SUPPLEMENTAL TABLES - · PDF fileSUPPLEMENTAL TABLES Supplemental Table 1: Characteristics of...

Click here to load reader

  • date post

    14-Feb-2019
  • Category

    Documents

  • view

    218
  • download

    0

Embed Size (px)

Transcript of SUPPLEMENTAL TABLES - · PDF fileSUPPLEMENTAL TABLES Supplemental Table 1: Characteristics of...

SUPPLEMENTAL TABLES

Supplemental Table 1: Characteristics of peripheral blood prior to electrotransfer of SB plasmids

and numeric expansion on -irradiated AaPC and cytokines

P# AutoorAllo

Day0(Dayofelectroporation)WBC[K/mL]

ALC[K/mL]

CD3(ATC)[%&K/mL]

CD4[%&K/mL]

CD8[%&K/mL]

ABC[%&K/mL]

P446 Auto 5.4 1.46 81%1.1860%0.88

19%0.28 ND

P458 Auto 9 0.27 23%0.0617%0.05

2%0.005 ND

P468 Auto 4.7 0.9 17%0.1512%0.11

5%0.04 ND

P471 Auto 11.4 0.93 47%0.4435%0.32

5%0.04 ND

P509 Auto 7.2 1.46 78%1.1467%0.98

9%0.13 ND

P747 Auto 6.1 1.38 82%1.1347%0.65

32%0.44 0

P708 Auto 4.6 2.78 88%2.4544%1.22

47%1.31

0%0.05

P396 Allo 8.1 1.54 58%0.8947%0.72

20%0.31

21%1.7

P410 Allo 5.9 2.81 70%1.9731%0.87

32%0.90 ND

P411 Allo 4.5 1.72 80%1.3848%0.83

32%0.55 ND

P513 Allo 6.7 2.27 41%0.9324%0.54

15%0.34 ND

P580 Allo 6.1 2.1 86%1.8168%1.43

15%0.32

5%0.29

P459 Allo 10.6 2.29 82%1.8851%1.17

28%0.64 ND

P564 Allo 4.4 1.3 64%0.8352%0.68

12%0.16

18%0.81

P617 Allo 7.1 1.55 82%1.2761%0.94

17%0.26

8%0.58

P671 Allo 5.4 1.7 78%1.3353%0.90

24%0.41

3%0.17

P723 Allo 8.6 2.61 69%1.8050%1.30

20%0.52

7%0.59

P732 Allo 6.7 1.68 78%1.3152%0.87

22%0.37

6%0.39

P641 Allo 9.0 2.13 74%1.5857%1.21

15%0.32

9%0.78

P647 Allo 12.1 2.29 73%1.6754%1.24

18%0.41

9%1.11

P716 Allo 3.0 1.83 75%1.3759%1.08

11%0.20 0

P718 Allo 6.2 1.99 87%1.7373%1.45

12%0.24

1%0.07

P771 Allo 13.1 3.23 83%2.6869%2.23

13%0.42

6%0.79

P783 Allo 8.1 1.54 73%1.1242%0.65

27%0.42

6%0.52

WBC=whitebloodcellcount(automatedcompletebloodcounts)ALC=absolutelymphocytecount(automatedcompletebloodcounts)ATC=absoluteT-cellcount(ALCx%CD3)CD4&CD8=ALC%(CD4orCD8)ABC=absoluteB-cellcount(ALCx%CD19)ND=notdetected%CD3,%CD4,%CD8and%CD19(ABC)werecalculatedfromlymphocytegate(FSC/SSC)usingflowcytometry

Supplemental Table 2: Characterization of T cells during and after SB electrotransfer and expansion on AaPC/cytokines

UPN AutoorAllo

Day1afterelectroporation(%)*

Day7ofco-culture

(%)

Day14ofco-culture

(%)

Day21ofco-culture

(%) Day28ofco-culture(%)

**CD56depletion

SB11PCR G-bandingKaryotype

CD3 CAR CD3 CAR CD3 CAR CD3 CAR CD3 CAR CD4 CD8 GAPDHControl Day14

Day21

Day28

P446 Auto 83 67 79 43 99 65 99 85 99 88 6 95 Days7,10 + - Normal P458 Auto 48 47 87 44 99 93 99 85 99 77 38 47 Day9 + - Normal P468 Auto 61 38 86 34 97 79 97 69 98 86 1 91 Day10 + - Normal P471 Auto 84 38 75 34 99 53 99 89 99 96 7 87 None + - Normal P509 Auto 90 38 79 57 97 85 99 87 99 96 10 84 None + - Normal P747 Auto 90 75 96 26 80 40 97 79 99 88 3 86 Day15 + + - ND P708 Auto 78 87 73 18 86 46 99 78 100 91 3 95 Days7,14 + - ND P396 Allo 84 55 92 78 97 86 99 88 99 97 3 97 None + - Normal P410 Allo 61 48 88 54 94 70 98 84 99 90 4 92 None + - Normal P411 Allo 85 49 61 59 81 54 85 60 99 71 42 52 Day7 + - Normal P513 Allo 83 29 69 26 99 86 99 92 99 88 1 96 None + - ND P580 Allo 79 77 95 54 97 78 97 66 99 70 12 85 Day14 + - ND P459 Allo 91 40 93 39 96 81 98 95 99 91 30 64 None + - Normal P564 Allo 74 67 84 40 79 93 99 92 99 91 6 92 Day14 + - ND P617 Allo 93 77 68 20 94 50 97 61 99 67 3 64 Day7 + - ND P671 Allo 86 82 NA NA 81 45 98 81 100 95 8 91 Day11 + - ND P723 Allo 85 61 84 54 97 34 97 26 95 47 10 71 Day14 + + - ND P732 Allo 76 66 93 50 93 29 96 68 98 84 11 75 None + - - ND P641 Allo 87 80 46 32 95 60 92 72 96 75 13 70 None + - - NDP647 Allo 79 76 62 27 80 56 99 82 99 87 27 72 Days7,14 + - - NDP716 Allo 13 15 44 33 98 84 99 73 97 65 6 91 Day7 + - NDP718 Allo 90 77 87 34 87 57 99 65 99 92 14 75 Day14 + + - ND

P771 Allo 83 75 84 45 98 71 97 75 97 93 31 66 Day15 + + - NDP783 Allo 33 38 86 51 98 68 99 78 99 94 4 92 Day15 + + - ND*Dayofelectroporation,definedasDay0**DayofcultureND=Notdone

Supplemental Table 3: Genes measured using digital bar-coded probes (for nCounter Analysis

System)

CODESETDETAILS

Gene Accession

TargetRegion TargetSequence

ABCB1NM_000927.3

3911-4010

TATAGCACTAAAGTAGGAGACAAAGGAACTCAGCTCTCTGGTGGCCAGAAACAACGCATTGCCATAGCTCGTGCCCTTGTTAGACAGCCTCATATTTTGC

ABCG2NM_004827.2 286-385

AGGATTTAGGAACGCACCGTGCACATGCTTGGTGGTCTTGTTAAGTGGAAACTGCTGCTTTAGAGTTTGTTTGGAAGGTCCGGGTGACTCATCCCAACAT

CCR10NM_001296.3

1346-1445

GAACAGATGGGAACCAGCTCAATTGGGTGTCCACTCAAAGTGCTCTCTCCAGGGGCCTCAGTGACTGTGTTGCTAAACCCAGTGGTCAGTTCTCAGTTCT

ACTBNM_001101.2

1011-1110

TGCAGAAGGAGATCACTGCCCTGGCACCCAGCACAATGAAGATCAAGATCATTGCTCCTCCTGAGCGCAAGTACTCCGTGTGGATCGGCGGCTCCATCCT

ADAM19NM_023038.3

1691-1790

GAGAAGGTGAATGTGGCAGGAGACACCTTTGGAAACTGTGGAAAGGACATGAATGGTGAACACAGGAAGTGCAACATGAGAGATGCGAAGTGTGGGAAGA

AGERNM_001136.3 341-440

GAAAGGAGACCAAGTCCAACTACCGAGTCCGTGTCTACCAGATTCCTGGGAAGCCAGAAATTGTAGATTCTGCCTCTGAACTCACGGCTGGTGTTCCCAA

AHNAKNM_001620.1

15421-15520

GGATTTGACCTGAATGTTCCTGGGGGTGAAATTGATGCCAGCCTCAAGGCTCCGGATGTAGATGTCAACATCGCAGGGCCGGATGCTGCACTCAAAGTCG

AIF1NM_032955.1 316-415

AAAAGCGAGAGAAAAGGAAAAGCCAACAGGCCCCCCAGCCAAGAAAGCTATCTCTGAGTTGCCCTGATTTGAAGGGAAAAGGGATGATGGGATTGAAGGG

AIM2NM_004833.1 608-707

ACGTGCTGCACCAAAAGTCTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTTTCAGAAGCGCTGTTTG

p38NM_006303.3 508-607

CCCTCTCCCTGCTTGTGCTGCACAGGCTGCTCTGTGAGCACTTCAGGGTCCTGTCCACGGTGCACACGCACTCCTCGGTCAAGAGCGTGCCTGAAAACCT

C11ORF17NM_020642.3 571-670

GAACATCTCTAAGGACCTCTACATAGAAGTATATCCAGGGACCTATTCTGTCACTGTGGGCTCAAATGACTTAACCAAGAAGACTCATGTGGTAGCAGTT

AKT1NM_005163.2

1773-1872

TTCTTTGCCGGTATCGTGTGGCAGCACGTGTACGAGAAGAAGCTCAGCCCACCCTTCAAGCCCCAGGTCACGTCGGAGACTGACACCAGGTATTTTGATG

ALDH1A1NM_000689.4 277-376

TTGCTGAGCCAGTCACCTGTGTTCCAGGAGCCGAATCAGAAATGTCATCCTCAGGCACGCCAGACTTACCTGTCCTACTCACCGATTTGAAGATTCAATA

ANXA1NM_000700.1 516-615

GAAATCAGAGACATTAACAGGGTCTACAGAGAGGAACTGAAGAGAGATCTGGCCAAAGACATAACCTCAGACACATCTGGAGATTTTCGGAACGCTTTGC

ANXA2P2NR_003573.1 258-357

ATATTGTCTTCTCCTACCAGAGAAGGACCAAAAAGGAACTTGCATCAGCACTGAAGTCAGCCTTATCTGGCCACCTGGAGACGGTGATTTTGGGCCTATT

Apaf1NM_181869.1

1161-1260

TTCTGATGAAACTGCAGAATCTTTGCACACGGTTGGATCAGGATGAGAGTTTTTCCCAGAGGCTTCCACTTAATATTGAAGAGGCTAAAGACCGTCTCCG

aqp9NM_020980.3

1503-1602

TCATCCTCGATGGGAATTCTTGCTAGGTAAGCACTAATAACTCGGCATCTTGACGATAGTCCCATTTGGGTGGTTTCAGCTGCACTATCTGTATGAAATG

ARG1NM_000045.2 506-605

AAGGAACTAAAAGGAAAGATTCCCGATGTGCCAGGATTCTCCTGGGTGACTCCCTGTATATCTGCCAAGGATATTGTGTATATTGGCTTGAGAGACGTGG

ArntlNM_001030272.1 841-940

GATGTGACCGAGGGAAGATACTCTTTGTCTCAGAGTCTGTCTTCAAGATCCTCAACTACAGCCAGAATGATCTGATTGGTCAGAGTTTGTTTGACTACCT

Beta-arrestin(ARRB2andARRB2)

NM_004313.3

1653-1752

CATTAATTTTTTGACTGCAGCTCTGCTTCTCCAGCCCCGCCGTGGGTGGCAAGCTGTGTTCATACCTAAATTTTCTGGAAGGGGACAGTGAAAAGAGGAG

ATF3 NM_0010 601-700 GGCTCAGAATGGGAGGACTCCAGAAGATGAGAGAAACCTCTTTATCCAACAGATAA

30287.2 AAGAAGGAACATTGCAGAGCTAAGCAGTCGTGGTATGGGGGCGA

ATMNM_000051.3 31-130

ACGCTAAGTCGCTGGCCATTGGTGGACATGGCGCAGGCGCGTTTGCTCCGACGGGCCGAATGTTTTGGGGCAGTGTTTTGAGCGCGGAGACCGCGTGATA

atn1NM_001007026.1

2857-2956

CCCTACCTGGGTCCTGACACTCCAGCCTTGCGCACTCTCAGTGAATATGCCCGGCCTCATGTCATGTCTCCTGGCAATCGCAACCATCCATTCTACGTGC

ATP2B4NM_001684.3

7641-7740

CTTCCCATAGTATCATCTGTCCTCTGGAATGACTCTCCTGTCCCTAAAGGGGTTAAGAGAGAGATCACCTAGAAATCCCTCTGGACACTTGTGGGTTCTT

Axin2NM_004655.3

1036-1135

CTTGTCCAGCAAAACTCTGAGGGCCACGGCGAGTGTGAGGTCCACGGAAACTGTTGACAGTGGATACAGGTCCTTCAAGAGGAGCGATCCTGTTAATCCT

B2MNM_004048.2 236-335

TACTGAAGAATGGAGAGAGAATTGAAAAAGTGGAGCATTCAGACTTGTCTTTCAGCAAGGACTGGTCTTTCTATCTCTTGTACTACACTGAATTCACCCC

CD57/B3GAT1

NM_018644.3 146-245

CTGGACAGCGACCCCTTCTCAGACTCCAGTTGGGCCGGACTCTCCAAACCTGCTTCCGCAATGGGTGGGTTGTGAGTGCTGGTAATGAGGAGCCGTGGGT

BACH2NM_021813.2

3396-3495

TGTGGCACTGTTCATCTGCTGTCCCGAAGAAACCGAGAACACATTTGGTGCACACTACAGCGGTCTTAGCAGCAATACTGTTCCGAAGTATCCTCTCCTC

BADNM_004322.2 196-295

CAGCTGTGCCTTGACTACGTAACATCTTGTCCTCACAGCCCAGAGCATGTTCCAGATCCCAGAGTTTGAGCCGAGTGAGCAGGAAGACTCCAGCTCTGCA

RAP46NM_004323.3

1491-1590

CTCTTGTGATCGTGTAGTCCCATAGCTGTAAAACCAGAATCACCAGGAGGTTGCACCTAGTCAGGAATATTGGGAATGGCCTAGAACAAGGTGTTTGGCA

BATFNM_006399.3 294-393

CCTGGCAAACAGGACTCATCTGATGATGTGAGAAGAGTTCAGAGGAGGGAGAAAAATCGTATTGCCGCCCAGAAGAGCCGACAGAGGCAGACACAGAAGG

BAXNM_138761.2 695-794

ATTTTTCTGGGAGGGGTGGGGATTGGGGGACATGGGCATTTTTCTTACTTTTGTAATTATTGGGGGGTGTGGGGAAGAGTGGTCTTGAGGGGGTAATAAA

BCL10NM_003921.2

1251-1350

TGAAAATACCATCTTCTCTTCAACTACACTTCCCAGACCTGGGGACCCAGGGGCTCCTCCTTTGCCACCAGATCTACAGTTAGAAGAAGAAGGAACTTGT

Bcl11bNM_022898.1

3421-3520

GAGATGTAGCACTCATGTCGTCCCGAGTCAAGCGGCCTTTTCTGTGTTGATTTCGGCTTTCATATTACATAAGGGAAACCTTGAGTGGTGGTGCTGGGGG

Bcl2NM_000633.2

1526-1625

CCAAGCACCGCTTCGTGTGGCTCCACCTGGATGTTCTGTGCCTGTAAACATAGATTCGCTTTCCATGTTGTTGGCCGGATCACCATCTGAAGAGCAGACG

BCL2L1NM_138578.1

1561-1660

CTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAG

BCLxLNM_001191.2 261-360

ATCTTGGCTTTGGATCTTAGAAGAGAATCACTAACCAGAGACGAGACTC