1

Supplementary information appendix

 Common biosynthetic origins for polycyclic tetramate macrolactams from

phylogenetically diverse bacteria    Joshua A. V. Blodgett, Dong-Chan Oh, Shugeng Cao, Cameron R. Currie, Roberto Kolter and Jon Clardy

Frontalamide supplementary structural data:

frontalamide  A): white  powder; [α]D +85 (c 0.04, MeOH); IR (neat) υmax 3435, 1658, 1603, 1462; UV (MeOH) λmax (log ε) 220 (4.3), 323 (4.0) nm; HR-ESI-TOFMS [M+H]+ m/z 525.2604, calcd [M+H]+ 525.2601. frontalamide  B)  white  powder; [α]D +57 (c 0.05, MeOH); IR (neat) υmax 3450, 1662, 1605, 1460; UV (MeOH) λmax (log ε) 223 (4.3), 324 (4.0) nm; HR-ESI-TOFMS [M+H]+ m/z 509.2662, calcd [M+H]+ 509.2652.    FI-1): white  powder; [α]D +85 (c 0.11, MeOH:CHCl3 9:1); IR (neat) υmax 3307, 1655, 1598, 1455, 1261, 1092, 1020, 802; UV (MeOH) λmax 222, 323 nm; HRMS m/z 509.2670 ([M+H]+), calcd for C29H37N2O6, 509.2652). FI-2): white  powder; [α]D +96 (c 0.21, MeOH:CHCl3 9:1); IR (neat) υmax 3324, 1651, 1587, 1455; UV (MeOH) λmax 225, 323 nm; HRMS m/z 511. 2829 ([M+H]+), calcd for C29H39N2O6, 511.2808). FI-3): white  powder; [α]D +66 (c 0.16, MeOH:CHCl3 9:1); IR (neat) υmax 3308, 1650, 1588, 1457, 1260, 1090, 1018, 799; UV (MeOH) λmax 222, 323 nm; HRMS m/z 493.2714 ([M+H]+), calcd for C29H37N2O5, 493.2703).   Methods:

General microbiological and molecular methods: Bacterial strains and plasmids used

in this study are listed in Table S4. Escherichia coli strains were cultivated at 37 °C in

LB liquid or on TYE (9) solid media supplemented with 30 or 50 µg/ml apramycin (Apr)

when required for plasmid maintenance and cloning. Streptomyces strains were

2

propagated on ISP2 (Becton, Dickinson & Co., Sparks MD) agar medium at 30 °C unless

otherwise noted. When grown in liquid, Streptomyces strains were cultured in 125 ml

flasks containing 15 ml MYG (10) media and sterile 6mm glass beads (for baffles and

disaggregation of mycelia) on a flatbed shaker operating at 250 rpm. Plasmid

constructions were carried out using standard methods (11). Restriction endonucleases

and T4 DNA ligase were purchased from New England Biolabs (Beverly, MA).

Plasmids were isolated using Qiagen miniprep kits, and PCR reaction products were

purified for downstream cloning and sequencing by gel extraction using Promega

(Madison, WI) SV Wizard Gel and PCR Clean-up kits. PCR reactions were carried out

using Epicentre (Madison, WI) FailSafe pre-mixed buffers with Taq DNA polymerase for

colony screening or KOD Hot-start DNA polymerase (EMD Biosciences, San Diego CA)

for applications requiring high fidelity such as sequencing and cloning. Oligonucleotides

used in this study are listed in Table S5 and were purchased from Integrated DNA

Technologies (Coralville, IA). DNA sequencing reactions were performed by Genewiz,

South Plainfield NJ.

Structure elucidation of frontalamides A and B. Streptomyces strain SPB78 was

grown for 3 days in 15 ml YMS liquid medium contained in a 125 ml flask (equipped

with 6 mm glass beads to improve liquid mixing and aeration). Aliquots (200 µl) of this

seed culture were spread for confluence over Petri plates containing ~25-30 ml YMS

solid agar medium and allowed to incubate for 3-4 days at 30 °C. To isolate

frontalamides, agar and adhering SPB78 cells were scraped from the plates, pooled, and

covered with ethyl acetate to extract. The extract was dried under vacuum, and

subsequently fractionated through a C18 Sepak (1 gram) SPE (solid phase extraction)

3

column by eluting with a step gradient of 20%, 40%, 60%, 80%, 100% MeOH in water.

The 80% MeOH/water fraction was subjected to further chromatography (listed below) to

purify frontalamides A and B after testing individual fractions by LC/MS. Frontalamide

LC/MS analyses were conducted using an Agilent 1200 Series HPLC equipped with a

Phenomenex Luna C18 reversed-phase column (4.6 × 100 mm, 5 µm) and operated at a

flow rate of 0.7 ml/min. A gradient of 10-100% acetonitrile in water with 0.1% formic

acid over 20 min was used and data were collected using a diode array to monitor

absorbance at 280 nm. Mass spectral data were acquired using ESI-MS on an Agilent

6130 Series mass spectrometer, where both positive and negative ions were monitored.

Frotalamide A was isolated by reversed-phase HPLC (Phenomenex C18

semiprepartive column 10 mm × 250 mm, 2 ml/min, UV 280 nm detection) with the

isocratic solvent of 50% acetonitrile in water with 0.1% formic acid (retention time 15.0

min). Frontalamide B was also isolated by reversed-phase HPLC (Alltech

semipreparative column C18, 10 mm × 250 mm, 2 ml/min, UV 280 nm detection) with

the isocratic solvent of 75% methanol in water with 0.1% formic acid (retention time 31.9

min).

Production and isolation of biosynthetic intermediates FI-1, FI-2, and FI-3. SPB78

mutant strain JV174 was grown essentially as described above for the production of

frontalamides. Production of frontalamide biosynthetic intermediates was monitored on

an Agilent 1100 LC/MS system operating at 0.7 ml/min. A Phenomenex Luna C18

column (100 × 4.6 mm, 5µ ) was employed and metabolites were eluted from the solid

phase using the following mobile phase gradient: 0-100-100% aq. acetonitrile with 0.1%

formic acid (0-15-20 min). Biosynthetic intermediates for structure elucidation were

4

extracted from JV174-inoculated YMS agar with ethyl acetate. About 140 milligrams of

crude extract were obtained after removal of the solvent under vacuum. The crude

extract was dissolved in methanol and filtered for preparative HPLC separation

(Phenomenex, Luna, C18, 250 × 21.2 mm, 5 µ; 65% MeCN/H2O with 0.1% formic acid;

9 ml/min), which afforded three pure compounds, FI-1 (retention time 11.5 min, 1.5 mg,

30 µg/plate), FI-2 (retention time 13.5 min, 2.2 mg, 40 µg/plate), and FI-3 (retention time

18 min, 3 mg, 60 µg/plate).

Structure elucidation of frontalamide biosynthetic intermediates FI-1, FI-2 and FI-

3. HRMS measurements were obtained on an Agilent accurate-mass Q-TOF 6500

system. All NMR experiments were carried out on a Varian INOVA 600 MHz

spectrometer. The structures were determined based on 1-D and 2-D NMR data. The

relative configurations were determined by using 1-D and 2-D NOESY experiments. [α]D

measurements were obtained using a Jasco P-2000 digital polarimeter with a sodium

lamp. IR spectra were obtained using a Bruker FT-IR Tensor-27 instrument.

Genetic methods. The frontalamide biosynthetic locus is split between two adjacent

contigs in the draft genome of Streptomyces sp. SPB78 and the gap is located in the 3’

end of the ftdB gene. To close this gap and enable further analyses, two PCR reactions

with primer pairs SPB78gapseq F1/R1 and SPB78gapseq F2/R2 were performed and the

products were sequenced.

Two frontalamide biosynthetic genes were deleted using a markerless Apr

selection/ streptomycin (Str)-resistance counterselection scheme (12). To isolate the

required Streptomyces sp. SPB78 rpsL mutant, mycelia were grown in MYG liquid media

for 48 hours and 0.2 ml of this culture was plated to ISP2 containing Str at concentrations

5

of 10 or 50 µg/ ml. Colonies arose under both conditions, and a subset was re-streaked to

Str containing plates. To confirm that the Str-resistance (StrR) phenotype correlated to an

rpsL mutation, we PCR- amplified the rpsL locus using primers SPB78rpsL seqF and

SPB78rpsL seqR and the products were sequenced using the same primers. One

confirmed rpsL mutant, JV141, was used as the parent strain in which the ftdA and ftdB

deletion mutations were created.

  The markerless deletion scheme used to analyze frontalamide biosynthetic

genes is essentially as previously described (7). To delete ftdA, a deletion cassette

resulting from the fusion of upstream and downstream homologous regions by PCR

overlap extension (13, 14) was created. The upstream region was amplified using

primers Desat KO F1/ Desat KO R1 and the downstream region was created using the

primer pair Desat KO F2/ Desat KO R2. Likewise, a ftdB deletion cassette was PCR-

generated by overlap extension between upstream and downstream regions created using

primer pairs NRPKS KO F1/ NRPKS KO R1 and NRPKS KO F2/ NRPKS KO R2,

respectively. The respective deletion cassettes were cloned into the counter-selectable

shuttle vector pJVD52.1, giving rise to deletion constructs pJVD130 and pJVD131.

To delete ftdA and ftdB from the chromosome of JV141, plasmids pJVD130 and

pJVD131 were introduced by intergenic conjugation from E. coli donor strain JV36.

Conjugations were set up using JV141 mycelia grown ~24 hours at 30 °C in liquid MYG

media. JV36 donor strains carrying pJVD130 or pJVD131 were grown overnight in LB

Apr30 at 37 °C. The strains were mixed (100 µl JV141 mycelia and 2-4 µl overnight

donor culture) and cell suspension was spotted to Petri plates containing 30 ml solidified

R2 agar (15) lacking sucrose. The conjugation plates were incubated at 30 °C for 20

6

hours before overlaying each with 2 ml sterile distilled water containing 1.5 mg Apr and

2 mg Nalidixic acid (Nal). Conjugation plates were incubated for an additional 3 days

before exconjugant colonies were streaked to ISP2 Apr30 Nal25 plates. A few individual

colonies were used to inoculate 15 ml MYG liquid cultures at 39 °C and incubated for 3

days. From these liquid cultures, single integrants were isolated by spreading or

streaking 200 µl aliquots to ISP2 Apr15 plates with further incubation at 39 °C. After 5-7

days, single colonies arose that were large enough to inoculate 15 ml MYG liquid

cultures, which were again incubated at 39 °C non-selectively to allow for the second

crossover event. After 3 days, these cultures were spread to ISP2 Str10 plates and

incubated at 30 °C to select against cells still harboring the deletion plasmids. Individual

StrR colonies were streaked for purity on ISP2 Str10 and checked for Apr sensitivity.

Colonies found to be StrR resistant and apramycin sensitive were then screened for the

desired mutations using PCR with primers pairs that anneal internally to the homology

regions used to delete the genes of interest. For ftdA, these primer pairs were Desat

intKOck F/ Desat intKOck R and for ftdB these pairs were NRPKS intKOck F/ NRPKS

intKOck R. A subset of colonies that appeared to be deletion mutants after the first PCR

screen were subjected to two successive rounds of streaking for isolated colonies,

subsequent growth in liquid culture to produce finely dispersed mycelial filaments, and

plating for isolated colonies to ensure no inadvertent wild type carryover. Finally, the

purified strains were again verified by the initial PCR screen described above, and were

further verified with two additional PCR screens. In these screens, one primer anneals to

an opposite region of homology and the other in the pair annealed outside of the

homologous sequences used to make the deletion cassette. To verify the ΔftdA strains,

7

primer pairs Desat upstrKOck F / Desat intKOck R and Desat intKOck F / Desat

dnstrKOck R were used. Likewise, to verify ΔftdB strains, primer pairs NRPKS

upstrKOck F/ NRPKS intKOck R and NRPKS intKOck F/ NRPKS dnstrKOck R were

used. In these screens, both sets of verification reactions gave predicted products, as

expected for gene deletion events. Finally, the ΔftdA mutant was further verified for the

loss of the expected sequence by primers that amplify a short portion of the wild type

ftdA sequence. The reaction was run in parallel with JV141 template and as expected, the

ΔftdA mutant did not give the band seen with the JV141 parent. The primers used in this

screen were Desat wtCK F and Desat wtCK R.

Isolation and screening of environmental actinomycetes for frontalamide-like gene

clusters. Soil samples were transported back to the laboratory in clean plastic bags

where they were sifted to remove debris. As mentioned in the Methods section, protocol

used for the enrichment and isolation of actinomycetes from these samples was adapted

from El-Nakeeb et al (16). The sifted soil was air dried for 16 days at room temperature.

One gram of the dried material was then mixed in a mortar with one gram of CaCO3. The

mixture was then layered into a sterile polystyrene 100 15 mm Petri plate and these

were subsequently incubated in a humid atmosphere for 12 days at 30 °C. The

soil/CaCO3 mixtures were then added to 50 ml sterile distilled water and vortexed.

Particulate in the samples settled for 30-40 minutes before serially- diluting the remaining

suspension in sterile water. 0.1 ml aliquots of the diluted material were spread over

plates containing AGS (16) or LTY (17) agar with added cycloheximide (50 mg/L final

concentration) to inhibit fungal growth. These were incubated at 30 °C for 4-10 days and

colonies showing typical actinomycete morphology were then streaked for purity.

8

  To screen for frontalamide-like gene clusters in environmental actinomycete

strains by PCR, degenerate-code primers were designed that bind to conserved regions in

the 3’ ends of ftdA-like genes and the 5’ ends of the hybrid ftdB-like genes. To design the

forward primer (CHdesatF1), amino acid sequences of fatty acid hydroxylase homologs

from the strains Streptomyces SPB74, Streptomyces SBP78, S. albus, S. griseus, L.

enzymogenes and S. degradans were aligned using BLOCKS (18)

(http://blocks.fhcrc.org/blocks/make_blocks.html) and degenerate primers were generated

from the BLOCKS output using CODEHOP (19)

(http://blocks.fhcrc.org/blocks/codehop.html). Two reverse primers (CHnrpksR1 and

R2) were similarly created that anneal to ftdB homolog 5’ sequences of the same

organisms listed above. Isolates were screened via PCR after samples were prepared as

recommended by Van Dessel et al (20). Touchdown PCR conditions were used, where

the first round of cycling conditions were as follows: 94 °C, 1 min; 62 °C, 1 min; 72 °C,

1min. The annealing temperatures were dropped on successive cycles through the

following temperatures (°C): 60, 58, 56, 54 and 52. After the touchdown cycles were

complete, 34 cycles of the program 94 °C, 1 min; 52 °C, 1 min; 72 °C, 1 min was used to

complete the amplification.

  PCR products obtained after screening the environmental isolates were from the

screening efforts were sequenced using primer CHdesatF1, except for isolate JV178

where both primers CHdesatF1 and Env27intseqF were used. The resulting data were

analyzed by BlastX (21) to ensure that each product contained regions encoding portions

of both the C-terminus FtdA like protein and the N-terminus of a FtdB-like protein

separated by an intergenic region. Sequences that contained these regions were grouped

9

and de-replicated to guide downstream metabolite screening efforts using ClustalW (22).

The 16S rRNA genes were PCR- amplified from isolates of interest using primers 8F and

1492R (8). The resulting products were sequenced using primers 8F, 1492R, and

16SintseqF.

  Environmental isolates thought to harbor putative frontalamide-like clusters after

PCR analyses were grown in 15 ml MYG liquid cultures under conditions noted above

for the cultivation of strain SPB78. After 4 days of growth at 30 °C, 0.2 ml of each

culture was spread for confluence on plates containing the following agar media: LTY

(17), YMS (23), Hickey-Tresner agar (15), and ISP4 (Becton, Dickinson & Co., Sparks

MD). After allowing growth for 5 days (12 days for SPB74) at 30 °C, agar was cut from

the plates as described for frontalamide isolation, and extracted with ethyl acetate

overnight. The resulting organic extract was dried under vacuum to yield crude solids.

These were dissolved in 0.4 ml methanol, filtered (13 mm Pall Acrodisc syringe filter,

0.2µm PVDF membrane), and analyzed by LC/MS. The LC/MS protocol used to

separate the crude extract was similar to that used to analyze production of intermediates

FI-1, 2 and 3, except the following gradient conditions were adopted: 0-100-100% water/

acetonitrile with 0.1% formic acid (0-25-30 min.).

Figure S1: 1H NMR spectrum of frontalamide A

Figure S2: 1H NMR spectrum of frontalamide B

Figure S3: Bioassay of Streptomyces sp. SPB78 and frontalamide non-producing mutants against Ophiostoma minus. A) Bioassay plate showing differential inhibition of O. minus (Om) when plated against wild type SPB78 (WT), a SPB78 rpsL mutant (rpsL), a SPB78 rpsL ΔftdA double mutant (ΔftdA) and an SPB78 rpsL ΔftdB (ΔftdB) double mutant. B) Microscopic examination of frontalamide effects on O. minus filament morphology. Top row; O. minus (Om) displaying wild-type morphology after growing in the presence of SPB78 frontalamide non- producing strains ΔftdA (left) and ΔftdB (right). Bottom row; O. minus (Om) with deformed filaments after growing in the presence of frontalamide producing strains SPB78 rpsL (left) and wild-type SPB78 (right). Note that due to the strong inhibition of Om by the streptomycete strains assayed in the bottom row, both Om and the inhibiting bacteria could not be captured in the same image under the selected magnification. Scale bars: 100 microns.

Figure S4: 1H NMR spectrum of frontalamide biosynthetic intermediate FI-1

Figure S5: 1H NMR spectrum of frontalamide biosynthetic intermediate FI-2

Figure S6: 1H NMR spectrum of frontalamide biosynthetic intermediate FI-3

Figure S7: Unrooted tree of phytoene dehydrogenase homologs (FtdC and FtdD) encoded in various bacterial ftd-like gene clusters. The sequences of three carotenoid dehydrogenase (DH) family biosynthetic enzymes from Staphylococcus aureus (CrtN), Rhodobacter capsulatus (CrtI) (24) and Arabidopsis thaliana (F4H5.10) (25) were included for comparison as noted in the text. GenBank protein identifiers are indicated for the latter enzymes. Sequence alignments and tree calculations were performed using ClustalW software at http://workbench.sdsc.edu using default parameters.

Figure S8: LC/MS detection of putative polycyclic tetramate macrolactams by environmental Streptomyces isolates harboring ftd genes. The detection of related compounds produced by the mycangimycin-producing strain Streptomyces sp. SPB74 is also included. The peaks marked with an asterisk indicate compounds with UV spectra similar to frontalamide- family compounds and the detected ESI-MS values for [M-H]- ions are indicated. The source strains are as follows: A) SPB74 B) JV177 C) JV186 D) JV185 E) JV178 F) JV180 G) JV184 H) JV181

Figure S9: Extracted UV spectra of select frontalamide-like compounds produced by environmental isolates and Streptomyces sp. SPB74. The minute values indicate which peak in the respective LC/MS traces of Figure S3 serve as the source compound: A) SPB74, 14.384 min. B) JV177, 16.356 min. C) JV186, 17.935 min. D) JV185, 16.362 min. E) JV178, 16.259 min. F) JV180, 16.350 min. G) JV184, 15.537 min. H) JV181, 17.884 min.

Table S1. 1Ha and 13Cb NMR Data (in CD3OD) of frontalamides A and B

# 1H (ppm) 13C (ppm) frontalamide A frontalamide B A B

1 167.2 167.6 2 5.82 (dd, 11.5, 2.5) 5.84 (dd, 11.5, 2.5) 123.7 123.8 3 6.08 (ddd, 11.5, 11.5, 2.5) 6.01 (ddd, 11.5, 11.5, 2.5) 139.4 139.5 4a 3.70 (m) 3.57 (m) 27.7 28.1 4b 2.27 (m) 2.21 (m) 5 1.94 (m) 1.86 (m) 43.7 44.4 6 2.66 (m) 2.12 (m) 48.7 52.3 7a 2.27 (m) 2.19 (m) 36.7 38.6 7b 1.14 (m) 1.19 (m) 8 2.21 (m) 2.51 (m) 51.9 41.7 9a 2.03 (m) 2.04 (m) 39.0 40.8 9b 1.08 (m) 1.22 (m) 10 2.33 (m) 2.13 (m) 54.3 57.1 11 1.44 (m) 1.29 (m) 49.8 47.3 12 2.37 (m) 90.1 50.3 13 2.42 (m) 2.47 (m) 64.5 63.5 14 210.5 209.5 15a 2.55 (m) 2.49 (m) 45.9 46.5 15b 2.25 (m) 2.23 (m) 16 2.56 (m) 2.42 (m) 47.8 47.8 17 6.74 (dd, 15.5, 9.5) 6.43 (dd, 15.5, 9.5) 143.2 142.8 18 7.10 (d, 15.5) 7.39 (d, 15.5) 123.0 129.6 19 173.4 182.2 20 101.7 103.5 21 176.4 177.6 22 23 3.96 (m) 3.75 (m) 68.6 66.7 24 193.9 194.3 25 3.97 (m) 3.94 (m) 70.9 71.1 26a 1.60 (m) 1.68 (m) 31.3 30.9 26b 1.39 (m) 1.34 (m) 27a 3.46 (m) 3.50 (m) 36.7 36.5 27b 2.80 (m) 2.82 (m) 28 29 5.66 (ddd, 17.0, 10.0, 8.0) 5.68 (ddd, 17.0, 10.0, 8.0) 140.9 141.4 30a 4.99 (dd, 17.0, 2.0) 5.00 (dd, 17.0, 2.0) 113.8 113.2 30b 4.95 (dd, 10.0, 2.0) 4.93 dd (10.0, 2.0) 31 0.99 d (7.0) 0.99 d (7.0) 10.9 16.5

aδ (ppm) 600 MHz; multiplicities; J values (Hz) in parentheses. bδ (ppm) 150 MHz, acquired with gHSQC and gHMBC

HN

OOH

NH

O

HO

OO

HO

HN

O

NH

O

HO

OO

H

frontalamide AExact Mass: 524.25

frontalamide BExact Mass: 508.26

H

H H

OH

HH

H30910

29

31

11 128 7

561314

15

16 17

1819 20

24

2122

23

25

26

272812

3

4

Table S2. 1Ha and 13Cb NMR Data (in 90%CDCl3/CD3OD) of intermediates FI-1~FI-3

# 1H (ppm) 13C (ppm) FI-1 FI-2 FI-3 FI-1 FI-2 FI-3

1 166.5 166.7 166.5 2 5.80 (d 10.4) 5.73 (d 11.4) 5.75 (d 11.7) 124.5 124.2 124.2 3 5.99 (dd 10.4,

10.2) 5.92 (dd 11.4, 10.8)

5.87 (dd 11.7, 10.8)

139.4 139.3 139.5

4 3.58 (m) 2.33 (m)

3.50 (m) 2.25 (m)

3.52 (m) 2.25 (m)

28.0 27.8 28.2

5 1.82 (m) 1.75 (m) 1.83 (m) 44.0 43.8 44.0 6 2.62 (m) 2.30 (m) 2.45 (m) 47.6 47.6 41.3 7 2.05 (m)

0.98 (m) 2.08 (m) 0.63 (m)

2.15 (m) 1.10 (m)

39.3 38.3 38.7

8 2.21 (m) 2.05 (m) 2.05 (m) 51.6 51.1 52.5 9 2.27 (m)

1.05 (m) 2.00 (m) 0.98 (m)

2.00 (m) 1.10 (m)

37.1 37.1 40.9

10 2.35 (m) 1.57 (m) 2.00 (m) 53.9 50.5 56.7 11 1.30 (m) 1.10 (m) 1.20 (m) 50.4 50.3 47.5 12 2.34 (m) 90.5 90.5 50.0 13 2.15 (m) 2.07 (m) 2.28 (m) 65.3 65.2 64.1 14 210.5 210.5 207.8 15 2.35 (m) 2.30 (m) 2.42 (m) 46.7 46.7 46.2 16 2.51 (m) 2.55 (m) 2.51 (m) 49.1 47.6 48.3 17 6.64 (dd 15.3,

10.2) 6.56 (dd 15.3, 10.2)

6.65 (dd 15.3, 10.2)

147.6 147.3 148.2

18 7.08 (d 15.3) 7.04 (d 15.3) 7.03 (d 15.3) 123.0 123 122.7 19 173.5 173.0 173.1 20 101.0 101.1 101.0 21 175.5 175.2 175 22 23 3.86 (br s) 3.76 (d 4.8) 3.81 (br s) 61.5 61.4 61.5 24 196.6 196.9 196.8 25 2.00 (m)

1.75 (m) 1.95 (m) 1.68 (m)

1.98 (m) 1.72 (m)

28.0 26.4 26.6

26 1.51 (m) 1.23 (m)

1.43 (m) 1.17 (m)

1.48 (m) 1.20 (m)

20.7 20.5 20.5

27 3.57 (m) 2.51 (m)

3.45 (m) 2.50 (m)

3.52 (m) 2.51 (m)

39.3 38.6 38.5

28 29 5.58 (m) 1.50 (m)

0.93 (m) 5.59 (m) 140.5 25.7 141.0

30 4.96 (d 17.4) 4.92 (d 10.2)

0.76 (t 7.8) 4.91 (d 16.8) 4.86 (d 10.8)

114.6 11.7 114.0

31 0.98 (d 6.6) 0.92 (d 6.6) 0.95 (d 6.6) 11.0 11.0 17.0 aδ (ppm) 600 MHz; multiplicities; J values (Hz) in parentheses. bδ (ppm) 150 MHz

HN

O

NH

O

HO

OO

HO H

HH

HN

O

NH

O

HO

OO

H H

HH

FI-1 FI-2 FI-3Exact Mass: 510.27 Exact Mass: 492.26

HN

O

NH

O

HO

OO

HO H

HH

30910

29

31

11 128 7

561314

15

16 17

1819 20

24

2122

2325

26

272812

3

4

Exact Mass: 508.26

Table S3. Comparison of selectivity-conferring residues extracted from frontalamide-type hybrid NRPS/PKS enzymes to those from known ornithine-adenylating domains

Amino acid positionsa: Organism 235 236 239 278 299 301 322 330 331 517

Expected Substratea

Lenzym D V G E V G S I D K Orn Strroseo D V G E V G S I D K Orn Stralbus D V G E I G S I D K Orn StrSPB74 D V G E V G S I D K Orn StrSPB78 D V G E V G S I D K Orn StrMg1 D V G E I G S V D K Orn Sgriseus D V G E V G S I D K Orn

Sflavogris D V G E V G S I D K Orn Sarenicola D V G E V G S I D K Orn Sdegrad D V G E I G S I D K Orn StrActE D V G E V G S V D K Orn

StrAct-1 D V G E V G S I D K Orn TycC_m5 D V G E I G S I D K Orn BacB_ m2 D V G E I G S V D K Orn

Abbreviations: Lenzym, Lysobacter enzymogenes; Strroseo, Streptomyces roseosporus ATCC11379; Stralbus, Streptomyces albus; StrSPB74, Streptomyces sp. SBP74; StrSPB78, Streptomyces sp. SBP74; StrMg1, Streptomyces sp. Mg1; Sgriseus, Streptomyces griseus; Sflavogris, Streptomyces flavogriseus; Sarenicola, Salinispora arenicola; Sdegrad, Saccarophagus degradans; StrActE, Streptomyces sp. ActE; StrAct-1, Streptomyces sp. Act-1; TycC_m5, tyrocidine synthetase 3, module 5, from Brevibacillus brevis; BacB_m2, bacitracin synthetase 2, module 2, from Bacillus licheniformis; Orn, ornithine. aActive site residues as defined by Stachelhaus (1), and the expected amino acid substrates recognized by these motifs, were determined using the software program “NRPSpredictor” at http://www-ab.informatik.uni-tuebingen.de/software (2). Original work identifying Orn activating domains in tyrocidine and bacitracin synthetases is described in Supplementary Refs (1, 3, 4).

Table S4. Microorganisms and plasmids used in this study Strain or plasmid Relevant characteristics Source or

reference Escherichia coli

DH5α/λpir λpirΦ80dlacZΔM15 Δ(lacZYA-argF)U169 recA1 hsdR17 deoR thi-1 supE44 gyrA96 relA1

(5)

DH10B Φ80dlacZΔM15 /araD139 Δ(ara- leu)7697 ΔlacX74 galU galK rpsL deoR endA1 nupG recA1 mcrA Δ(mrr hsdRMS mcrBC)

Invitrogen

JV36 dam-3 dcm-6 metB1 galK2 galT27 lacY1 tsx-78 supE44 thi-1 mel-1 tonA31 ΔhsdRMS-mrr::Frt(rK

- mK-) attHK::pJK202

(ΔoriR6K-aadA::Frt bla::pir) (Tra+, AmpS) [conjugal donor]

This study

Streptomyces spp.

Streptomyces sp. SPB74

Wild type, Streptomyces isolate from Dendrocontus valens pine beetle (red morph)

(6)

Streptomyces sp. SPB78

Wild type, Streptomyces isolate from Dendrocontus valens pine beetle (white morph)

(6)

JV141 Streptomyces sp. SPB78 rpsL (S12 K43R) This study JV174 Streptomyces sp. SPB78 rpsL ΔftdA This study JV168 Streptomyces sp. SPB78 rpsL ΔftdB This study JV176 Environmental isolate LTYF20 (Streptomyces setonensis) a This study JV177 Environmental isolate AGSF-N2 (Streptomyces naraensis) a This study JV178 Environmental isolate AGSG12 (Streptomyces hygroscopicus) a This study JV179 Environmental isolate LTYF12 (Streptomyces setonensis) a This study JV180 Environmental isolate AGSG3 (Streptomyces californicus) a This study JV181 Environmental isolate LTYG3 (Streptomyces sp. SXY49) a This study JV182 Environmental isolate LTYF1 (Streptomyces setonensis) a This study JV184 Environmental isolate AGSF1 (Streptomyces naraensis) a This study JV185 Environmental isolate AGSF3 (Streptomyces pulveracerus) a This study JV186 Environmental isolate AGSG13 (Streptomyces globisporus) a This study

Streptomyces sp. Mg1

Wild type, Alaskan glacier isolate M.Fischbach, Harvard

Streptomyces clavuligerus

Wild type, Type strain ATCC 27064, clavulanic acid producer M.Fischbach, Harvard

Fungi Ophiostoma

minus Wild type, pine tree pathogenic fungus C. Currie,

UW-Madison Plasmids

pJVD52.1 AprR, oriT, reppSG5(ts), reppUC, rpsL+ shuttle vector (7) pJVD130 pJVD52.1 digested with EcoR1/HindIII and ligated to the

EcoRI/HindIII digested PCR-generated ftdB deletion cassette This study

pJVD131 pJVD52.1 digested with EcoR1/HindIII and ligated to the EcoRI/HindIII digested PCR-generated ftdA deletion cassette

This study

aIdentity of closest 16S rDNA match in GenBank. All show >97% identity to listed organism.

1

Table S5. Oligonucleotides used in this study

Oligonucleotide DNA Sequence Source or reference

SPB78rpsL seqF CATTCGGCACACAGAAACC This study SPB78rpsL seqR TTACTTCTCCTTCTTGGC This study SPB78gapseq F1 CTGCCCTCGTACCTCGTC This study SPB78gapseq F2 GCTCATCGCCTTCAACTACC This study SPB78gapseq R1 TGTGTCCTCGTCCGTGAG This study SPB78gapseq R2 CTCCGCGTCGAGCATCTC This study

CHdesatF1 CCCAGGGCTACTTCGTCCAYGCNAAYRT This study CHnrpksR1 GCGGTGGTCGTTGGCNCCNCCNGG This study CHnrpksR2 GCGTGTGGGTGAGGCARTCYTTNCC This study

NRPKS KO F1 GGCGCGCCAAGCTTGGCAGGGCGCTGCTGCGTTTCC This study

NRPKS KO R1 CGCCTCCGCCGCCGTCTCGGCCGCGCTCACGTGGGCACACTCCTCGGGTTCGCGC This study

NRPKS KO F2 GGACGCGCGAACCCGAGGAGTGTGCCCACGTGAG CGCGGCCGAGACGGCGGCG This study

NRPKS KO R2 GGCGCGCCGAATTCATGACGTGCTCGGCGTAGAGC This study NRPKS intKOck F CTTCGGCAGCTTCACCTG This study NRPKS intKOck R GCCCCGATCACGAGGAC This study

NRPKS upstrKOck F CTCCTGTTCAATGGCTCACG This study

NRPKS dnstrKOck R CCTCGTACAGCTTGTCGATCC This study

Desat KO F1 GGCGCGCCAAGCTTGCTCGACTCGAAGTCGCAGGAGACG This study

Desat KO R1 GGTCTCGCTCAGGCGCCCTGGCGGCCGTCCGTCACGGGAACCCGGCCGTGAGCCATTG This study

Desat KO F2 CTCCTGTTCAATGGCTCACGGCCGGGTTCCCGTGACGGACGGCCGCCAGGGCGCCTGAG This study

Desat KO R2 GGCGCGCCGAATTCTCGGCGATCGTGTACTGCGG This study Desat intKOck F GCCATCTCCACTCCCTTTG This study Desat intKOck R ATGATCGCGACCTTCTCG This study

Desat upstrKOck F ACGTGGACGAACCACTCC This study Desat dnstrKOck R GTCCGAGAGCCGCTTGAG This study

Desat wtCK F CCGTTTCCGTCATCACTTG This study Desat wtCK R GAGCTTCCACAGGTGCTTG This study Env27intseqF CGAACGCGCCCTGAAC This study

16SintseqF CACGGCCCAGACTCCTAC This study 8F AGAGTTTGATCCTGGCTCAG (8)

1492R GGTTACCTTGTTACGACTT (8)

Supplemental Appendix References 1. Stachelhaus T, Mootz HD, Marahiel MA (1999) The specificity-conferring code

of adenylation domains in nonribosomal peptide synthetases. Chem Biol 6: 493-505.

2. Rausch C et al. (2005) Specificity prediction of adenylation domains in nonribosomal peptide synthetases (NRPS) using transductive support vector machines (TSVMs). Nucleic Acids Res 33: 5799-5808.

3. Mootz HD, Marahiel MA (1997) The tyrocidine biosynthesis operon of Bacillus brevis: complete nucleotide sequence and biochemical characterization of functional internal adenylation domains. J Bacteriol 179: 6843-6850.

4. Ishihara H, Hara N, Iwabuchi T (1989) Molecular cloning and expression in Escherichia coli of the Bacillus licheniformis bacitracin synthetase 2 gene. J Bacteriol 171: 1705-1711.

5. Miller VL, Mekalanos JJ (1988) A novel suicide vector and its usein construction of insertion mutants: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 170: 2575-2583.

6. Scott JJ et al. (2008) Bacterial protection of beetle-fungus mutualism. Science 322: 63.

7. Blodgett JA et al. (2007) Unusual transformations in the biosynthesis of the antibiotic phosphinothricin tripeptide. Nat Chem Biol 3: 480-485.

8. Burr MD, Clark SJ, Spear CR, Camper AK (2006) Denaturing gradient gel electrophoresis can rapidly display the bacterial diversity contained in 16S rDNA clone libraries. Microb Ecol 51: 479-486.

9. Wanner BL (1994) Gene expression in bacteria using TnphoA and TnphoA' elements to make and switch phoA, lacZ(op) and lacZ(pr) fusions (Academic, Orlando, FL).

10. Alijah R et al. (1991) Genetic analysis of the phosphinothricin-tripeptide biosynthetic pathway of Streptomyces viridochromogenes Tü494. Appl Microbiol Biot 34(6): 749-755.

11. Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY).

12. Hosted TJ, Baltz RH (1997) Use of rpsL for dominance selection and gene replacement in Streptomyces roseosporus. J Bacteriol 179: 180-186.

13. Horton RM et al. (1989) Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 77: 61-68.

14. Wurch T, Lestienne F, Pauwels PJ (1998) A modified overlap extension PCR method to create chimeric genes in the absence of restriction enzymes. Biotechnol Tech 12: 653-657.

15. Keiser T et al. (2000) Practical Streptomyces Genetics (John Innes Centre, Norwich, England).

16. El-Nakeeb MA, Lechevalier HA (1963) Selective isolation of aerobic Actinomycetes. Appl Microbiol 11: 75-77.

17. Gorski L, Leadbetter ER, Godchaux W, 3rd (1991) Temporal sequence of the recovery of traits during phenotypic curing of a Cytophaga johnsonae motility mutant. J Bacteriol 173: 7534-7539.

18. Henikoff S, Henikoff JG, Alford WJ, Pietrokovski S (1995) Automated construction and graphical presentation of protein blocks from unaligned sequences. Gene 163: GC17-26.

19. Rose TM et al. (1998) Consensus-degenerate hybrid oligonucleotide primers for amplification of distantly related sequences. Nucleic Acids Res 26: 1628-1635.

20. Van Dessel W, Van Mellaert N, Geukens JA (2003) Improved PCR-based method for the direct screening of Streptomyces transformants. J Microbiol Meth 53: 401-403.

21. Altschul SF, Miller GW, Myers EW, Lipmann DJ (1990) Basic local alignment search tool. J Mol Bio 215: 403-410.

22. Larkin MA et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948.

23. Ikeda H, Kotaki H, Omura S (1987) Genetic studies of avermectin biosynthesis in Streptomyces avermitilis. J Bacteriol 169: 5615-5621.

24. Sandmann G (2009) Evolution of carotene desaturation: the complication of a simple pathway. Arch Biochem Biophys 483: 169-174.

25. Park H et al. (2002) Identification of the carotenoid isomerase provides insight into carotenoid biosynthesis, prolamellar body formation, and photomorphogenesis. Plant Cell 14: 321-332.