SURP Final Paper [Final] DW

download SURP Final Paper [Final] DW

of 15

  • date post

    20-Jan-2017
  • Category

    Documents

  • view

    27
  • download

    2

Embed Size (px)

Transcript of SURP Final Paper [Final] DW

Wilkes 3

Regulation of synaptic BACE1 trafficking and A generation through late endocytic transport

David Wilkes, Xuan Ye, Qian Cai.

AbstractCumulative evidence suggests that -amyloid (A) peptides play a key role in synaptic damage and affect memory processes early in the course of Alzheimer's disease (AD). Amyloid- (A) peptide is produced via -secretase, mainly by -site amyloid precursor protein (APP)-cleaving enzyme 1 (BACE1). BACE1 aberrantly accumulates at the distal axons and synapses in AD neurons and relies on late endocytic transport to be degraded within lysosomes in the soma. APP is primarily processed in the late endocytic pathway, but the mechanism through which BACE1 is trafficked from the synapse to the lysosome is still largely unknown. We hypothesized that snapin deficiency results in defective retrograde transport of late endosomes and causes accumulation of BACE1 at the nerve terminal, thus enhancing APP amyloidogenic processing. To test this hypothesis, synaptosomes were prepared from conditional snapin knockout mice and protein levels were assayed by Western blotting. We showed that deletion of snapin causes an abnormal accumulation of synaptic BACE1 and APP, increasing APP processing and A generation at the nerve terminal. Altogether, our study indicated that Snapin-mediated retrograde transport is important for regulating synaptic BACE1 trafficking and its cleavage of APP.BackgroundAlzheimers disease (AD) is a progressive neurodegenerative disease characterized by memory loss and impaired cognitive function. The disease begins primarily in the highly plastic neurons of the hippocampus, and then spreads to the cerebral cortex and other brain regions. The pathology of this disease is characterized by synaptic dysfunction, axonal degeneration, neuronal loss, and the formation of neurofibrillary tangles and senile plaques that are composed mostly of amyloid-beta (A) peptide. However, it has been found that the degree of cognitive impairment in AD is most correlated to the level of the soluble form of oligomeric A in neurons, and not to the amount or size of the extracellular plaques themselves (Hardy and Selkoe, 2002). A is generated through the sequential cleaving of amyloid precursor protein (APP) by a -secretase and then by a -secretase. -site amyloid precursor protein cleaving enzyme 1 (BACE1) is the prominent -secretase involved in amyloidogenesis in neurons (Huse et al., 2000; Vassar et al., 2009). The initial cleavage step involving BACE1 and APP is the rate-limiting step in A production, which occurs predominantly in late endosomes [also called multi vesicular bodies (MVBs)]. The low pH and extensive surface area within late endosomes is optimal for BACE1 activity (Vassar et al., 2009; Wu et al., 2011). BACE1 is a transmembrane aspartyl protease (Huse et al. 2000), which is endocytosed from the plasma membrane into the endocytic pathway, where it is eventually trafficked by means of retrograde transport to lysosomes for degradation (Sannerud et al., 2011). In AD brains, increased levels of BACE1, especially when colocalized with APP in the endocytic pathway (Das et al., 2013), have been directly correlated to a rise in A production (Vassar et al., 2009; Ye and Cai, 2014), as well as to a greater accumulation in acidic compartmentsprobably endosomes (Kandalepas et al., 2013). Particularly of interest, BACE1 seems to concentrate aberrantly in dystrophic neurons around amyloid plaques in APP transgenic mouse brains, which suggests an increase in synaptic APP processing. BACE1 levels increase with age and in the brains of patients with sporadic AD (Fukumoto et al., 2004). It is important to note that a rise in BACE1 levels is due to its enhanced stability and/or reduced turnover, and not by an increase in production of BACE1 (Lefort et al., 2012). Consequently, BACE1 levels potentially could be primarily controlled by modulation of late endosomal retrograde transport. Neuronal endocytosis moderates cell signaling by controlling how many receptors can actively interact at the membrane surface (Yuzaki, 2010). Endocytosis begins with budding of the membrane, which contains surface proteins (including BACE1), to form vesicles, which fuse with early endosomes. Early endosomes mature into late endosomes by a regulated inward budding process to form a multi vesicular body (late endosome), increasing membrane surface area and allowing lysosome-delivered hydrolase access (Nixon, 2005). The late endosome then fuses with a lysosome in order to degrade its protein cargo. The process by which late endosomes and its BACE1 contents migrate to and then fuse with lysosomes is still poorly understood (Ye and Cai, 2014). Upon fusion, acid hydrolases from the lysosome become active and digest late endosomal cargo (Nixon, 2005). Mature lysosomes mainly reside in the neuronal soma, far from the axon terminal (Cai et al., 2010). Therefore, late endosomes containing BACE1 depend on retrograde transport along the axonal microtubules in order to deliver their cargoes to the lysosomes for degradation in the soma (Cai et al., 2010). Retrograde transport is driven by dynein, the major microtubule-based minus-end directed motor protein in neurons. Deficits in dynein-related proteins such as dynein intermediate chain (DIC) and Snapin have been shown to disrupt late-endocytic transport and lead to excess production of A (Cai et al., 2010; Ye and Cai, 2014). Snapin is an important adaptor protein for dynein motors, as it has been found to coordinate late endocytic transport and maturation of lysosomes (Cai et al., 2010). Snapin is also thought to interact with dynein intermediate chain (DIC), which allows recruitment of dynein motors to late endocytic organelles for retrograde transport. Experiments involving snapin knockout (KO) mice or DIC substitution resulted in decreased dynein-assisted transport of BACE1 containing vesicles, and enhanced APP processing (Ye and Cai, 2014). Distal accumulation of late endosomes containing A42 has also been found in AD mouse neurons, possibly due to impaired retrograde transport of APP and BACE1, which may account for the excess production of A observed in AD neurons (Ye and Cai, 2014). In dendrites, APP and BACE1 converge mostly during the endocytic pathway, triggering amyloidogenesis (Das et al., 2013). One of the earliest symptoms in AD brains is the loss of synaptic functionality (Selkoe, 2002). The loss of synapses has been discovered to be the best predictor of cognitive impairment in AD brains (Tampellini et al., 2011). BACE1 has been found to localize in vesicles at the presynaptic terminals near active zones (Kandalepas et al., 2013). Excessive A production and release at synaptic sites are tightly correlated with increased amyloid deposition and synaptic dysfunction (Stokin and Goldstein, 2006; Takahashi et al., 2002). Considering that abnormal accumulation of BACE1 and APP at presynaptic terminals occurs before the onset of plaque (Zhang et al., 2009), intervention in the BACE1 trafficking pathway could be a reliable means for halting amyloid pathology early in AD. This raises the central question of whether enhancement of Snapin-mediated dynein motor-assisted BACE1 transport can decrease its synaptic accumulation and A generation at nerve terminals, reducing or delaying synaptic pathology in AD mouse brains. In this study, we sought to address whether disruption of retrograde transport accumulates BACE1 at the synapse, thereby enhancing amyloidogenic processing and amplifying synaptic AD pathology. Snapin KO mice will serve as a unique genetic tool that allows us to address whether snapin deficiency heightens synaptic retention of BACE1, exacerbating synaptic A generation. Materials and MethodsGenotypingPCR genotyping assay was performed to identify homozygous snapin flox mice (snapinflox/flox; Thy-1 Cre Tg) after the tissue-specific Cre was confirmed. DNA was extracted from mouse tail snips using PCR lysate reagent (Viagen). The snapin loxP site forward primer 5- GTGCAGCAGCTCGACTCTC -3 and loxP site reverse primer 5- AGCCAACCTCAACTTCAAGG 3 were used to flox the snapin gene coding region. The DNA segments were amplified by using the following PCR reaction system: 9.46l H2O, 1.25l 10X PCR Buffer, 0.25l 10mM dNTPs, 0.38l 50mM MgCl2, 0.3l 10M forward primer, 0.3l 10M reverse primer, 0.06l (5U/l) Taq Polymerase, and 0.5l tail DNA. Thirty three cycles of PCR were used with the following cycles: 94 C for 3 minutes (only first time), 94 C for 30 seconds, 55 C for 30 seconds, 72 C for 45 seconds, repeat 33 times, 72 C for 5 minutes (only last time), then keep at 16 C. By running PCR products on 2% agarose gel, homozygous snapin flox mice show a band at 275bp, while wild-type mice can be identified by a band at 188bp. Synaptosome PreparationSynaptosome preparations from WT and snapin conditional KO mouse brains (snapinflox/flox; Thy-1 Cre Tg) were collected using Percoll gradient centrifugation as described in the protocol (Leenders et al., 2004). Cortex tissue from WT and snapin mutant mice were homogenized in ice cold Isolation Buffer (IB) [10mM Tris-HCl, 1mM EGTA, 1mM EDTA, 0.25 M sucrose and protease inhibitors (Roche), pH 7.4]. Homogenates were centrifuged at 1,330 g for 3 minutes, the supernatant was gathered, and the pellet was resuspended with IB and centrifuged again at 1,330 g for 3 minutes. The first and second supernatant were combined and then centrifuged at 21,000 g for 10 minutes and then resuspended in 12 ml of 15% Percoll. 2 ml of the 15% Percoll suspension was overlaid on Percoll gradient that has 3.5 ml of 15% Percoll gradient layered over 23% Percoll gradient. The gradient was then separated by centrifugation for 5 minutes at 30,700 g. The synaptosomal fraction was collected from the 15%/23% Percoll layers, and combined with 0.5 ml of 10 mg/ml bovine serum albumin (BSA) in 3 ml IB. The