producing animals in Switzerland. However, the 276 predominant ESBL-producing clinical isolates in Switzerland belonged to CTX-M-15 277 (36). 278

As shown in Table 5, various ESBL-producing E. coli clones have been isolated 279 from animals; ST131 clones have not been detected in certain studies (30, 32, 37–46). 280 The ST10, ST58, and ST155 clones have been detected in animals, water, and human 281 isolates in the Netherlands, Canada, Chile, and China (30, 32, 37, 40–47). We detected 282 numerous ST10 or ST58 clonal complexes in high-density chicken farming areas. 283 Additional studies are warranted to elucidate the virulence potential of E. coli ST10 and 284 ST58 clonal groups. 285

We observed a significant association of ESBL-producing E. coli clones isolated 286 from river water with chicken, but not with pigs (P = 0.013). This finding may be 287

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

18

explained by the shorter period and higher antibiotic usage per average body weight for 288 poultry compared with pigs. In Southern Taiwan, antibiotic usage is 10 times higher in 289 chickens than in pigs (43), although dosing is higher in pigs (44). According to the 290 Annual Report of Food and Drug Research of 2014 released by the Food and Drug 291 Administration, Taiwan, antibiotic residues were detected with greater frequency in 292 chicken meat than in pig meat (48). In addition, a significant difference was observed in 293 the proportion of ESBL-producing E. coli among different RPIs in our series (P = 0.025); 294 this difference may be due to chicken farms being located mostly in suburban areas, 295 where the river water is less polluted. The relationship between resistant bacteria and the 296 RPI remains controversial. Multidrug-resistant bacteria in rivers may have developed 297 because of the deterioration of the water quality resulting from the flow of untreated 298 sewage from domestic wastewater or intensive agricultural and industrial activities (49). 299 However, the detection of multidrug-resistant bacteria in chlorinated water has also been 300 reported (50, 51). 301 Our study has several limitations. Data from Southern Taiwan may be inapplicable to 302 other countries because of the geographic diversity of E. coli strains and their variable 303 virulence and resistance genes. For example, ESBL-producing E. coli strains expressing 304 CTX-M-14 are prevalent in Taiwan, whereas those expressing CTX-M-15 are more 305

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

19

common in other parts of the world (11). Although we selected sample stations based on 306 the surveillance data by the TEPA, water samples may not be independent because certain 307 stations are located on the same river; however, the distribution of sampling stations is 308 essential for the analysis of regional characteristics. Furthermore, the replication of E. 309 coli in a single water sample is possible. We did not isolate the DNA of all E. coli strains 310 as has been conducted in previous studies; therefore, it is difficult to evaluate the 311 replication (13, 15). Moreover, we did not detect ESBL-associated genes, including 312 CTX-M, SHV, and TEM, from certain ESBL-producing E. coli isolates in our study. We 313 attribute this finding to the difference between the genes identified through PCR assay 314 and the design of CHROMagarTM ESBL plates or other ESBL-associated genes, such as 315 OXA, which we did not detect. In addition, we did not detect several resistant genes 316 reported in other studies; for instance, CMY-2 may contribute to cefotaxime resistance. In 317 an Asian surveillance study on ESBL-producing Enterobacteriaceae isolates reported a 318 higher prevalence of AmpC CMY-type β-lactamases, particularly CMY-2, in Taiwan (52). 319 Additional epidemiological studies are required to correlate river water, animal contact, 320 poultry consumption, and other environmental exposures with the emergence of 321 ESBL-producing E. coli. 322

In conclusion, this is the first study to investigate ESBL-producing E. coli in various 323

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

20

river waters in Southern Taiwan. We isolated several ESBL-producing E. coli clones 324 found in poultry and other farm animals, but not the O25b-ST131 clone, which causes 325 human infections. These environmental ESBL-producing clones can potentially spread 326 among humans, rendering treatment difficult. The continued surveillance of food and 327 environment is essential to anticipate emerging infections. 328

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

21

Funding information 329 This work was supported by the Ministry of Science and Technology, Taiwan, 330 R.O.C., under grant MOST 104-2314-B-075B-003-MY3. The funders did not play any 331 role in the study design, data collection and interpretation, or the decision to submit the 332 study for publication. 333

334 Acknowledgments 335

The authors thank Professor Calvin M. Kunin for his review of the manuscript. The 336 authors have no conflicts of interest to disclose. 337

338 339 340 341 342

343 344

345 346

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

22

REFERENCES 347 1. Coque TM, Novais A, Carattoli A, Poirel L, Pitout J, Peixe L, Baquero F, 348

Canton R, Nordmann P. 2008. Dissemination of clonally related Escherichia 349 coli strains expressing extended-spectrum beta-lactamase CTX-M-15. 350 Emerging infectious diseases 14:195-200. 351

2. Johnson JR, Menard M, Johnston B, Kuskowski MA, Nichol K, Zhanel GG. 352 2009. Epidemic clonal groups of Escherichia coli as a cause of 353 antimicrobial-resistant urinary tract infections in Canada, 2002 to 2004. 354 Antimicrobial agents and chemotherapy 53:2733-2739. 355

3. Lau SH, Kaufmann ME, Livermore DM, Woodford N, Willshaw GA, 356 Cheasty T, Stamper K, Reddy S, Cheesbrough J, Bolton FJ, Fox AJ, Upton M. 357 2008. UK epidemic Escherichia coli strains A-E, with CTX-M-15 358 beta-lactamase, all belong to the international O25:H4-ST131 clone. The 359 Journal of antimicrobial chemotherapy 62:1241-1244. 360

4. Nicolas-Chanoine MH, Blanco J, Leflon-Guibout V, Demarty R, Alonso MP, 361 Canica MM, Park YJ, Lavigne JP, Pitout J, Johnson JR. 2008. 362 Intercontinental emergence of Escherichia coli clone O25:H4-ST131 363 producing CTX-M-15. The Journal of antimicrobial chemotherapy 364

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

23

61:273-281. 365 5. Peirano G, Pitout JD. 2010. Molecular epidemiology of Escherichia coli 366

producing CTX-M beta-lactamases: the worldwide emergence of clone ST131 367 O25:H4. International journal of antimicrobial agents 35:316-321. 368

6. Platell JL, Cobbold RN, Johnson JR, Heisig A, Heisig P, Clabots C, 369 Kuskowski MA, Trott DJ. 2011. Commonality among 370 fluoroquinolone-resistant sequence type ST131 extraintestinal Escherichia 371 coli isolates from humans and companion animals in Australia. Antimicrobial 372 agents and chemotherapy 55:3782-3787. 373

7. Rogers BA, Sidjabat HE, Paterson DL. 2011. Escherichia coli O25b-ST131: a 374 pandemic, multiresistant, community-associated strain. The Journal of 375 antimicrobial chemotherapy 66:1-14. 376

8. Oteo J, Perez-Vazquez M, Campos J. 2010. Extended-spectrum 377 [beta]-lactamase producing Escherichia coli: changing epidemiology and 378 clinical impact. Curr Opin Infect Dis 23:320-326. 379

9. Johnson JR, Johnston B, Clabots C, Kuskowski MA, Castanheira M. 2010. 380 Escherichia coli sequence type ST131 as the major cause of serious 381 multidrug-resistant E. coli infections in the United States. Clinical infectious 382

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

24

diseases : an official publication of the Infectious Diseases Society of America 383 51:286-294. 384

10. Cheng MF, Chen WL, Hung WY, Huang IF, Chiou YH, Chen YS, Lee SS, Hung 385 CH, Wang JL. 2015. Emergence of Extended 386 Spectrum-beta-Lactamase-Producing Escherichia coli O25b-ST131: A Major 387 Community-Acquired Uropathogen in Infants. The Pediatric infectious 388 disease journal 34:469-475. 389

11. Chung HC, Lai CH, Lin JN, Huang CK, Liang SH, Chen WF, Shih YC, Lin HH, 390 Wang JL. 2012. Bacteremia caused by 391 extended-spectrum-beta-lactamase-producing Escherichia coli sequence type 392 ST131 and non-ST131 clones: comparison of demographic data, clinical 393 features, and mortality. Antimicrobial agents and chemotherapy 56:618-622. 394

12. Wu YH, Cheng MF, Lai CH, Lin HH, Hung CH, Wang JL. 2014. The role of 395 Sequence Type (ST) 131 in adult community-onset non-ESBL-producing 396 Escherichia coli bacteraemia. BMC infectious diseases 14:579. 397

13. Colomer-Lluch M, Mora A, Lopez C, Mamani R, Dahbi G, Marzoa J, 398 Herrera A, Viso S, Blanco JE, Blanco M, Alonso MP, Jofre J, Muniesa M, 399 Blanco J. 2013. Detection of quinolone-resistant Escherichia coli isolates 400

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

25

belonging to clonal groups O25b:H4-B2-ST131 and O25b:H4-D-ST69 in raw 401 sewage and river water in Barcelona, Spain. The Journal of antimicrobial 402 chemotherapy 68:758-765. 403

14. Dhanji H, Murphy NM, Akhigbe C, Doumith M, Hope R, Livermore DM, 404 Woodford N. 2011. Isolation of fluoroquinolone-resistant O25b:H4-ST131 405 Escherichia coli with CTX-M-14 extended-spectrum beta-lactamase from UK 406 river water. The Journal of antimicrobial chemotherapy 66:512-516. 407

15. Zurfluh K, Hachler H, Nuesch-Inderbinen M, Stephan R. 2013. 408 Characteristics of extended-spectrum beta-lactamase- and 409 carbapenemase-producing Enterobacteriaceae Isolates from rivers and lakes 410 in Switzerland. Applied and environmental microbiology 79:3021-3026. 411

16. 2000. Waterborne outbreak of gastroenteritis associated with a 412 contaminated municipal water supply, Walkerton, Ontario, May-June 2000. 413 Canada communicable disease report = Releve des maladies transmissibles 414 au Canada 26:170-173. 415

17. Hoxie NJ, Davis JP, Vergeront JM, Nashold RD, Blair KA. 1997. 416 Cryptosporidiosis-associated mortality following a massive waterborne 417 outbreak in Milwaukee, Wisconsin. American journal of public health 418

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

26

87:2032-2035. 419 18. Steele M, Odumeru J. 2004. Irrigation water as source of foodborne 420

pathogens on fruit and vegetables. Journal of food protection 67:2839-2849. 421 19. Center for Produce Safety . [(accessed on 10 February 2015)]. Agricultural 422

Water. Center for Produce Safety Five Year Research Review. Version 1.1. 423 Available online: 424 http://www.pma.com/~/media/pma-files/food-safety/cps/cps-research-re425 portag-water-200813version-11final.pdf. 426

20. standard operating procedures of sampling water of river, lake, and resorvir, 427 No. NIEA W104.51C [in chinese]. 428

21. Anonymous 2015, posting date. Taiwan Central Weather Bureau. [(accessed 429 on 02 August 2015)]. Available online: 430 http://www.cwb.gov.tw/V7/climate/monthlyMean/Taiwan_tx.htm. [Online.] 431

22. Liou SM, Lo SL, Wang SH. 2004. A generalized water quality index for 432 Taiwan. Environ Monit Assess 96:35-52. 433

23. Alonso JL, Soriano A, Carbajo O, Amoros I, Garelick H. 1999. Comparison 434 and recovery of Escherichia coli and thermotolerant coliforms in water with a 435 chromogenic medium incubated at 41 and 44.5 degrees C. Applied and 436

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

27

environmental microbiology 65:3746-3749. 437 24. Clermont O, Dhanji H, Upton M, Gibreel T, Fox A, Boyd D, Mulvey MR, 438

Nordmann P, Ruppe E, Sarthou JL, Frank T, Vimont S, Arlet G, Branger C, 439 Woodford N, Denamur E. 2009. Rapid detection of the O25b-ST131 clone of 440 Escherichia coli encompassing the CTX-M-15-producing strains. The Journal 441 of antimicrobial chemotherapy 64:274-277. 442

25. Clermont O, Lavollay M, Vimont S, Deschamps C, Forestier C, Branger C, 443 Denamur E, Arlet G. 2008. The CTX-M-15-producing Escherichia coli 444 diffusing clone belongs to a highly virulent B2 phylogenetic subgroup. The 445 Journal of antimicrobial chemotherapy 61:1024-1028. 446

26. Sidjabat HE, Paterson DL, Adams-Haduch JM, Ewan L, Pasculle AW, Muto 447 CA, Tian GB, Doi Y. 2009. Molecular epidemiology of CTX-M-producing 448 Escherichia coli isolates at a tertiary medical center in western Pennsylvania. 449 Antimicrobial agents and chemotherapy 53:4733-4739. 450

27. Chia JH, Chu C, Su LH, Chiu CH, Kuo AJ, Sun CF, Wu TL. 2005. Development 451 of a multiplex PCR and SHV melting-curve mutation detection system for 452 detection of some SHV and CTX-M beta-lactamases of Escherichia coli, 453 Klebsiella pneumoniae, and Enterobacter cloacae in Taiwan. Journal of clinical 454

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

28

microbiology 43:4486-4491. 455 28. Dallenne C, Da Costa A, Decre D, Favier C, Arlet G. 2010. Development of a 456

set of multiplex PCR assays for the detection of genes encoding important 457 beta-lactamases in Enterobacteriaceae. The Journal of antimicrobial 458 chemotherapy 65:490-495. 459

29. http://mlst.warwick.ac.uk/mlst/, accessed 08 August 2015. 460 30. Rashid M, Rakib MM, Hasan B. 2015. Antimicrobial-resistant and 461

ESBL-producing Escherichia coli in different ecological niches in Bangladesh. 462 Infection ecology & epidemiology 5:26712. 463

31. Zhang H, Zhou Y, Guo S, Chang W. 2015. Multidrug resistance found in 464 extended-spectrum beta-lactamase-producing Enterobacteriaceae from rural 465 water reservoirs in Guantao, China. Frontiers in microbiology 6:267. 466

32. Hernandez J, Johansson A, Stedt J, Bengtsson S, Porczak A, Granholm S, 467 Gonzalez-Acuna D, Olsen B, Bonnedahl J, Drobni M. 2013. 468 Characterization and comparison of extended-spectrum beta-lactamase 469 (ESBL) resistance genotypes and population structure of Escherichia coli 470 isolated from Franklin's gulls (Leucophaeus pipixcan) and humans in Chile. 471 PloS one 8:e76150. 472

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

29

33. Gao L, Hu J, Zhang X, Ma R, Gao J, Li S, Zhao M, Miao Z, Chai T. 2014. 473 Dissemination of ESBL-producing Escherichia coli of chicken origin to the 474 nearby river water. J Mol Microbiol Biotechnol 24:279-285. 475

34. Woodford N, Ward ME, Kaufmann ME, Turton J, Fagan EJ, James D, 476 Johnson AP, Pike R, Warner M, Cheasty T, Pearson A, Harry S, Leach JB, 477 Loughrey A, Lowes JA, Warren RE, Livermore DM. 2004. Community and 478 hospital spread of Escherichia coli producing CTX-M extended-spectrum 479 beta-lactamases in the UK. The Journal of antimicrobial chemotherapy 480 54:735-743. 481

35. Geser N, Stephan R, Hachler H. 2012. Occurrence and characteristics of 482 extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae in 483 food producing animals, minced meat and raw milk. BMC veterinary research 484 8:21. 485

36. Geser N, Stephan R, Korczak BM, Beutin L, Hachler H. 2012. Molecular 486 identification of extended-spectrum-beta-lactamase genes from 487 Enterobacteriaceae isolated from healthy human carriers in Switzerland. 488 Antimicrobial agents and chemotherapy 56:1609-1612. 489

37. Overdevest I, Willemsen I, Rijnsburger M, Eustace A, Xu L, Hawkey P, 490

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

30

Heck M, Savelkoul P, Vandenbroucke-Grauls C, van der Zwaluw K, 491 Huijsdens X, Kluytmans J. 2011. Extended-spectrum beta-lactamase genes 492 of Escherichia coli in chicken meat and humans, The Netherlands. Emerging 493 infectious diseases 17:1216-1222. 494

38. Ma J, Liu JH, Lv L, Zong Z, Sun Y, Zheng H, Chen Z, Zeng ZL. 2012. 495 Characterization of extended-spectrum beta-lactamase genes found among 496 Escherichia coli isolates from duck and environmental samples obtained on a 497 duck farm. Applied and environmental microbiology 78:3668-3673. 498

39. Dierikx C, van der Goot J, Fabri T, van Essen-Zandbergen A, Smith H, 499 Mevius D. 2013. Extended-spectrum-beta-lactamase- and 500 AmpC-beta-lactamase-producing Escherichia coli in Dutch broilers and 501 broiler farmers. The Journal of antimicrobial chemotherapy 68:60-67. 502

40. Bergeron CR, Prussing C, Boerlin P, Daignault D, Dutil L, Reid-Smith RJ, 503 Zhanel GG, Manges AR. 2012. Chicken as reservoir for extraintestinal 504 pathogenic Escherichia coli in humans, Canada. Emerging infectious diseases 505 18:415-421. 506

41. Blaak H, Hamidjaja RA, van Hoek AH, de Heer L, de Roda Husman AM, 507 Schets FM. 2014. Detection of extended-spectrum beta-lactamase 508

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

31

(ESBL)-producing Escherichia coli on flies at poultry farms. Applied and 509 environmental microbiology 80:239-246. 510

42. Cortes P, Blanc V, Mora A, Dahbi G, Blanco JE, Blanco M, Lopez C, Andreu 511 A, Navarro F, Alonso MP, Bou G, Blanco J, Llagostera M. 2010. Isolation and 512 characterization of potentially pathogenic antimicrobial-resistant Escherichia 513 coli strains from chicken and pig farms in Spain. Applied and environmental 514 microbiology 76:2799-2805. 515

43. Leverstein-van Hall MA, Dierikx CM, Cohen Stuart J, Voets GM, van den 516 Munckhof MP, van Essen-Zandbergen A, Platteel T, Fluit AC, van de 517 Sande-Bruinsma N, Scharinga J, Bonten MJ, Mevius DJ, National Esg. 518 2011. Dutch patients, retail chicken meat and poultry share the same ESBL 519 genes, plasmids and strains. Clinical microbiology and infection : the official 520 publication of the European Society of Clinical Microbiology and Infectious 521 Diseases 17:873-880. 522

44. Hu YY, Cai JC, Zhou HW, Chi D, Zhang XF, Chen WL, Zhang R, Chen GX. 523 2013. Molecular typing of CTX-M-producing escherichia coli isolates from 524 environmental water, swine feces, specimens from healthy humans, and 525 human patients. Applied and environmental microbiology 79:5988-5996. 526

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

32

45. Ding Y, Tang X, Lu P, Wu B, Xu Z, Liu W, Zhang R, Bei W, Chen H, Tan C. 527 2012. Clonal analysis and virulent traits of pathogenic extraintestinal 528 Escherichia coli isolates from swine in China. BMC veterinary research 8:140. 529

46. Borjesson S, Bengtsson B, Jernberg C, Englund S. 2013. Spread of 530 extended-spectrum beta-lactamase producing Escherichia coli isolates in 531 Swedish broilers mediated by an incl plasmid carrying bla(CTX-M-1). Acta 532 veterinaria Scandinavica 55:3. 533

47. Peirano G, van der Bij AK, Gregson DB, Pitout JD. 2012. Molecular 534 epidemiology over an 11-year period (2000 to 2010) of extended-spectrum 535 beta-lactamase-producing Escherichia coli causing bacteremia in a 536 centralized Canadian region. Journal of clinical microbiology 50:294-299. 537

48. 2013 annual report of drug residuals in animal product, 2014. [in Chinese]. 538 49. Al-Badaii F, Shuhaimi-Othman M. 2015. Water Pollution and its Impact on 539

the Prevalence of Antibiotic-Resistant E. coli and Total Coliform Bacteria: A 540 Study of the Semenyih River, Peninsular Malaysia. Water Qual Expo Health 541 7:319-330. 542

50. Huang JJ, Hu HY, Tang F, Li Y, Lu SQ, Lu Y. 2011. Inactivation and 543 reactivation of antibiotic-resistant bacteria by chlorination in secondary 544

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

33

effluents of a municipal wastewater treatment plant. Water Res 545 45:2775-2781. 546

51. Murray GE, Tobin RS, Junkins B, Kushner DJ. 1984. Effect of chlorination 547 on antibiotic resistance profiles of sewage-related bacteria. Applied and 548 environmental microbiology 48:73-77. 549

52. Sheng WH, Badal RE, Hsueh PR, Program S. 2013. Distribution of 550 extended-spectrum beta-lactamases, AmpC beta-lactamases, and 551 carbapenemases among Enterobacteriaceae isolates causing intra-abdominal 552 infections in the Asia-Pacific region: results of the study for Monitoring 553 Antimicrobial Resistance Trends (SMART). Antimicrobial agents and 554 chemotherapy 57:2981-2988. 555

556

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

34

LEGENDS 557 Table 1 O25b CTX-M group-specific primers used for multiplex PCR. 558 559 Table 2 Number of O25b and nonO25b serotypes in ESBL-producing E. coli (n = 186) 560 and nonESBL-producing E. coli (n = 435) from the 621 E. coli strains isolated from river 561 waters in Southern Taiwan. 562 563 Table 3 Number of CTX-M Group 1, Group 2, Group 8, and Group 9 as well as SHV 564 and TEM genes detected in O25b ESBL-producing E. coli (n = 12) and nonO25b 565 ESBL-producing E. coli (n = 174) from 186 ESBL-producing E. coli strains isolated from 566 river waters in Southern Taiwan. 567 568 Table 4 Characteristics of ESBL-producing and nonESBL-producing E. coli of the 621 E. 569 coli strains isolated from river waters in Southern Taiwan. 570 571 572 Table 5 Summary of 13 major animal or human E. coli sequence-type studies after 2000. 573 574 FIG 1 Study area in Southern Taiwan including the Puzi, Bazhang, Jihsui, Tsengwen, 575

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

35

Yanshui, Linbian, Donggang, Fenggang, Fangshan, Gaoping, Erren, and Agongdian 576 Rivers and the Shihchung, Paoli, and Gangkou streams, with 40 river sampling points. 577 578 FIG 2 Sample selection for detecting the sequence type of E. coli from river waters in 579 Southern Taiwan. 580 581 FIG 3 An eBURST diagram showing the clustering of E. coli STs belonging to the 6 582 main complexes [A: clonal complex of sequence type 10 (STC10, n = 15), B: STC58 (n = 583 18), C: STC46 (n = 11), D: STC4623 (n = 4), E: STC641 (n = 9), and F: STC336 (n = 4)] 584 isolated from river waters in Southern Taiwan. The E. coli strains from the same ancestor 585 based on the entire MLST data were grouped and are indicated with black circles. Each 586 ST is represented as a node. Single-locus variants (SLV) are connected with a purple line, 587 and double-locus variants (DLV) are connected with a blue line. Strains that shared 5 of 588 the 7 alleles were grouped into a single clonal complex. 589 590 FIG 4 Geographic distribution of the proportion of ESBL-producing E. coli in relation to 591 the number of chicken farming and river pollution index (RPI) in Southern Taiwan. The 592 background of the map with the color gradient presents the number of chicken farming in 593

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

36

each country; the dots with a size display the proportion of ESBL-producing E. coli in 594 each sampling point, and the color of the dots represents the RPI. 595 596

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 1 O25b CTX-M group-specific primers used for multiplex PCR.

PCR name Primer name Sequence (50 – 30 ) Reference

Multiplex )) CTX-M group , group and group

MultiCTXMGp _for MultiCTXMGp - _rev MultiCTXMGp _for MultiCTXMGp - _rev MultiCTXMGp _for MultiCTXMGp _rev

TTAGGAARTGTGCCGCTGYAa CGATATCGTTGGTGGTRCCATa CGTTAACGGCACGATGAC CGATATCGTTGGTGGTRCCATa TCAAGCCTGCCGATCTGGT TGATTCTCGCCGCTGAAG

CTX-M group /

CTX-Mg / _for CTX-Mg / _rev AACRCRCAGACGCTCTACa TCGAGCCGGAASGTGTYATa CTX-M- CTX- F CTX- R TACCGCAGATAATACGCAGGTG CAGCGTAGGTTCAGTGCGATCC CTX-M- CTX-M- -SF CTX-M- -SR CACACGTGGAATTTAGGGACT GCCGTCTAAGGCGATAAACA Multiplex ) TEM and S(V MultiTSO-T_for MultiTSO-T_rev CATTTCCGTGTCGCCCTTATTC CGTTCATCCATAGTTGCCTGAC Multiplex PCR S(V-F S(V-R AACGGAACTGAATGAGGCGCT

TCCACCATCCACTGCAGCAGCT a Y = T or C; R = A or G; S = G or C; and D = A or G or T

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 2 Number of O25b and non-O25b serotypes in ESBL-producing E. coli (n = 186)

and nonESBL-producing E. coli (n = 435) from the 621 E. coli strains isolated from river

waters in Southern Taiwan.

ESBLa E. coli (n=186)

Non-ESBLa E. coli

(n=435) Total

O25b 12 34 46 non-O25b 174 401 575 Total 186 435 621

a ESBL, extended-spectrum β-lactamase

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 3 Number of CTX-M Group 1, Group 2, Group 8, and Group 9 as well as SHV

and TEM genes detected in O25b ESBL-producing E. coli (n = 12) and nonO25b

ESBL-producing E. coli (n = 174) from 186 ESBL-producing E. coli strains isolated from

river waters in Southern Taiwan.

O25b ESBLa E.

coli (n=12)

Non-O25b ESBLa E. coli (n=174)

Total

CTX-M group 1 CTX-M group 2 CTX-M group 8 CTX-M group 9 SHV TEM

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 4 Characteristics of ESBL-producing and nonESBL-producing E. coli of the 621 E.

coli strains isolated from river waters in Southern Taiwan.

No. (%) of isolates

Characteristics Non-ESBL (n=435) ESBL (n=186) p value

Seasona 0.80

dry(2~4) 133 (70.7) 55 (29.3)

rain(5-8) 302 (69.7) 131 (30.3)

Regionb 0.999

Upper 44 (69.8) 19 (30.2)

middle 166 (70.0) 71 (30.0)

Lower 225 (70.1) 96 (29.9)

Populationc 0.19

<137000 423 (70.5) 177 (29.5)

>137000 12 (57.1) 9 (42.9)

Chickend 0.013

<100000 131 (78.9) 35 (21.1)

100000~500000 192 (66.2) 98 (33.8)

>500000 112 (67.9) 53 (32.1)

Pige 0.55

<1000 205 (71.7) 81 (28.3)

10000~50000 124 (67.0) 61 (33.0)

>50000 106 (70.7) 44 (29.3)

RPIf 0.025

<=6 327 (67.8) 155 (32.2)

>6 108 (77.7) 31 (22.3)

aSeason: Dry season is defined from February to April and wet season from May to

August.

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

bRegion: Water collected in the region is classified as upper, middle, and lower stream by

the distance of the sampled station to the river origin.

cPopulation: Classified by the density of population in the sampled station.

dChicken: Classified by the number of chicken farming in the region of sampled station

in a month.

ePig: Classified by the number of pig farming in the region of sampled station in a month.

fRPI: River Pollution Index, calculated by the average of the concentrations of four

parameters in water: Dissolved Oxygen (DO), Biochemical Oxygen Demand (BOD5),

Suspended Solids (SS) and Ammonia Nitrogen (NH3-N).

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

Table 5 Summary of 13 major animal or human E. coli sequence-type studies conducted after 2000.

Author Year Country Sample origin (No.) Most common Serotype (%) Dominant

ST ST131 (No.)

ST10 (No.)

ST58/ ST155 (No.)

Reference

Overdevest et al. Netherland Meat of Chicken , Beef , pork , mixed meat , other meat Chicken CTX-M- / . % , all other meat CTX-M- / . % ST , ST Not found Found ST Ma et al. China Duck feces , Water CTX-M- / / / / . %/ %/ . %/ . %, . % NA NA NA NA Dierikx et al. Denmark broiler feces , farmer’s feces CTX-M- , CMY- , S(V- ST Not found Not found Not found Rashid et al. Bangladesh OBSa feces , water CTX-M- % ST Not found ST CC Not found (ernandez et al. Chie Gull feces , human feces CTX-M group . % ST Not found ST ST ST Bergeron et al. - Canada (uman urine , meat of chicken , beef , pork , animal feces NA ST , ST Not found ST Not found Blaak et al. Dutch Flies , poultry manure in broiler farm , laying-hen farm S(V- , CTX-M- , TEM- ST , ST Not found ST ST , ST , Cortes et al. Spain Farm floor of Poultry and pig Poultry: CTX-M- group . % , CTX-M- group . % Pig: CTX-M- group . % ST , ST ST ST ST Peirano et al. - Canada (uman blood CTX-M- : % , CTX-M- : % ST ST ST CC Not found Leverstein-van (all et al. - Dutch chicken meat , floor of poultry farm , (uman Poultry: CTX-M- % chicken meat: CTX-M- % (uman: CTX-M- % ST , ST Not found (uman , Meat (uman: ST (u et al. - China Swine feces , water , human urine,

blood, sputum, and body secretion CTX-M- group , CTX-M- ST , CC ST CC NA Ding et al. - China Pig tissue NA CC Not found CC CC Borjesson et al. Sweden Broiler feces CTX-M- ST Not found Not found ST a OBS, Open Bill Stork (Anastomus oscitans)

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from

on February 16, 2018 by guest

http://aem.asm

.org/D

ownloaded from