SUPPLEMENTARY INFORMATION - Nature INFORMATION DOI: ... performed according to the manufacturer’s...

SUPPLEMENTARY INFORMATIONDOI: 10.1038/NPLANTS.2015.209

NATURE PLANTS | www.nature.com/natureplants 1

Supplementary Note 1 Egg cell size in ΔBELL1

The diameter of egg cells of WT and the deletion lines ΔBELL1-2, ΔBELL1-4, and ΔBELL1-9

was measured from micrographs (Fig. 1k, Supplementary Table 1). The developmental

status of the respective archegonia was recorded as well: closed archegonia with the apical

cell still intact are not fertilized as sperms are mechanically prevented from entry. Open

archegonia with a degraded apical cell are potentially fertilized; however the likelihood was

decreased by not adding water to the plants. Moss sperms require free water in order to be

able to swim to the archegonium. No signs of zygote development, such as a wavy surface,

elongation43 or cell division occurred. From this we conclude that egg cells either were not

fertilized or if fertilized, were arrested in development. Both the size and the variance of

ΔBELL1 egg cells were increased. The mean WT egg cell (n = 9 egg cells) size was 16.61 µm

with a standard deviation of 1.14. The mean ΔBELL1 (n = 27) egg cell size was 19.32 µm

with a standard variation of 3.02, with a maximum diameter of 26.39 µm (ΔBELL1-4). A

Welch t-test yielded a P value of 0.0004 which indicates significant (P < 0.001) differences.

The volume of a sphere depends on the diameter raised to the third power. Therefore, the

biggest ΔBELL1 egg cell has four times (26.393 / 16.613) the volume of the mean WT egg cell

volume.

Supplementary Note 2 Germination of spores from apogamous sporophytes

To assess the germination rate of spores from apogamous sporophytes the content of

individual spore capsules was placed on Knop agar plates and cultivated under standard

conditions for nine days. It was not possible to distribute the spores of the BELL1oe

apogamous sporophytes evenly with forceps or in an aliquot of water as this is usually done.

Not only did the tetrads of spores not separate (Fig. 2l insert), but also the entire content of

the spore sac stuck together. After nine days the majority of spores of all ten analysed WT

http://dx.doi.org/10.1038/nplants.2015.209

2 NATURE PLANTS | www.nature.com/natureplants

SUPPLEMENTARY INFORMATION DOI: 10.1038/NPLANTS.2015.209

capsules germinated. The content of five of the six (line 7), two of the ten capsules (line 27),

and four of the six capsules (line 31) analysed did not germinate at all. The number of spores

which germinated was low in all BELL1oe lines and could not be further quantified as the

spores stuck together.

Supplementary Note 3 Ploidy of apogamous sporophytes

As the individual sporophytes did not yield enough material for nuclei measurement via flow

cytometry, the relative amounts of nuclear DNA were estimated from micrographs of DAPI-

stained nuclei according to44. This allows the determination of relative DNA amounts of

individual cells. As non-dividing cells have a fixed amount of DNA, one expects the

individual data points to fall into categories with relative values differing by factor 2. As cells

are either at G1 or G2 phase of the cell cycle, these categories are 1C, 2C and 4C.

Gametophytic cells (e.g. leaves) are haploid (1n) and either 1C when in G1 or 2C when in G2.

Correspondingly, sporophytic cells are diploid (2n) and therefore are 2C when in G1 and 4C

in G2. In addition, a proportion of plant cells undergo endoreduplication27,28. Depending on

the method used, the individual value obtained from each nucleus may be imprecise.

Therefore, we analysed many nuclei (49-73 nuclei per line). Relative DNA amounts of nuclei

were measured from WT and apogamous sporophytes and from WT leaves as a control for

haploid (1n) gametophytic cells.

Size distributions of DNA amounts were similar between WT and apogamous

sporophytes and twice the amount of the controls (haploid WT leaf cells) (Supplementary

Fig. 13). The relative values of the sporophyte nuclei ranged from 511 to 10730. The bulk of

the nuclei split into a group from about 750 to 1250 and a second group from about 1500 to

2400. We reason that the individual data points fluctuate around the “true” values resulting in

the range of values observed by us.




To find the relative (“true”) values in an unbiased way, hierarchical clustering was

performed. Analysis of all data revealed three distinct clusters of sporophytic cells

corresponding to 2C (2n, G1, 750 to 1250), 4C (2n, G2, 1500 to 2400), and a cluster of

endoreduplicated cells (>2500). Correspondingly, the gametophytic cells were in two clusters,

1C (1n, G1) and 2C (1n, G2) (Supplementary Fig. 14). Median values of these clusters were

similar in the sporophytes and twice the amount of the gametophytic cells (Supplementary

Table 3), revealing that the fully functional apogamous sporophytes are diploid.

Supplementary methods

Plant material and culture conditions

Chloronemal tissue was cultivated in liquid cultures which were disrupted weekly. Density

was adjusted to 200 mg/L dry weight. 7d after the last disruption the material was harvested

for RNA isolation. For isolation of RNA from caulonema-enriched tissue, the plants were

grown for 21d under standard conditions and then placed for 14d in the dark in a vertical

position.

The formation of aposporous protonema was induced by injuring sporophytes with

forceps. The injured sporophytes were then cultivated on solid medium and protonemata

spontaneously developed.

WT calyptrae were removed with forceps once they detached from the leafy

gametophytes carrying the developing sporophytes. On each colony about equal numbers of

calyptrae were removed from developing sporophytes or left undisturbed, respectively. After

two weeks, once the spore capsules were fully expanded, they were analysed under a

dissecting microscope. For analysis, the calyptrae of the undisturbed sporophytes were




removed to allow maximum comparability of the samples. From the acquired images the

sporophyte tips were outlined using a cursor.

Transcriptional analysis

For RT-PCR total RNA was extracted using the TRIZOL® Reagent (Life Technologies,

Carlsbad, CA, USA) and reversely-transcribed using oligo d(T)16 primers with Superscript III

reverse transcriptase (Life Technologies). Expression analysis via RT-PCR of P. patens

BELL1 was performed with gene-specific primers BELL1_3_fw

5'-GGCGATACCGATTTTGGTGC-3' and BELL1_3_rev

5'-GCCCATTGCTCATAGTTGCG-3'. The expression level of the constitutively expressed

gene coding for the 60S ribosomal protein L21 (primers C45_fw

5'-GGTTGGTCATGGGTTGCG-3' and C45_rev 5'-GAGGTCAACTGTCTCGCC-3') was

used to monitor amounts of input RNA.

For quantitative Real-Time PCR of the PpBELL genes total RNA was extracted using

the SV Total RNA Isolation System (Promega, USA) from 6 days old protonemata. The

cDNA was synthesized from 2 µg of total RNA with the SuperScript® III First-Strand

Synthesis System (Life Technologies) using oligo d(T)20 primers. The quantitative Real-

Time PCR was performed in a StepOne Thermal Cycler (Applied Biosystems, Foster City,

CA, USA) using SYBR Green to monitor dsDNA synthesis. The amount of cDNA for each

gene was quantified with a log-linear regression curve of the threshold cycle and the amount

of standard template prepared from a cDNA clone. PpBELL1 was amplified with the primers

BELL1_f 5' TGGACCATTTTGAAGGAAGG 3' and BELL1_r 5'

GCTCATAGTTGCGGAGGATT 3', PpBELL2 with BELL2_f 5'

GCCAATTGTTTGTTCAGTAGGTT 3' and BELL2_r 5' AGATGGCACAACATGACCAC

3', PpBELL3 with BELL3_f 5' CTGCCTCAACACTGAACAGAA 3' and BELL3_r 5'




AGATCTCTGGAACCGTCTGGC 3', and PpBELL4 with BELL4_f 5'

CACAACGTTGAGCATGATTTC 3' and BELL4_r 5' CAGGATGTAAAGCACTGGACCT

3'. The transcripts coding for Histone H3 (Pp1s1963_1V6.1 and Pp1s3_594V6.1) served as

control and were amplified with PpHistone3_100_f 5' GGAGGAGTGAAGAAGCCACA 3'

and PpHistone3_143_r f 5' TGCGAATCTCCCGAAGAG 3'. The transcript coding for the

TATA-binding protein was amplified with the primers TATA_qf 5'

GATCTAGCTATAAGCCTGATCTACCG 3' and TATA_qr 5'

CAGGAGCAGGGAGAGATTTG 3'. The bar chart depicts means of three technical

replicates with standard deviations as error bars.

For quantitative Real-Time PCR of the PpKNOX (MKN) genes, total RNA was

extracted with cetyltrimethylammonium bromide (CTAB) buffer containing 2% 2-

mercaptoethanol45. Contaminants were removed by two extractions with chloroform: isoamyl

alcohol (24:1). The nucleic acids were precipitated with lithium chloride at a final

concentration of 2.5 M overnight at 4 °C. After two washing steps the RNA was resuspended

in water and DNaseI (RNase-Free DNase Set, Qiagen, Hilden, Germany) treatment was

performed according to the manufacturer’s instructions. Next, the RNA was purified using the

RNeasy Plant Mini Kit (Qiagen). After column purification, a DNaseI treatment (TURBO™

DNase, Life Technologies) was performed and a sample of the RNA was run on an agarose

gel to confirm integrity. The RNA was reversely-transcribed with the TaqMan® Reverse

Transcription Reagents (Life Technologies). In order to monitor DNA contamination of the

samples, 200 ng of each DNaseI-treated RNA sample were used as a no reverse transcriptase

control by omitting the reverse transcriptase. The quantitative Real-Time PCR was performed

using the SensiMixTM SYBR No-ROX Kit (Bioline, Luckenwalde, Germany) in a

LightCycler 480II (Roche Diagnostics Deutschland GmbH, Mannheim, Germany). PpMKN2

was amplified with the primers MKN2_qf 5' CACTGGAGCTGCGAAGGTAA 3' and

MKN2_qr 5' CCGTTGGAGGTGCCATAGAA 3', PpMKN1 with MKN1_qf2 5'




GCGGCTGATTCAGGAGACA 3' and PpMKN1_qr2 5' TCCGCTTGCGTTGGTTTATG 3',

and PpMKN6 with MKN6_qf2 5' GGGGCTATGGTCCTCTTGTG 3' and MKN6_qr2 5'

CCCGCTCCATTAAACTACGC 3'. The transcripts coding for TATA-binding protein

(primers TATA_qf and TATA_qr), and 60S ribosomal Protein L21 (primers C45_qf 5'

ACGCACCGGCATCG 3' and C45_qr 5' TGCTTGTTCATCACGACACCAA 3') were used

as reference for relative quantification.

For all quantitative Real-Time PCR analyses efficiency between 1.90 and 2.09 of each

primer set was determined with a logarithmic dilution of a DNA mix. For all primer sets the

generation of specific PCR products was confirmed by melting curve analyses. Quantification

of the target relative to the abundance of the reference genes was calculated according to46.

Determination of transgene copy numbers via quantitative Real-Time PCR

Transgene copy numbers in each tested line were estimated via quantitative Real-Time PCR

according to47. Genomic DNA was isolated from chloronema cultures using the innuPREP

Plant DNA Kit (Analytic Jena AG, Jena, Germany) according to the manufacturer’s

instructions. Integrity of DNA was verified on an agarose gel. PpBELL1 was amplified using

the gene-specific primers BELL1_f and BELL1_r. The single copy gene CLF was used as a

reference for normalization with two primer sets (pPCLF_5915_qf

5'-AGCAATGTCCGTGCCTACTT-3', pPCLF_5981_qr

5'-TTGTAAGAATCACTCACCCACAG-3' and pPCLF_7739_qf

5'-GTATTGGCGATCCCACTCTT-3', pPCLF_7804_qr

5'-GCATAAAATAGGTCACAGATTGAGG-3'). The number of transgene copies was

determined by comparing relative values of the tested transgene with the relative values of the

single copy PpBELL1 gene in WT.




Flow cytometry

Flow cytometric analysis was performed according to48.

Determination of relative nuclear DNA content

The relative amount of nuclear DNA of individual nuclei was calculated from

microscopic images of 4’,6-diamidino-2-phenylindole (DAPI)-stained tissue44. Gametophores

and sporophytes were fixed in 50 % v/v ethanol, 3.7 % v/v formaldehyde and 5 % v/v acetic

acid. After replacement of the fixative with water, whole mount samples of leaves, embryos,

and spore sacks, respectively, were desiccated on polylysine-coated slides. The samples were

rehydrated in phosphate buffered saline containing 1 mg/L DAPI (Merck KGaA, Darmstadt,

Germany). Using a Nikon Eclipse 80i fluorescent microscope (Tokyo, Japan) with a 60x air

objective equipped with a Nikon DS-Vi1 CCD camera grayscale images of nuclei were

captured. All images were acquired with an exposure time of 33 ms and with the same

settings to obtain a constant background.

The nucleus was segmented using a cursor and its area and the grayscale values of the

fluorescent pixels were determined from the microscopic images using ImageJ

(http://rsbweb.nih.gov/ij/). The Integrated Optical Density (i. e. the summed up grayscale

values of each nucleus) was calculated to obtain the relative amount of DNA. Hierarchal

Clustering of the relative values was performed with the Free Statistics Software v1.1.23-r7

(http://www.wessa.net/rwasp_agglomerativehierarchicalclustering.wasp/)49.




Microscopic analysis

For the assessment of sperm viability (Supplementary Fig. 7), antheridia were placed in 100

µl tap water containing 10 µg/ml propidium iodide. Phase contrast and epifluorescent images

of the same view were captured and merged with GIMP 2.8 (http://www.gimp.org/).

Movies of WT and ΔPpBELL1 were composed from time series of 50 micrographs obtained

at 100 ms intervals. Movies were generated utilizing ImageJ and run at 0.5x speed.

Bimolecular fluorescence complementation analysis

Protein interaction of BELL and KNOX proteins was examined by bimolecular fluorescence

complementation (BiFC) as previously described13. The coding sequences of PpMKN2,

PpMKN4, PpMKN5, PpMKN1, and PpMKN6 were amplified with the primer pairs MKN2-

SpeI-f 5'-ACTAGTATGGAGCAGCAAACCCCGTC-3', MKN2-SpeI_r

5'-ACTAGTCTACTCCAGATGACCTCTGCATT-3', and MKN4_SpeI_f

5'-ACTAGTATGGGAGGGAAGGAGGAAG-3', MKN4-SpeI_r

5'-ACTAGTTTACTGCTCCAGATAACCCTCA-3', and MKN5_SpeI_f

5'-ACTAGTATGGCCAGGTCATCGGATA-3', MKN5-SpeI_r

5'-ACTAGTCTACTCCAGATGACCATTGC-3', and MKN1_SpeI_f

5'-ACTAGTATGATGGCTTTCAACAATTTATCACATG-3', MKN1_SpeI_r

5'-ACTAGTTCACTTTTTCCGTTTGCTCTTCAGC-3', and MKN6_SpeI_f

5'-ACTAGTATGACGTTCGACAATGACTT-3', and MKN6_SpeI_r

5'-ACTAGTTTACCTCTTTCGTACTTTATTCTTCA-3'. Coding sequences of the MKNs

were cloned C-terminally of the sequence coding for the N-terminal fragment of YFP (YN)

into the SpeI site of the plasmid pSY 73650. PpBELL1 was amplified with primers containing

overlapping regions to the plasmid pSY 73550: Bell1_gib_YC_f

5'-GTTCCTGACTATGCGTCGACATATGAGCTCACTAGTATGGATTCTTCAGAGCCT




TTGC-3' and Bell1_gib_r

5'-GATTTTTGCGGACTCTAGAGGATCCAGATCTGACTAGTTCAACTGGTAACAAAC

TCATGATGA-3' for the cloning of the sequences C-terminally of the sequence coding for

the C-terminal fragment of YFP (YC). The amplified fragments and the plasmids, linearized

with SpeI, were combined in a 4:1 molecular ratio for Gibson51 assembly. 5 µl of DNA was

added to 15 µl 1.33x assembly master mixture prepared according to51, incubated at 50 °C for

60 minutes and directly used for transformation of chemically competent cells.

Agrobacterium tumefaciens strain GV3101/pMp90 containing plasmids of interest

were transiently co-expressed in N. benthamiana leaves via the leaf injection procedure50.

Image annotation was performed with a LSM 780 NLO confocal microscope (Zeiss) and

Adobe Photoshop 7.0 (Mountain View, CA). Negative controls with vectors bearing only YN

or YC alone were carried out in every experiment to verify the specificity of the interactions.

Bioinformatics methods

MUSCLE alignment52 of amino acid sequences was performed using

http://www.ebi.ac.uk/Tools/msa/muscle/.

Helical wheel projections of the SKY domains were created with

http://emboss.bioinformatics.nl/cgi-bin/emboss/pepwheel.




Supplementary Fig. 1 | Physcomitrella patens BELL proteins. MUSCLE alignment of the

predicted amino acid sequences of PpBELL1 (Pp1s258_6V6.1, retrieved from

http://cosmoss.org/), PpBELL2 (Pp1s220_67U2__horst.1), PpBELL3 (Pp1s115_128V6.1)

and PpBELL4 (Pp1s52_231V6.1) and the A. thaliana AtBEL1-like homeodomain protein 1

(AtBLH1, AT2G35940.1, retrieved from http://arabidopsis.org/). Boxes mark the typical

protein domains17,30: ZIBEL/VSLTLGL, SKY, BELL and the homeodomain.




Supplementary Fig. 2 | The fourth position of the SKY domain is not conserved in

PpBELL2. a, MUSCLE alignment of the SKY domain of BELL proteins using the predicted

amino acid sequence of BELL proteins of representative plants. Arabidopsis thaliana

sequences (AtATH1 AT4G32980.1, AtBEL1 AT5G41410.1, AtBLH1 AT2G35940.1,




AtBLH3 AT1G75410.1, AtBLH5 AT2G27220.1, AtBLH6 AT4G34610.1, AtBLH7

AT2G16400.1, AtBLH10 AT1G19700.1, AtBLH11 AT1G75430.1, AtPNF AT2G27990.1,

AtPNY (AtBLR) AT5G02030.1, AtSAW1 AT4G36870.1, AtSAW2 AT2G23760.1) were

obtained from http://www.arabidopsis.org/. Rice (Oz), poplar (Potri), and Selaginella

moellendorffii (Sm) sequences were retrieved from http://www.phytozome.net/ and are

displayed with the IDs used there. Refer to Supplementary Fig. 1 for the accessions of

Physcomitrella patens (Pp) BELL sequences. A partial sequence of a Gnetum gnemon (Gg)

BELL was obtained from https://www.ncbi.nlm.nih.gov/genbank/ (GgMELBEL1

AJ318871.1). b and c, Helical wheel projections of the SKY domains of PpBELL1 (b) and

PpBELL2 (c). The hydrophobic face is indicated as a blue arc, the hydrophilic face as a red

arc. The arrow in c points to the glutamic acid (E) residue at the fourth position of the SKY

domain of PpBELL2.




Supplementary Fig. 3 | Expression analysis via quantitative Real-Time PCR of PpBELL

genes in WT and a FIE null mutant (ΔFIE). Transcripts of PpBELL genes BELL1, BELL2,

BELL3 and BELL4 were analysed in WT and ΔFIE chloronemata samples. Bars depict means

of three technical replicates with standard errors. Signals for BELL3 and BELL4 were below

the background in all samples. The transcripts coding for Histone H3 (Pp1s1963_1V6.1 and

Pp1s3_594V6.1) were used as reference for relative quantification. The transcript coding for

the TATA-binding protein (Pp1s246_34V6.1) served to validate the accuracy of the data

analysis.




Supplementary Fig. 4 | Construction of PpBELL1:GUS and PpBELL2:GUS reporter

lines. Schematic depiction of PpBELL1 (a) and PpBELL2 (b) genomic loci on top, in the

middle the construct used for in-frame insertion of the uidA (GUS) reporter gene, and at the

bottom the modified genomic loci after integration of the construct. GUS reporter constructs

containing the GUS CDS followed by the nos terminator (uidA-nosT; blue arrow) and an hptII

selection cassette (grey arrow) are flanked by the 5' genomic region and the 3' un-translated




region of the respective genes. The PpBELL start and stop codons are indicated. Boxes and

lines represent exons and introns, respectively. (c, d) Correct integration at the genomic loci

of PpBELL1:GUS and PpBELL2:GUS reporter constructs were verified via PCR. Correct 5'

and 3' integration of the GUS CDS at the PpBELL1 genomic locus in line 16 and 21 (c).

Correct 5' and 3' integration of the GUS CDS at the PpBELL2 genomic locus in lines 12, 16,

37, 38 and 44 (d).

Supplementary Fig. 5 | GUS staining indicative for protein accumulation of

PpBELL1:GUS in line BELL1:GUS-21. Absence of GUS staining in PpBELL1:GUS

antheridia. a and b, Archegonia of line BELL1:GUS-21. Arrowhead indicates egg cell,

arrow indicates ventral canal cell. c, Early and d, late stage antheridia of line BELL1:GUS-16.

e, Early and f, late stage antheridia of line BELL1:GUS-21. g, Magnification of f, with

spermatozoids visible. Scale bars: 100 µm in a, b; and 20 µm in c-g.




Supplementary Fig. 6 | Construction of PpBELL1 null mutants. (a) Schematic

representation of PpBELL1-KO construct and its predicted integration to the genome. The

bottom line represents the endogenous genomic locus, the upper line represents the plasmid

construct, and the dotted lines point to the site at which the cassette is directed to integrate

into the endogenous locus following homologous recombination. The arrows indicate the

position of primers used to detect the 5′ and 3′ integration of the recombinant DNA,

respectively. (b) PCR verification of cassette integration at 5′ and 3′ homologous regions,

PpBELL1 absence and PpBELL2 presence. (nptII, nptII selection cassette).




Supplementary Fig. 7 | Sperms of ΔBELL1. First column: Phase contrast micrographs of

sperm masses of WT ΔBELL1-2, -4, and -9. Middle column: Epifluorescent micrographs of

propidium iodide-stained dead cells, showing that the majority WT and ΔBELL1 sperms are

viable. Last column: Merged image of the phase contrast and epifluorescent images. Scale




bars: 20 µm. The number of analysed antheridia was 9 (WT), 13 (ΔBELL1 line 2), 3 (ΔBELL1

line 4), and 11 (ΔBELL1 line 9), respectively.

Supplementary Fig. 8 | Constitutive expression of GFP driven by the Actin5 promoter

Ppact5. Bright field image of chloronemata and caulonemata (arrow) of a transgenic moss

line expressing GFP under the control of the Actin5 promoter. Epifluorescent image of the

identical sample showing fluorescence of the Green Fluorescent Protein GFP in all cells,

chloronemata as well as caulonemata. Scale bar: 50 µm.




Supplementary Fig. 9 | Analysis of PpBELL1oe lines. Expression analysis via RT-PCR of

PpBELL1 in WT, ΔFIE and overexpressor lines BELL1oe-7, -27 and -31. L21

(Pp1s107_181V6.1) coding for the 60S ribosomal protein was used to monitor amounts of

input RNA.




Supplementary Fig. 10 | Protonema, leafy shoots, and apogamous sporophytes of

PpBELL1oe lines. a-d, Chloronemata from liquid cultures 7 days after the last disruption. e-

h, Negatively gravitropic grown caulonemata after 14 days incubation in the dark. a-h,

Representative images of the samples used for quantitative Real-Time PCR of KNOX genes

(Supplementary Fig. 12). i-l, Individual leafy shoots of four-week-old plants. m, WT spore

capsule on a leafy shoot. n-p, PpBELL1oe apogamous sporophytes on caulonema filaments.

Scale bars: 200 µm in a-d; 2 mm in e-l; 500µm in m-p.




Supplementary Fig. 11 | BELL1oe apogamous sporophytes develop instead of side

branches. a, Early BELL1oe apogamous sporophyte, the first division plane (arrow) is

perpendicular to the longitudinal axis, indicative of side branch formation26. b, BELL1oe

apogamous sporophyte, the first cell (arrow) branching of the caulonema cell is filamentous.

c, BELL1oe apogamous sporophytes (box) on caulonemata at the edge of a gametophyte

colony, apart from the sporophytes only filamentous side branches are present on the

protruding filaments. No leafy gametophytes have yet developed on the protruding filaments.

d, Magnification of box in c. Scale bars: 20 µm in a; 100 µm in b, d; 1 mm in c.




Supplementary Fig. 12 | Influence of the calyptra on the WT sporophyte shape.

Calyptrae were removed from developing sporophytes as soon as they detached from the leafy

gametophyte. a, Developmental stage of WT embryos at calyptras removal. Note the presence

of significant amount of apical tissue (arrowhead). b, WT embryo (arrow) with its calyptra

removed on the intact plant. On intact plants it is impossible to judge the amount of apical

tissue already present. c, BELL1oe apogamous embryos without apical tissue. d, WT

sporophyte with calyptra. e, WT sporophyte with the calyptra removed. f, BELL1oe

apogamous sporophyte that had developed freely in the medium. g-i, Apical views of

sporophytes, developed with calyptra (g), calyptra removed (h), and BELL1oe apogamous

sporophyte (i). j, Outlines of apical tips of WT sporophytes developed with (n = 13) and

without (n = 10) calyptra. Scale bars: 200 µm.




Supplementary Fig. 13 | Relative DNA content of WT sporophyte (n = 73) cells, WT leaf

(n= 21) cells and PpBELL1oe apogamous sporophyte cells from lines 7 (n = 49), 27 (n =

60) and 31 (n = 63). Relative values were obtained by quantification of fluorescent pixels of

DAPI-stained nuclei of whole-mount tissues and were plotted in ascending order. Relative

DNA contents of WT haploid leaf cells were used as control for ploidy level. Data points

from WT haploid leaf cells were moved to the right along the x-axis for better visibility. The

analysis is described in Supplementary Note 2 (n= sample size).




Supplementary Fig. 14 | Hierarchical clustering of relative nuclear DNA amounts of WT

leaf cells, WT sporophyte cells and apogamous sporophyte cells from lines PpBELL1oe-

7, -27 and -31. Depiction of hierarchical clustering. According to their values, the clusters are

named 1nG1 (leaf cells, haploid, G1-phase), 1nG2 (leaf cells, haploid, G2-phase), 2nG1

(sporophyte cells, diploid, G1-phase, red labelling), 2nG2 (sporophyte cells, diploid, G2-




phase, blue labelling) and endoreduplication (sporophyte cells, black labelling). The analysis

is described in Supplementary Note 2.

Supplementary Fig. 15 | Ploidy measurement of protonema cells. The DNA content of

nuclei in WT protonemata (a), BELL1oe protonemata (d), and protonemata regenerated from

a regular WT sporophyte (b, c) and an apogamous BELL1oe sporophyte (e, f) was determined

by flow cytometry. The dominant peak at 200 fluorescent units represents haploid cells in the

G2 phase of the cell cycle (2C) in the original haploid protonemata (a, d). The protonemata

regenerated from sporophytes (c, f) are diploid and in G2 (4C).




Supplementary Fig. 16 | Expression analysis via quantitative Real-Time PCR of MKN

(PpKNOX) genes. Transcripts of the PpKNOX1 genes MKN2 and the PpKNOX2 genes

MKN1 and MKN6 were amplified from WT, ΔFIE and BELL1oe-7, -27, -31 plants enriched in

chloronemata or caulonemata, respectively. Bars depict averages of two biological replicates

with standard errors. The transcripts coding for TATA-binding protein (Pp1s246_34V6.1) and

60S ribosomal Protein L21 (Pp1s107_181V6.1) were used as reference for relative

quantification.




Supplementary Fig. 17 | PpBELL1 and MKN (PpKNOX) proteins interact in planta.

BiFC analysis of in planta interaction between YC-PpBELL1 and the following: a, YN-

empty serving as negative control. b-f, YN-MKN2, 4, and 5 members of the class I KNOX

family, MKN1 and 6 members of the class II KNOX family, respectively. Insert in panel e

presents a typical fluorescent image from the nucleus which is excluded from the nucleolus.

g-k, No signal is observed between YN-MKN2, 4, 5, 1, or 6 with YC serving as negative

control. Localization was determined in leaf epidermis of Nicotiana benthamiana. YFP

fluorescence from single confocal sections is overlaid with Nomarski Differential Interference

Contrast (DIC) images. Scale bars: 100 µm; 20 µm in insert in e.




Supplementary Fig. 18 | Molecular analysis of ΔFIEΔBELL1 mutant lines #10, #18 and

#167. Rows 1 and 2: PCR verification of 5′ and 3′ integration of the gene disruption cassette

in the ΔFIEΔBELL1 mutant lines. Row 3: Absence of the PpBELL1 gene in the double

mutants. Row 4: Presence of the PpBELL2 gene in the double mutants. Row 5: RT-PCR

confirming the absence of the PpBELL1 transcript in the mutant lines. Row 6: RT-PCR

confirming presence of PpL21 transcripts coding for the 60S ribosomal protein as positive

control to monitor amounts of input RNA.




Supplementary Fig. 19 | Morphology of ΔFIEΔBELL1 mutants lines -10, -18, and -167 in

comparison to WT, ΔBELL1, and ΔFIE. a-f, Chloronemata from liquid cultures 7 days

after the last disruption. g-l, Caulonemata after 14 days incubation in the dark. m, n, p-r,

Gametophyte buds in WT, ΔBELL1, and ΔFIEΔBELL1 mutants. o, Early ΔFIE sporophyte-

like structure. s, t, v-x, Individual leafy shoots of four-week-old plants. u, ΔFIE branched

sporophyte-like structure. y, z, ab-ad, Individual leaves. aa, Side branch of a ΔFIE

sporophyte-like structure (magnification of u). Scale bars: 100 µm in a-f; 1 mm in g-l, s, t; 20

µm in m-r; 200 µm in u-z; 100 µm in aa-ad.




Supplementary Table 1 | Egg cell sizes in WT and three different ΔBELL1 lines. The egg

cell diameters were measured from micrographs of WT (n = 9 egg cells), ΔBELL1-2 (n = 13),

ΔBELL1-4 (n = 3), and ΔBELL1-9 (n = 11).

Egg cell diameters in µm WT state of

archegonium ΔBELL1 state of

archegonium ΔBELL1 line

14.43 closed 15.47 open ΔBELL1-2 15.67 open 15.63 open ΔBELL1-2 15.74 closed 15.82 open ΔBELL1-2 16.76 closed 15.9 open ΔBELL1-9 16.93 open 16.22 closed ΔBELL1-9 17.02 open 16.32 open ΔBELL1-4 17.3 open 16.77 open ΔBELL1-2 17.34 closed 16.79 open ΔBELL1-2 18.27 open 17.03 closed ΔBELL1-9 17.18 closed ΔBELL1-9 17.23 open ΔBELL1-9 18.04 open ΔBELL1-2 18.79 open ΔBELL1-2 19.78 closed ΔBELL1-9 19.84 open ΔBELL1-2 20.03 closed ΔBELL1-9 20.12 open ΔBELL1-2 20.26 open ΔBELL1-2 20.54 open ΔBELL1-2 20.55 open ΔBELL1-9 21.04 open ΔBELL1-2 21.85 open ΔBELL1-9 23.28 open ΔBELL1-2 23.47 closed ΔBELL1-9 23.7 closed ΔBELL1-4 23.73 open ΔBELL1-9 26.39 closed ΔBELL1-4




Supplementary Table 2 | Number of BELL1 transgene copies in the BELL1oe lines. The

number of transgene copies was measured using quantitative Real-Time PCR. The number of

BELL1 copies (one endogenous copy and transgene copies) was determined in BELL1oe lines

compared to the single copy in WT. Table displays the means of three technical replicates and

the standard deviation.

# copies standard deviation transgene copies

WT 1.1 0.04 0

BELL1oe-7 3.1 0.4 2-3

BELL1oe-27 1.6 0.09 1

BELL1oe-31 1.6 0.06 1

Supplementary Table 3 | Median values of clusters shown in Supplementary Fig. 14. The

median values for clusters 1nG1 and 1nG2 were determined for WT and for clusters 2nG1

and 2nG2 were determined for WT and the lines BELL1oe-7, -27 and -31.

cluster median values and standard deviations

WT BELL1oe-7 BELL1oe-27 BELL1oe-31

1nG1 549 38

1nG2 912 109

2nG1 1019 139 960 163 895 137 994 124

2nG2 1778 217 1904 249 1758 347 1889 211




Supplementary Movie 1 | Sperm masses from WT. Boxes mark motile sperms in focus.

Video runs at 0.5x speed. Scale bar: 20 µm.

Supplementary Movie 2 | Sperm masses from ΔBELL1-2. Boxes mark motile sperms in

focus. Video runs at 0.5x speed. Scale bar: 20 µm.

Supplementary references

34. Rensing, S. A. et al. The Physcomitrella genome reveals evolutionary insights into the

conquest of land by plants. Science 319, 64–69 (2008).

35. Reski, R. & Abel, W. O. Induction of budding on chloronemata and caulonemata of the

moss, Physcomitrella patens, using isopentenyladenine. Planta 165, 354–358 (1985).

36. Egener, T. et al. High frequency of phenotypic deviations in Physcomitrella patens plants

transformed with a gene-disruption library. BMC Plant Biology 2, 6, (2002).

37. Frank, W., Decker, E. L. & Reski, R. Molecular tools to study Physcomitrella patens.

Plant Biology 7, 220–227 (2005).

38. Hohe, A., Rensing, S. A., Mildner, M., Lang, D. & Reski, R. Day length and temperature

strongly influence sexual reproduction and expression of a novel MADS-box gene in the

moss Physcomitrella patens. Plant Biology 4, 595–602 (2002).

39. Kamisugi, Y., Cuming, A. C. & Cove, D. J. Parameters determining the efficiency of gene

targeting in the moss Physcomitrella patens. Nucleic Acids Research 33, e173 (2005).




40. Büttner-Mainik, A. et al. Production of biologically active recombinant human factor H in

Physcomitrella: Production of recombinant human factor H. Plant Biotechnology Journal

9, 373–383 (2011).

41. Hohe, A. et al. An improved and highly standardised transformation procedure allows

efficient production of single and multiple targeted gene-knockouts in a moss,

Physcomitrella patens. Current Genetics 44, 339–347 (2004).

42. Bierfreund, N. M., Tintelnot, S., Reski, R. & Decker, E. L. Loss of GH3 function does not

affect phytochrome-mediated development in a moss, Physcomitrella patens. Journal of

Plant Physiology 161, 823–835 (2004).

43. Kofuji, R. et al. in The moss Physcomitrella patens (eds. Knight, C. D., Perroud, P.-F. &

Cove, D. J.) 167–181 (Wiley-Blackwell, 2009).

44. Ishikawa, M. et al. Physcomitrella cyclin-dependent kinase A links cell cycle reactivation

to other cellular changes during reprogramming of leaf cells. Plant Cell 23, 2924–2938

(2011).

45. Chang, S., Puryear, J. & Cairney, J. A simple and efficient method for isolating RNA

from pine trees. Plant Molecular Biology Reporter 11, 113–116 (1993).

46. Livak, K. J. & Schmittgen, T. D. Analysis of relative gene expression data using real-time

quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25, 402–408 (2001).

47. Noy-Malka, C. et al. A single CMT methyltransferase homolog is involved in CHG DNA

methylation and development of Physcomitrella patens. Plant Molecular Biology 84,

719–735 (2014).

48. Hohe, A., Decker, E. L., Gorr, G., Schween, G. & Reski, R. Tight control of growth and

cell differentiation in photoautotrophically growing moss (Physcomitrella patens)

bioreactor cultures. Plant Cell Reports 20, 1135–1140 (2002).




49. Wessa, P. Free Statistics Software, Office for Research Development and Education,

version 1.1.23-r7. Free Statistics Software, Office for Research Development and

Education, version 1.1.23-r7 (2015). at <http://www.wessa.net/>

50. Bracha-Drori, K. et al. Detection of protein-protein interactions in plants using

bimolecular fluorescence complementation. Plant Journal 40, 419–427 (2004).

51. Gibson, D. G. et al. Enzymatic assembly of DNA molecules up to several hundred

kilobases. Nature Methods 6, 343–345 (2009).

52. Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high

throughput. Nucleic Acids Research 32, 1792–1797 (2004).


SUPPLEMENTARY INFORMATION - Nature INFORMATION DOI: ... performed according to the manufacturer’s...

Documents

Transcript of SUPPLEMENTARY INFORMATION - Nature INFORMATION DOI: ... performed according to the manufacturer’s...