Supplemental Figure 1 - The Plant · PDF file 4/6/2011  · Supplemental Figure 1....

Click here to load reader

  • date post

    11-Aug-2020
  • Category

    Documents

  • view

    0
  • download

    0

Embed Size (px)

Transcript of Supplemental Figure 1 - The Plant · PDF file 4/6/2011  · Supplemental Figure 1....

  • GS T-

    NT 1L

    GS T

    kD 37

    26

    -

    -

    HisB”β (88-536)

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    61-

    HisB”α

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    70-

    GS T-

    NT 1L

    GS T

    kD 37

    26

    -

    -

    GS T-

    NT 1L

    GS T

    kD 37

    26

    -

    -

    HisB”β (88-536)

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    61-

    HisB”β (88-536)

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    61-

    HisB”α

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    70-

    HisB”α

    In pu

    t

    GS T

    GS T-

    NT 1L

    kD

    70-

    BD P53 laminine NT1L CD1 HMGS MVK ΔNtFPS1 SQS1

    AD-AtB”α - - - + - - - - - AD-AtB”β (88-536) - - - + - - - - - AD-B”α

    AD-B”β (88-536)

    BD P53 laminine NT1L CD1 HMGS MVK ΔNtFPS1 SQS1

    AD-AtB”α - - - + - - - - - AD-AtB”β (88-536) - - - + - - - - - AD-B”α

    AD-B”β (88-536)

    AD-B”α

    AD-B”β (88-536)

    AD

    BD-NT1L HIS3 LacZ

    AD-B”α

    AD-B”β (88-536)

    AD

    BD-NT1L HIS3 LacZ

    A

    B

    C

    Supplemental Figure 1. Specific interaction of B”α and B”β(88-538) with the N-terminal region of HMGR1L

    Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    (A) Two-hybrid analysis in the yeast strain Y190. Yeast cells were cotransformed with a pAS2.1- derivative encoding BD-NT1L and either control pACT plasmid encoding AD or pACT-derivatives encoding AD fused to the complete B”α or the truncated version of B”β (residues 88-536). Interaction between the assayed partners was confirmed by the occurrence of growth on selective medium without histidine (HIS3 lanes) and β-galactosidase activity (LacZ lanes).

    (B) Two-hybrid analysis in the yeast strain CG-1945. Cells harboring the indicated plasmid combinations were plated on selective medium without histidine. The occurrence (+) or absence (-) of growth and β-galactosidase activity is indicated.

    (C) In vitro GST pull-down analysis. Agarose beads carrying GST or GST-NT1L were incubated with equivalent amounts of radiolabeled in vitro-synthesized HisB”α or HisB”β(88-536). Pictures on the left and the center show fluorograms of the radiolabeled products retained by the resins, whereas the picture on the right shows a coomassie-stained gel with the GST-NT1L bait and control GST used in the assay.

    Supplemental Figures page 1/4

  • b”β -1

    wtbp

    434- fgfg

    Ler

    b”β -1

    wtbp

    434- fgfg

    Ler

    Supplemental Figure 2. RT-PCR analysis of the b”β-1 mutant

    Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    Total RNA was extracted from Arabidopsis Ler wt and Ler b”β-1 mutant seedlings grown in MS medium for 14 days, under long-day conditions. The presence of the B”β transcript was examined by first strand cDNA synthesis and PCR amplification with primers f and g.

    Supplemental Figures page 2/4

  • BD-PR65

    BD-NT1S

    BD-NT1L

    AD-B”α AD-B”α(1-397) His3 His3LacZ LacZ

    BD-PR65

    BD-NT1S

    BD-NT1L

    AD-B”α AD-B”α(1-397) His3 His3LacZ LacZ

    Supplemental Figure 3. Two-hybrid analysis of B”α(1-397)

    Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    Yeast Y190 cells were co-transformed with a pAS2.1-derivatives encoding BD-PR65, BD-NT1S or BD-NT1L and pACT2-derivatives encoding AD-B”α or AD-B”α(1-397). The absence of growth (HIS3 lane) and staining (LacZ lane) indicates failure of interaction between the assayed proteins. BD-PR65 corresponds to the A2 (pDF1) variant of PR65.

    Supplemental Figures page 3/4

  • wt Ler b”β-1

    0

    5

    10

    15

    20

    25

    wt b”β-1 Ler

    Se ed

    l. es

    ta bl

    is h.

    ( %

    ) *

    Supplemental Figure 4. Seedling establishment analysis of the b”β-1 mutant

    Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    Seedling establishment assays were performed to compare the HMGR activity of the b”β-1 mutant and its wild type parental line (Ler) in vivo. Seeds were vernalized at 4º C for three days and germinated on polyester filters layered on MS medium containing 4 µM mevinolin or 4 µM lovastatin. The appearance of true leaves was evaluated after 16 days of growth at 22º C, under long day conditions. The graph shows the average and SD of three independent assays with 50 plants per assay and genotype. Under the experimental conditions, nearly no Ler plant could develop true leaves, whereas about 20 % of b”β-1 plants overcame the statin blockage. The asterisk indicates the level of statistical significance as determined for Student’s t test: *, P < 0.005 for b”β-1 versus wt.

    Supplemental Figures page 4/4

  • Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    Supplemental Table 1: PCR Primers

    18F  5’‐gatccagctctagctcg^gagg‐3’  18R  5’‐gatgacctggcaacttctccttg‐3’  22F  5’‐ggctgtttccactgag^gtggc‐3’  22R  5’‐gtcagacaacttctttaccccag‐3’  25GSP1  5’‐aggctcgttgactactttg‐3’  25GSP2  5’‐ttagaaggggctctctgtttg‐3’  25F‐XhoI  5’‐ccgctcgagccatggtggatacggttattccc‐3’  25R‐XhoI  5’‐ccgctcgagttcttttgttgacttgctacctc‐3’  25totF  5’‐gaagactagattcgatgtgttg‐3’  25totR  5’‐ttcttttgttgacttgctacctc‐3’  264F  5’‐gagctgaa^gtggcttccatgac‐3’  264R  5’‐ggtccgacatacccatgatcc‐3’  29aF1  5’‐ggaagagtcggctgtttcagac‐3’  29aR1  5’‐ccggtactcctccagttt^cttc‐3’  764F  5’‐catctatcgag^gtggggacag‐3’  764R  5’‐gctcctttaactccgagcagg‐3’  a  5’‐ctcaatgttgcttgcgggagtg‐3’  b  5’‐ggaattcctgaggaatacacc‐3’  c  5’‐gagattcgagtggttcatcc‐3’  e  5’‐aggtgtattcctcaggaattcc‐3’  f  5’‐ggctgtctcatttccttgttcgg‐3’  g  5’‐tcttggtgaaagaggaggagcg‐3’  h  5’‐ttcctcattcgtcag^gagcgc‐3’  i  5’‐aacatcttcttccattgatagccg‐3’  E5‐1  5’‐gtcagatatccatggaaatcgatggtggaaacgat‐3’  E5‐2  5’‐cagtgatatcaatactcaagactaggctcagatg‐3’  H1.2R  5’‐gtcgctagcctcctttgcgttc‐3’  H1.3F  5’‐gctagcactaacagaggctgca‐3’  H2.3R  5’‐gatcctttcacaccgagtag‐3’  H2.4F  5’‐ctgtatccgaggtttgcgtg‐3’  HMGS‐F  5’‐cgaacatatggcgaagaacgttgggattttg ‐3’  HMGS‐R  5’‐ttcagaattcagtgtccattggctacagatcc‐3’  K2F  5’‐agctggagcacaacag^gcgg‐3’  K2R  5’‐ttcaggccggtcttgtccttc‐3’   NT1LF‐EcoRI  5’‐ggaattcatgaagaaaaagcaagctggtcc‐3’  NT1LR‐BamHI  5’‐gtgcggatcctggagggaatgaataatctctcc‐3’  NT1NF‐NcoI  5’‐gacatgccatggatctccgtcggaggcc‐3’  NT1NR‐BamHI  5’‐gtgcggatcccgcgtcggatgctttcggtg‐3’  NT2F‐NcoI  5’‐gacatgccatggaggatctccgtcgtagatttc‐3’  NT2R‐BamHI  5’‐gtgcggatcccgcgtcagaggctttacgaagag‐3’  NTGSTF‐HindIII  5’‐tacccaagcttatgtcccctatactaggttattg‐3’  pACTBF  5’‐ataccactacaatggatgatg‐3’  pASR  5’‐taaaacctaagagtcac‐3’  pGEX3’R  5’‐ggcagatcgtcagtcagtcac‐3’  SQS1F  5’‐ggaacatatggggagcttggggacgatg‐3’  SQS1R  5’‐acatggatccctcagtttgctctgagatatgc‐3’  T7  5’‐gtaatacgactcactataggg‐3’

    ^: position of an exon-exon junction

    Supplemental Table 1 : PCR primers    page 1/1 

  • Supplemental Data. Leivar et al. Plant Cell. (2011). 10.1105/tpc.110.074278

    Supplemental Table 2: Plasmid constructs The plasmid constructs, numbered on the left, are defined by the encoded protein. The plasmids were obtained by ligation of the indicated insert and vector. Inserts were obtained from its plasmid source either directly by restriction enzyme digestion or by PCR and subsequent restriction enzyme digestion.

    Construct  Insert  Vector  Number  Encoded Protein  Plasmid source 

    Primers  for PCR  Digestion  Name*  Cloning sites

    #1  AD‐B”α  Plasmid #3    BglII  pACT2  BamHI 

    #2  AD‐B”α(1‐397)  Plasmid #1  E5‐1  E5‐2 

    EcoRV  pACT2  SmaI 

    #3  AD‐B”α(1‐538)  pACT‐B”α(1‐538) Clone of the pACT library (Kim et al., 1997) obtained by screening with the BD-NT1L bait

    #4  AD‐B”β  Plasmid #6  25F‐XhoI  25R‐XhoI 

    XhoI  pACT2  XhoI 

    #5  AD‐B”β(88‐536)  pACT‐B”β (88‐536) Clone of the pACT library (Kim et al., 1997) obtained by screening with the BD-NT1L bait

    #6  B”β  pACT library (Kim et al., 1997) 25totF  25totR 

      pGEM‐T Easy   

    #7  BD‐CD1  pHMGR1 cd (Dale et al., 1995)   NdeI  EcoRI 

    pAS2‐1  NdeI  EcoRI 

    #8  BD‐HMGS  pACT library (Kim et al., 1997) HMGS‐F  HMGS‐R 

    NdeI  EcoRI 

    pAS2‐1  NdeI  EcoRI 

    #9  BD‐MVK  MVA‐K‐pFL61 (Riou et al., 1994)   EcoRI  SalI 

    pAS2‐1  EcoRI  SalI 

    #10  BD‐NT1L  pDS6‐HMGR1L (Lumbreras et al., 1995) NT1LF‐EcoRI  NT1NR‐BamHI 

    EcoRI  BamHI 

    pAS2‐1  EcoRI  BamHI 

    #11  BD‐NT1S  Plasmid  #24  NT1NF‐NcoI  NT1NR‐BamHI 

    NcoI