Studies on the biological functions of interaction...
Transcript of Studies on the biological functions of interaction...
Studies on the biological functions of interaction between components in Wnt, TGF-β and HIF pathways for
cancer progression
KARTHIK ARIPAKA
Department of Medical Biosciences Umeå 2019
This work is protected by the Swedish Copyright Legislation (Act 1960:729)
Copyright © Karthik Aripaka
Dissertation for PhD
ISBN: 978-91-7855-140-8
ISSN: 0346-6612
New series no: 2060
Electronic version available at: http://umu.diva-portal.org/
Printed by: Cityprint i Norr AB
Umeå, Sweden 2019
Cover picture front: Cancer cell signalling and targeting
Cover picture back: Immunofluorescence image showing protein expression of LRP5 (red)
and TRAF6 (green) in PC3U cells with nuclei stained by DAPI (blue). Co-localisation of
LRP5 and TRAF6 was observed (yellow) in the merged image (bottom right)
Cover picture design and composition: Designed by Karthik Aripaka using vector
resources from Freepik.com
You have to dream before your dreams can come true.
The dream is not that which you see while sleeping; it i s something
that does not let you s leep.
Dream, Dream, Dream; Dream transform into thoughts and
thoughts result in action.
- A P J Abdul Kalam
ii
iii
To my father and mother
iv
v
Table of contents
TABLE OF CONTENTS .............................................................................................. V ABSTRACT ............................................................................................................... VII ORIGINAL PAPERS .................................................................................................. IX ABBREVIATIONS ........................................................................................................ X ENKEL SAMMANFATTNING PÅ SVENSKA .................................................... XIII INTRODUCTION / BACKGROUND ......................................................................... 1 1. Cancer: ................................................................................................................... 1
1.1. Prostate Cancer: ............................................................................................ 3 1.2. Renal Cell Carcinoma: .................................................................................. 6
2. Wnt signalling Pathway: ....................................................................................... 9 2.1. Canonical Wnt/β-catenin Pathway ............................................................. 11 2.2. Non-canonical Wnt pathways ..................................................................... 14 2.3. Wnt signalling in development ................................................................... 16 2.4. Wnt signalling in adult tissue homeostasis................................................. 18 2.5. Wnt signalling in cancer .............................................................................. 19
3. TGF-β signalling pathway: ................................................................................. 21 3.1. Smad signalling (Canonical): ...................................................................... 22 3.2. Non-Smad signalling (Non-Canonical): ..................................................... 24 3.3. TGF-β signalling in cancer: ........................................................................ 26
4. HIF (Hypoxia-inducible factor) system.............................................................. 28 4.1. Components of the HIF pathway ................................................................ 29 4.2. HIF signalling: ............................................................................................. 32
5. Epithelial to mesenchymal transition (EMT) .................................................... 34 6. Ubiquitination: ..................................................................................................... 36 7. TRAF6: ................................................................................................................. 39 AIMS ............................................................................................................................. 43 MATERIALS AND METHODS ................................................................................ 44 Materials: ..................................................................................................................... 44
Chemicals and reagents: ............................................................................................ 44 Instruments: ............................................................................................................... 45 Cell lines: ................................................................................................................... 46 Plasmids: .................................................................................................................... 47 siRNA: ....................................................................................................................... 47 Patients and tumour samples: .................................................................................... 48
Methods: ....................................................................................................................... 48 Invitro cell culture and transfections: ........................................................................ 48 Immunoblotting (IB) and Immunoprecipitation (IP): ................................................ 49 Immunofluorescence: ................................................................................................ 52 Dual-Luciferase assay: ............................................................................................... 52 Proximity Ligation assay (PLA): ............................................................................... 52 Ubiquitination Assay: ................................................................................................ 53 Quantitative real-time PCR: ....................................................................................... 53 Invasion Assay: .......................................................................................................... 54 Label-free monitoring of a TRAF6-LRP5 protein interaction: .................................. 54 In silico gene expression analysis: ............................................................................. 55
vi
Statistical analysis: ..................................................................................................... 55 Zebrafish Strains and Maintainance: ......................................................................... 55 CRISPR/Cas9 mediated generation Zebrafish TRAF6 mutants: ............................... 56 Zebrafish DNA - RNA extraction and quantitative RT-PCR: ................................... 56 Whole Mount staining for Zebrafish bone: ................................................................ 57
RESULTS AND DISCUSSION .................................................................................. 58 Paper I: ......................................................................................................................... 58 Paper II:........................................................................................................................ 61 Paper III: ...................................................................................................................... 64 CONCLUDING REMARKS ...................................................................................... 67 ACKNOWLEDGEMENTS ........................................................................................ 69 REFERENCES ............................................................................................................ 74
vii
Abstract
Cancer is a disease that involves aggressive changes in the genome and aberrant signals between the living cells. Signalling pathways such as TGF-β (Transforming growth factor-β), Wnt, EGF (epidermal growth factor) and HIF (Hypoxia-inducible factor) evolved to regulate growth and development in mammals are also implicated for tumorigenesis due to failure or aberrant expression of components in these pathways. Cancer progression is a multistep process, and these steps reflect genetic alterations driving the progressive transformation of healthy human cells into highly malignant derivatives. Many types of cancers are diagnosed in the human population, such as head & neck, cervical, brain, liver, colon, prostate, uterine, breast, and renal cell cancer.
Prostate cancer is the second most common cancer and one of the foremost leading cancer-related deaths in men in the world. Aberrant Wnt3a signals promote cancer progression through the accumulation of β-Catenin. In the first paper, we have elucidated intriguing functions for TRAF6 (Tumour necrosis factor receptor-associated factor-6) as a coregulatory factor for the expression of Wnt-target genes which was confirmed in vivo by using CRISPR/Cas9 genomic editing, in zebrafish. Our data suggest that Wnt3a promotes TRAF6 interaction with Wnt components, and TRAF6 is required for gene expression of β-Catenin as well as for the Wnt-ligand co-receptor LRP5. From the in vivo studies, we elucidated positive regulation of TRAF6, which is crucial for survival and development of zebrafish. This study identifies TRAF6 as an evolutionary conserved co-regulatory protein in the Wnt pathway that also promotes the progression of prostate and colorectal cancer due to its positive effects on Wnt3a signalling.
Hypoxia is a condition due to O2 deprivation, and Hypoxia-inducible factors (HIF) transcription factors are responsible for the maintenance of oxygen homeostasis in living cells. Irregularities in these HIF transcription factors trigger pathological cellular responses for initiation and progression of malignant cancers. Renal cell carcinoma, a malignant cancer arising in renal parenchyma and renal pelvis and, hypoxia plays a
viii
vital role in its progression. In the second paper, we have investigated the clinicopathological relevance of several hypoxic and TGF-β component proteins such as HIF-1α/2α/3α, TGF-β type 1 receptor (ALK5-FL) and the intracellular domain of ALK5 (ALK5-ICD), SNAI1 and PAI-1 with patient survival in clear cell renal cell carcinoma (ccRCC). We showed that HIF-2α associated with low cancer-specific survival. HIF-2α and SNAI1 positively correlated with ALK5-ICD, pSMAD2/3, PAI-1 and SNAI1 with HIF-2α; HIF-1α positively correlated with pSMAD2/3. Further, under normoxic conditions, our data suggest that ALK5 interacts with HIF-1α and HIF-2α, and promotes their expression and target genes such as GLUT1 and CA9, in a VHL dependent manner through its kinase activity. These findings shed light on the critical aspect of cross-talk between TGF-β signalling and hypoxia pathway, and also the novel finding of an interaction between ALK5 and HIF-α might provide a more in-depth understanding of mechanisms behind tumour progression
In the third paper, an ongoing study, we investigated the role of HIF-3α in the progression of Renal cell carcinoma and its association with the components of TGF-β and HIF pathways. We have observed increased levels of HIF-3α in ccRCC and pRCC (papillary renal cell carcinoma) which are associated with advanced tumour stage, metastasis and larger tumours. Also, we found HIF-3α show a significant positive association with pro-invasive gene SNAI1, which is a crucial regulator of epithelial to mesenchymal transition. TRAF6 an E3 ligase known to be a prognostic marker in RCC and we observed HIF-3α associates with TRAF6.
ix
Original Papers
I. TRAF6 function as a novel co-regulator of Wnt3a target genes in prostate cancer.
Karthik Aripaka, Shyam Kumar Gudey, Guangxiang Zang, Alexej Schmidt, Samaneh Shabani Åhrling, Lennart Österman, Anders Bergh, Jonas von Hofsten, Marene Landström. EBioMedicine. 2019 Jun 28. Volume 45, Pages 192–207
II. Interactions between TGF-β type I receptor and hypoxia-inducible factor-α mediates a synergistic crosstalk leading to poor prognosis for patients with clear cell renal cell carcinoma.
Pramod Mallikarjuna, Tumkur Sitaram Raviprakash, Karthik Aripaka, Börje Ljungberg & Marene Landström. Cell Cycle. 2019 Jul 24. Volume 18, Pages 2141-2156
III. Expression and association of HIF-3α with hypoxic and TGF-β signalling components in Renal cell carcinoma. (on-going manuscript )
Pramod Mallikarjuna, Karthik Aripaka, Tumkur Sitaram Raviprakash, Börje Ljungberg & Marene Landström.
x
Abbreviations
ALK5 Activin A receptor type II-like kinase 5 AMH Anti-Mullerian Hormone Angptl4 Angiopoietin-like 4 APC Adenomatous polyposis coli ARNT Aryl hydrocarbon receptor nuclear translocator ATF2 Activating Transcription Factor 2 ATP Adenosine triphosphate BCL2/9 B-cell lymphoma 2/9 BHD Birt-Hogg-Dube syndrome bHLH Basic helix-loop-helix domain BMP Bone morphogenetic protein BRCA1&2 Breast Cancer Type 1 Susceptibility Protein 1&2 CA9 Carbonic anhydrase 9 CAFs Cancer-associated fibroblasts CAMKII Ca2+/calmodulin-dependent kinase II Cas9 CRISPR associated protein-9 nuclease CBP cAMP response element-binding protein (CREB)-
binding protein CCND1 Cyclin D1 ccRCC Clear cell renal cell carcinoma CDK Cyclin-dependent kinases CK1α Casein kinase 1α CRISPR Clustered regularly interspaced short Palindromic
repeats CRPC Castration-resistant prostate cancer DAAM1 Dishevelled associated activator of morphogenesis DAG 1,2 diacylglycerol DAPK Death-associated protein kinase DKK Dickkopf DUB Deubiquitinating enzymes DVL Dishevelled EGF Epidermal growth factor EMT Epithelial to mesenchymal transition EPHB3 Ephrin Type-B Receptor 3 ERG Erythroblast transformation-specific related gene FGF Fibroblast growth factors
xi
FH Fumarate hydratase FZD Frizzled GDFs Growth and differentiation factors GLUT1 Glucose transporter 1 GRHL2 Grainyhead Like Transcription Factor 2 GSK3β Glycogen synthase kinase-3β HCC Hepatocellular carcinoma HDAC Histone deacetylases HIF Hypoxia inducible factor HOXB13 Homeo Box B13 HPC1/2 Hereditary prostate cancer 1/2 HRE Hypoxia-responsive elements hTERT Human telomerase reverse transcriptase IGF-I Insulin growth factor-I IP3 Inositol 1,4,5-triphosphate JNK c-Jun N-terminal kinases LDLR Low-density lipoprotein receptor LGR5 Leucine-rich repeat-containing G-protein coupled
receptor 5 LRP5/6 Low-density lipoprotein receptor-related protein
5/6 LTBP Latent TGF-β binding protein MAPK Mitogen-activated protein kinase MIR Mortality to incidence ratio MMP7 Matrix Metalloproteinase 7 MMTV Mouse Mammary tumour virus MSX2 Msh Homeobox 2 mTOR Mammalian target of rapamycin NFAT Nuclear factor of activated T-cells NFκB Nuclear factor kappa-light-chain-enhancer of
activated B cells NICD Notch intra cellular domain OEA Ovarian endometrioid adenocarcinomas PAI-1 Plasminogen activator inhibitor-1 PAX6 Paired box protein Pax-6 PCP Planar cell polarity PI3K Phosphatidylinositol-3´kinase PKC Protein kinase C
xii
pRCC Papillary renal cell carcinoma PS1 Presenilin 1 PSA Prostate-specific antigen RCC Renal cell carcinoma RING Really interesting new gene RNF43 Ring finger 43 ROCK Rho-associated, coiled-coil containing protein
kinase ROR2 Receptor Tyrosine Kinase Like Orphan Receptor 2 RSPO2 R-Spondin 2 RYK Receptor Like Tyrosine Kinase sFRPs Secreted Frizzled-related proteins SGF Sarcoma growth factor SOST Sclerostin TACE TNF alpha converting enzyme TAK1 TGF-β activated kinase 1 TCFLEF T-cell factor/lymphoid enhancer-binding factor TGF-β Transforming growth factor- β TGIF Transforming Growth Factor-β Induced Factor TIRAP Toll/interleukin-1 receptor adaptor protein TMPRSS2 Transmembrane Serine Protease 2 TNF-α Tumour necrosis factor- α TRAF6 Tumour necrosis factor receptor-associated factor
6 TβRI TGFβ receptor I VEGF Vascular endothelial growth factor VHL Von Hippel-Lindau Wg Wingless WIF1 Wnt-interacting factor Wls/Evi Wnt Ligand Secretion Mediator ZEB1/2 Zinc finger E-box-binding homeobox 1/2 ZNFR3 Zinc and ring finger 3 β-Trcp β-transducin repeats-containing proteins
xiii
Enkel sammanfattning på svenska
Cancer är en sjukdom som innefattar aggressiva förändringar i genomet och abnormala signaler mellan levande celler. Signalvägar såsom Transforming Growth Factor-β (TGF-β), Wnt, Epidermal Growth Factor (EGF) och Hypoxia-inducible factor (HIF) utvecklades i mammalieceller för att reglera tillväxt och utveckling och är också involverade i tumörutveckling på grund av bristande eller abnormala uttryck av komponenter i dessa signalvägar. Progression av cancer sker i flera steg och dessa steg reflekterar genetiska förändringar som driver progressiv transdifferentiering av friska humana celler till att bli mycket maligna cancerceller. Ett flertal olika cancerformer diagnostiseras hos människor som t.ex huvud- och halscancer, hjärntumörer, levercancer, tjocktarmscancer, prostatacancer, livmodercancer, bröstcancer och njurcancer.
Prostatacancer är den näst vanligaste cancerformen och en av de vanligaste cancer-relaterade dödsorsakerna hos män globalt sett. Avvikande Wnt3a-signalering befrämjar progression av cancer pga av att β-catenin accumuleras. I den första artikeln, har vi belyst nya och spännande funktioner för Tumour necrosis factor Receptor-Associated Factor 6 (TRAF6) som en co-regulerande faktor för att reglera gener som regleras av Wnt. Detta fynd konfirmerades in vivo genom användandet av den s.k. gensaxen det vill säga CRISPR/Cas9 i zebrafisk. Våra data antyder att Wnt3a befrämjar att TRAF6 fysiskt kan binda till komponenter i Wnt-signaleringskedjan och att TRAF6 krävs för att stimulera genuttrycket av β-catenin samt för en Wnt-ligand co-receptor som heter LRP5. Från dessa in vivo studier har vi belyst hur TRAF6 är ett evolutionärt bevarat protein i Wnt-signaleringskedjan som också befrämjar tumörprogression av både prostatacancer och tjocktarmscancer pga av sina positiva effekter på Wnt3a-signalering,
Hypoxi är ett tillstånd som beror på syrebrist och hypoxia-inducible factors (HIF) som är transkriptionsfaktorer som är ansvariga för upprätthållandet av syre homeostasis i levande celler. Avvikelser i dessa HIF
xiv
transkriptionsfaktorer utlöser patologiska cellulära svar som leder till initiering och progression av maligna celler. Njurcancer uppstår i njurparenkymet och njurbäckenet och syrebrist spelar en viktig roll för att stimulera till progression av denna cancerform. I den andra artikeln har vi undersökt den kliniska och patologiska betydelsen av flera hypoxi och TGF-β signalkomponenter såsom HIF-1α/2α/3α, TGF-β Typ I receptor (ALK5-full längd) och den intracellulära domänen av ALK5 (ALK5-ICD), SNAI1 och PAI-1 med patientöverlevnad för patienter med klarcellig njurcancer (ccRCC). Vi visade att uttrycket av HIF-2α är associerat med låg cancer-specifik överlevnad. HIF-2α och SNAI1 är positivt korrelerade med ALK5-ICD, pSMAD2/3, PAI-1 och SNAI1 med HIF-2α; HIF-1α var positivt korrelerat med pSMAD2/3. Dessutom, under normala syreförhållanden visar våra data att ALK5 binder till HIF-1α och HIF-2α, och befrämjar deras uttryck samt uttrycket av deras s.k. målgener såsom GLUT1 och CA9, på ett VHL- och ALK5-kinase-beroende sätt. Dessa fynd belyser kritiska aspekter av ett samspel mellan TGF-β signalering och hypoxi, och erbjuder också en ökad förståelse genom vilka mekanismer tumörprogression styrs.
I det tredje manuskriptet, som är en pågående studie har vi undersökt rollen av HIF-3α för tumörprogressionen av njurcancer, och sambandet mellan HIF-3α och olika komponenter i TGFβ och HIF signaleringskedjan. Vi har funnit ökade nivåer av HIF-3α i klarcellig njurcancer (ccRCC) och papillär njurcancer, som var associerade med avancerat tumörstadium, metastaser och stora tumörer. Dessutom fann vi att HIF-3α uppvisade en signifikant, positiv association med den pro-invasiva genen SNAI1 som är en kritisk regulator av epitelial till mesenkymal transdifferentiering. TRAF6 som är ett E3 ubiquitin-ligase, är en prognostisk markör för njurcancer och vi har observerat att HIF-3α binder till TRAF6.
1
Introduction / Background
1. Cancer:
Living organisms need a systematic and regulated development which is
one of the most complex and intricate phenomena in nature. Growth,
differentiation and maintenance have a synergistic approach in the process
of development. As the maximum degree of differentiation is reached, the
growth comes to a halt. Multicellular organisms can regenerate/repair their
tissues during the process of injury and healing by regulated cell division
which is governed by several complex signalling networks which maintain
the tight control. In certain instances, this growth, to a certain extent, skips
from the control of the organism and expresses properties such as
uncontrolled and unlimited proliferation along with disorganised
differentiation. This type of growth further results in progressive invasion
and metastasis, leading to the destruction of healthy neighbouring tissues
and ultimately lethal to the whole organism. This phenomenon/condition
of abnormal growth is known as cancer (1, 2).
Cancers are caused due to the contribution of several factors such as
somatic or germline mutations, environmental factors, chronic infections
and dietary factors (3). Recent studies have shown that common solid
tumours display subtle mutations in ~140 driver genes out of which 95%
are single-base substitutions which confer a selective growth advantage to
the mutated cells. Driver genes through several signalling pathways,
regulate core cellular functions such as cell fate determination, cell
survival and genome maintenance. These core functions are compromised
due to mutations in the driver genes directing the cells towards cancer
2
progression (4). Cancer cells evolve progressively from healthy cells by
attaining biological capabilities gradually in the multistep process of
tumorigenesis. In 2011, Hanahan and Weinberg (5) proposed eight
hallmarks of cancer along with two enabling characteristics for
understanding the architecture behind the diversity of cancer development
(Fig.1).
Fig 1: The figure illustrates the Emerging Hallmarks of cancer and enabling characteristics proposed by Hanahan and Weinberg (5).
Various Growth factor signalling pathways are deregulated, resulting in
cancer progression, which is one of the hallmarks. Growth factors such as
3
Transforming growth factor- β (TGF-β), Fibroblast growth factors (FGF),
Tumour necrosis factor- α (TNF-α), Vascular endothelial growth factor
(VEGF), interleukins and Wnt are responsible for the release of growth-
promoting signals and regulation of cell cycle to maintain homeostasis in
the normal cells. These cancer cells attain competence to survive without
these external growth signals and develop capabilities like producing
growth factor ligands or by destroying the normal control mechanisms
which prevent negative feedback mechanism or by constitutive activation
of downstream components in a signalling pathway. Evading growth
suppressors, resisting apoptosis, uncontrolled replication, sustained
angiogenesis, activating invasion and metastasis, abnormal metabolism
and escaping immune destruction were the other proposed hallmarks (5).
1.1. Prostate Cancer:
Prostate cancer is one of the most common forms of cancer in men.
Prostate cancer is the second most frequently diagnosed cancer and the
fifth leading cause of cancer-related death in men. According to
GLOBOCAN statistics in 2018, it is estimated that the incidence of 1.3
million new cases of prostate cancer with 359,000 related deaths
worldwide (3.8% of all cancer-related deaths in men) (6, 7). High
incidence rates of prostate cancer were observed in North America,
Northern Africa, Australia and Europe, especially in Northern Europe.
High cancer-related deaths and high mortality rates were reported in the
Caribbean and African countries. Due to improved treatment with better
diagnosis and early screening methods, the prostate cancer-related death
rates were low in countries like United States, Australia, Northern and
Western Europe. Mortality to incidence ratio (MIR) of prostate cancer is
4
very low in developed countries with best health care systems such as the
United States, Norway, Sweden, Ireland and Australia (6, 8). In Sweden,
prostate cancer is the most commonly diagnosed cancer with a high
number of deaths in men compared to other cancer forms. In 2017, about
10,300 men were diagnosed, and about 2300 died with prostate cancer
(Swedish Cancer Registry, The National Board of Health and Welfare -
2017).
Fig 2: Illustration shows the anatomy of male reproductive organs with the
prostate gland and cancerous tumour. “Prostate anatomy image ©American
Cancer Society, 2017. Used with permission.”
Prostate cancer is a multifaceted disease, which can be asymptomatic as
well as a hostile, aggressive disease with poor prognosis. Prostate cancer
initially spreads to glandular acini, further extends to the outer tissue of
prostate gland, seminal vesicles and rectum (Fig 2). In the later high-grade
stages, metastasis occurs to the bone, lymph nodes and lungs (9). Most
common symptoms of this disease are painful and frequent urination,
nocturia, blood in urine, erectile dysfunction and prostatitis. In the
advanced stages, urinary retention and pain in the back might occur due to
5
metastasis in bone (10, 11). Recent research has made advances in
understanding the underlying mechanism of prostate cancer. Prostate-
specific antigen (PSA) is the widely adopted screening method, but its
application remains controversial because of the uncertainty around its
benefits and risks (12, 13). The variation in the incidence rate of prostate
cancer between the populations is linked to differences in diagnostic usage
of PSA screening. Countries with high sociodemographic index have high
incidence rates due to better screening (12, 14).
Individual biological and lifestyle factors may contribute to the risk of
developing prostate cancer such as age, ethnicity, genetics, family history,
diet and other factors. In men, the risk of prostate cancer increases with
age. Men with age over 55 years have a 17-fold higher chance of
developing prostate cancer, especially with high incidence in African-
American men and low in Asian men (14, 15). African-American men
have common chromosome variants in 8q24, shown to associate with the
occurrence of prostate cancer (16). Also, mutations in genes regulating
apoptosis such as BCL2 has been reported to cause prostate cancer in
African American men (17). Established risk factors for the incidence of
prostate cancer also linked to the genetic mutations, which can be either
dominant, recessive or X-linked. Mutations in genes like BRCA1&2 (11),
HOXB13 (18) and HPC1 & HPC2 (ELAC2) (19) are linked to the
increased risk of hereditary prostate cancer. Several genome-wide studies
in prostate cancer have reported 77 SNPs associated with the disease. One
of the SNPs is located in a non-coding region close to the c-Myc oncogene,
affecting its expression (20). TMPRSS2: ERG gene fusion is the most
common genetic alteration observed in prostate cancer patients (21).
6
ELAC2, known to be involved in prostate cancer incidence, binds to
activated SMAD2 and potentiates TGF-β regulated transcriptional
responses (22). Increased Insulin growth factor (IGF)-I levels correlate
with an elevated risk of prostate cancer (23). Disorders in androgen
receptor signalling like androgen receptor gene amplification associated
with castration-resistant prostate cancer (CRPC) (24). Dietary habits with
its range of effects also contribute to the risk of prostate cancer. High
consumption of saturated animal fats, red meat, dairy products shown to
be linked with the prostate cancer risk in several studies (15, 25).
Currently, most effective treatment methods involve histopathological
grading using a scoring system named Gleason grade, radical
prostatectomy, radiation therapy, chemotherapy, immunotherapy, bone-
targeting treatment and androgen-deprivation hormonal therapy (13, 24,
26). Relapse is a very common feature of this disease due to the
progression of cancer from hormone-sensitive to hormone-refractory state
(24). Molecular mechanisms underlying this relapse still need to be
addressed. Development of better prognostic markers and effective
treatment methods are essential future goals for the cancer researchers in
this field.
1.2. Renal Cell Carcinoma:
Renal cell carcinoma (RCC) is a common malignant cancer in adults
arising in renal parenchyma and renal pelvis. In 2012, the incidence of new
cases was estimated at 338,000 cases, with an estimated 143,000 deaths in
the world (27). According to GLOBOCAN 2018, the incidence of new
cases increased to 403,262 cases with 175,098 death cases (6). RCC is the
7
11th most common type of cancer in Sweden, and in 2018 the incidence of
new cases and the number of deaths are estimated at 1299 and 629
respectively with high incidence rates in men (6). The highest incidence of
RCC was found in European countries mainly, Czech Republic, Lithuania,
Slovakia and Denmark, followed by North America and Australia (27-29).
Established risk factors include obesity, smoking, alcohol consumption,
hypertension and familial inheritance. Incidence rates of renal cell
carcinoma increase with the increase in age with the highest incidence at
age 75 years (29, 30). Symptoms include flank pain, haematuria, palpable
abdominal mass, weight loss and anaemia (31).
RCC comprises of several histological subtypes. Clear cell renal cell
carcinoma (ccRCC) accounts for 70% of RCC followed by 10-15% of
papillary renal cell carcinoma, 5% of chromophobe renal cell carcinoma
and 1% of other rare forms (32). ccRCC also called conventional RCC,
consists of cells with clear cytoplasm and arises from proximal renal
convoluted tubular epithelial cells (33). ccRCC occurrence is usually
sporadic, but also have rare familial inheritance patterns, i.e., germline
mutations in the von Hippel-Lindau gene (VHL) which is located on the
chromosome 3p25. This mutation results in a disease called von Hippel-
Lindau disease, and patients develop ccRCC due to inherited disease (34).
Loss of heterozygosity, implying loss of one allele on chromosome 3p,
which contains a VHL gene leads to sporadic ccRCC. Also, hyper-
methylation of the VHL gene is found in 11-19% of sporadic ccRCC (35-
37).
Papillary renal cell carcinoma is the second most common RCC, which
predominantly affects males. Papillary RCC originates from distal
8
convoluted tubule with papillary or tubular architectural pattern (35).
Based on the cytoplasmic and nuclear staining, they were subdivided into
type I and type II. Missense mutations in the tyrosine kinase domain of c-
MET proto-oncogene are shown to cause type I hereditary papillary renal
cell carcinoma. Germline mutations in the FH gene encode for fumarate
hydratase; a Krebs cycle enzyme which causes type II hereditary
leiomyomatosis papillary renal-cell cancer syndrome (37, 38). Sporadic
Papillary RCC involves trisomies of chromosomes 7 and 17 and loss of Y
chromosome (33, 35).
Chromophobe renal cell carcinoma is characterised by large polygonal
cells with distinct cell border and reticulated cytoplasm and known to
originate from intercalated cells of collecting duct in the kidney. These
tumours have slow growth and infrequent metastasis with better prognosis
(33, 35, 37). 30% of chromophobe RCC reported to have mutations in the
p53 gene and also the loss of one allele in chromosome 17p was detected
in 78% of tumours (39). Hereditary chromophobe RCC characterised with
mutations in gene BHD encodes for protein folliculin, a tumour repressor
gene. These mutations lead to a rare autosomal dominant disorder called
Birt-Hogg-Dubé syndrome characterised by Hair-follicle hamartomas of
face and neck (37, 40, 41).
Treatment for RCC includes surgery (Radical and partial nephrectomy),
anti-angiogenic treatment to target VEGF and mTOR pathways with drugs
(sunitinib, sorafenib and bevacizumab), chemotherapy and
immunomodulatory therapies with interferon-α and Interleukin-2 (33, 38,
42, 43).
9
2. Wnt signalling Pathway:
Wnt signalling pathway is evolutionarily highly conserved developmental
signalling network, which operates an array of cellular processes during
development and homeostasis in every tissue of an organism. These
cellular processes involve cell proliferation, cell migration, cell polarising
intracellular signalling, cell fate specification and stem cell renewal (44,
45). Genomic sequencing of ancient metazoans have given insights about
the specificity of Wnt genes, and they are confined only to metazoans. In
unicellular eukaryotes and fungi, the existence of Wnt genes was not
reported. This shows evidence that organisms which are multicellular and
with patterned body axis exhibit complete Wnt pathway but not unicellular
organisms (46-49).
Roel Nusse and Harold E Varmus first identified Mouse Wnt1 gene in
1982 while working on Mouse Mammary tumour virus (MMTV) induced
mammary hyperplasia. Wnt1 originally called as Int-1. This gene has a
proviral integration site for MMTV and is also essential for embryonic
development in mice (50). In Drosophila, a homologue of Wnt1 known as
wingless (wg) which controls the segment polarity during larval
development (51). Thus, the genes with similar function in embryogenesis
wg and Int1 became Wnt, means Wingless- related integration site.
Wnt signalling is a short-range extracellular communication system. Cells
respond functionally to Wnt signals upon Wnt ligand stimuli. Cell surface
receptors (LRP5/6 and Frizzled) receive these ligand signals and transmit
through downstream components for cellular functional responses (52).
Wnt signalling is broadly classified into two pathways. Canonical Wnt/β-
10
catenin pathway and Non-canonical pathway. The non-canonical pathway
involves two signalling cascades Wnt/PCP and Wnt/Ca2+, which are β-
catenin independent (53).
Genome sequencing revealed 19 Wnt genes categorised into 12 conserved
subfamilies in mammals, 7 in Drosophila and 5 in C.elegans (54). Wnt
proteins are characteristic proteins with conserved cysteine-rich residues.
These proteins have an N-terminal signal peptide and are relatively
insoluble due to post-translational modification by an enzyme called
palmitoyltransferase Porcupine. This enzyme covalently attaches
palmitoleic acid to cysteine residues on Wnt ligands, which brings
hydrophobic nature to the ligands. Palmitoylation is essential for Wnt
ligand signalling and secretion (45, 55, 56). Further, transmembrane
proteins Evi/Wls transport these lipid-modified Wnt ligands to the plasma
membrane, making them available for release to perform diverse roles
(57). From earlier studies, it is reported that canonical Wnts are mainly
Wnt1, Wnt3a and Wnt8 which activates Wnt/β-catenin pathway and non-
canonical Wnts are Wnt5a and Wnt11 which transduces β-catenin
independent pathway (58)
Wnt ligands bind to the cell surface receptors Frizzled (FZD) and LRP5/6
(Low-density lipoprotein receptor-related protein) family proteins. FZD
proteins contain 120 amino acid and are seven-pass transmembrane
proteins with extracellular N-terminal cysteine-rich domain (CRD). There
are ten different FZD genes in humans; FZD 1-10 (59). FZD receptors are
involved in β-catenin dependent and independent signalling pathways
(58). However, LRP5 and LRP6 are involved in canonical Wnt pathway,
which acts as co-receptors along with FZD for signal transduction. The
11
two closely related proteins LRP5 and LRP6 belong to LDLR family. In
Drosophila, Arrow is homologous to LRP5 and LRP6 with 45%
similarities (60). These are single-pass transmembrane proteins with a long
extracellular domain containing four YWTD type β-propeller domains and
three LDLR type-A repeats. Intracellular domain harbours five PPPSPxS
motifs in both LRP5 and LRP6, which are phosphorylation sites. These
motifs phosphorylate upon Wnt stimulation for recruitment and activation
of downstream components (59).
2.1. Canonical Wnt/β-catenin Pathway
A hallmark of canonical Wnt signalling is stabilisation and nuclear
accumulation of transcriptional co-activator β-catenin. In the absence of
Wnt ligands, a destruction complex forms which comprises scaffolding
protein AXIN and adenomatous polyposis coli (APC) along with Ser/Thr
kinases Casein kinase 1α (CK1α) and glycogen synthase kinase-3β
(GSK3β). AXIN phosphorylation by GSK3β is an essential event in the
assembly of destruction complex (61). This destruction complex recruits
β-catenin and promotes phosphorylation of β-catenin by CK1α at Ser 45
residue and GSK3β phosphorylates at Thr 41, Ser 37 and 33. These
phosphorylation events create a binding site on β-catenin for E3 ubiquitin
ligase β-Trcp. β-catenin gets ubiquitinated by β-Trcp and directs it towards
degradation by 26S proteasome in the cytoplasm. Absence of nuclear β-
catenin recruits histone deacetylases (HDAC) to promoter regions of target
genes mediated by TCF/LEF and Groucho transcription factors leading to
the transcriptional repression (62, 63) (Fig 3).
12
The canonical pathway is activated when Wnt ligand binds to FZD and co-
receptors LRP5/6. This event recruits Dishevelled (DVL) to the FZD
intracellular domain in the cytoplasm. Binding of Wnt ligand to the
receptors induces phosphorylation of LRP5/6 cytoplasmic domains by
GSK3β and CK1α at PPSPxS motifs, creating a docking site for AXIN.
Further AXIN translocates to the binding sites on LRP5/6 and complexes
with DVL-FZD-LRP5/6 (59). Binding of AXIN to phospho-LRP5/6
promotes AXIN dephosphorylation that brings conformational changes in
AXIN structure, inhibiting it from interacting with destruction complex
(61). The complex consisting of LRP5/6-FZD-AXIN-GSK3β-CK1α-DVL
undergoes polymerisation through DVL-DIX domain, which results in the
formation of membrane-associated “Signalosomes” (64). The
signalosomes formation inactivates the destruction complex and leads to
β-catenin stabilisation and translocation into the nucleus (65). Inside the
nucleus stabilised β-catenin associates with TCF/LEF transcription factors
along with co-activators cAMP response element-binding protein
(CREB)-binding protein (CBP), B-cell lymphoma 9 (Bcl-9), and pygopus
(66). This transcriptional activator complex carries transcription of
downstream target genes such as c-MYC, VEGF, MMP7, Cyclin D, c-Jun,
Fibronectin and also genes of the Wnt pathway itself. Most of the target
genes are involved in the developmental signalling and adult homeostasis
(45, 67)
Canonical Wnt signalling is regulated at multiple levels by various
secreted antagonists and agonists. At ligand level, signalling is negatively
regulated by proteins Notum, sFRPs (secreted Frizzled-related proteins)
and WIF1 (Wnt-interacting factor). Notum inhibits signalling by removing
13
the acyl group attached to Wnt ligands and hinder ligand interaction to
FZD-LRP5/6 receptors (68). sFRPs and WIF1 proteins which exert its
inhibitory effect on Wnt signalling because of their homology with FZD
receptors compete with FZD-LRP5/6 receptors and binds to Wnt ligand
proteins to prevent signalling (69, 70). At the receptor level, Dickkopf
Fig 3: Wnt signalling pathway. Representative image showing the canonical pathway in the absence of active Wnt ligand and the presence of active Wnt ligand. Adapted from Zhan et al. 2017 (71).
(DKK), a secreted antagonist plays an essential role in negatively
regulating Wnt signalling by interacting with the LRP6 receptor and
regulates signalling (72). LGR5 (Leucine-rich repeat-containing G-protein
14
coupled receptor 5) is a seven-transmembrane receptor that acts as a
modulator of Wnt signalling. LGR5 is an interstitial stem cell marker.
LGR5 binds to ligand R-spondin and exerts its negative and positive
effects on Wnt signalling (73). In the absence of R-spondins, two
transmembrane E3 ubiquitin ligases ZNFR3/RNF43 (zinc and ring finger
3/ ring finger 43) targets FZD receptors by ubiquitination and degradation
(74) leads to inhibition of Wnt signalling. Binding of R-spondins to LGR5
receptor inhibits the activity of ZNFR3/RNF43, which leads to the
accumulation of FZD receptors on the cell surface, thereby causing
amplification of the Wnt signalling (71, 75). Norrin, an agonist of Wnt
signalling, enhances signalling by binding with FZD4 receptor and LRP-
dependent activation of the pathway (76, 77).
2.2. Non-canonical Wnt pathways
Non-canonical Wnt signalling is characterised by β-catenin independent
signal transduction mechanism. This pathway is mainly classified into
Wnt/PCP (planar cell polarity) pathway and the Wnt/Ca2+ pathway (Fig 4).
The Wnt/PCP pathway is activated upon binding of Wnt ligands to FZD
and the tyrosine kinase co-receptors ROR2 and RYK. This binding
activates and recruits DVL to the complex at the cell membrane where
activation occurs through DAAM1 (Dishevelled associated activator of
morphogenesis 1). These events lead to downstream signalling by small
GTPases RHOA (Ras-homology gene family member A) and RAC1 (Ras-
Related C3 Botulinum Toxin Substrate 1). These GTPases further trigger
activation of ROCK (Rho-associated, coiled-coil containing protein
kinase) and JNK (c-JUN-N terminal kinase) (78, 79). These signalling
15
events triggers activation of transcription factor ATF2 for driving the
transcription of target genes responsible for several developmental
processes like the neuronal arrangement, embryonic heart development
and anterior-posterior patterning along with the significant role in actin
polymerisation, cytoskeleton scaffolding and coordinated spatial
polarisation of cells (78, 80, 81).
Fig 4: Non-canonical Wnt signalling pathway. Representative image showing Planar cell polarity pathway and Wnt /calcium pathway. Interaction of Wnt ligand to ROR2/RYK and FZD receptors activate the pathway. Reprinted from the publisher (82) which permits unrestricted non-commercial use. Pez, Floriane, et al. Journal of hepatology, 59.5 (2013): 1107-1117.
16
Wnt/Ca2+ pathway mainly regulates the release of calcium from
endoplasmic reticulum and maintenance of intracellular calcium levels.
Wnt/Ca2+ pathway promotes ventral cell fate, regulates tissue movements
during gastrulation and regulates dorsal axis formation during
embryogenesis (78, 80). Upon Wnt ligand binding to FZD receptor
triggers activation of phospholipase C, which in turn activates signalling
molecules, inositol 1,4,5-triphosphate (IP3) and 1,2 diacylglycerol (DAG).
IP3 and DAG stimulate the release of calcium which leads to an increase
in calcium levels in the cell. Further, amplified calcium levels trigger the
activation of CAMKII (Ca2+/calmodulin-dependent kinase II),
calcineurin and PKC (protein kinase C) (83). NFAT (nuclear factor of
activated T-cells) a transcription factor is activated by calcineurin and
boost the expression of genes responsible for polarisation of cells during
gastrulation and pro-inflammatory genes (84).
2.3. Wnt signalling in development
Wnt signalling is widely studied for its roles in several developmental
events across the animal kingdom. In most of the bilaterians (animals with
bilateral symmetry as an embryo), Wnt genes are expressed in the posterior
poles, while in pre-bilaterians the expression is polarised along the primary
axis. Wnt signalling is mainly responsible for developing posterior axis
features, and inhibition of Wnt genes in the anterior axis plays a vital role
in the body plan development in most vertebrates such as mouse, Xenopus
and zebrafish and cephalochordates (44, 85, 86).
In Xenopus embryos during early blastulae, after cortical rotation
accumulation of nuclear β-catenin in dorsal side cells occurs. This
17
phenomenon is essential for the transcriptional programme required for the
formation of Spearman organiser (85, 87). β-catenin is involved in the
Anterior-posterior (AP) axis formation. In mouse embryos, the first β-
catenin activity observed in extraembryonic visceral endoderm. During the
initiation of gastrulation in the epiblast β-catenin is distributed in the cells
adjacent to embryonic-extra embryonic junctions, and further β-catenin
signalling was detected in primitive streak (88). In Xenopus and zebrafish,
deletion of β-catenin or overexpression of DKK1 results in anteriorization
of AP axis with loss of posterior body and overexpression of Wnt8 causes
posteriorization of AP axis (89, 90). Wnt pathway synergistically cross-
talk with other signalling pathways such as the BMP pathway for the
ventral-posterior region establishment and FGF pathway for signalling
events in dorsal and posterior axis (91, 92).
Wnt signalling is responsible for the integration of components (lens and
retina) during the formation of an eye from neural crest cells in chick
embryos. TGF-β and canonical Wnt pathways transcriptionally repress
PAX6 activity for the formation of a functional eye (93). Wnt plays a vital
role in the formation of Cochlea (94), and both canonical and non-
canonical pathways are involved in muscle development (95). In mouse
embryos, Wnt1 and Wnt10b are responsible for the formation of the
midbrain and anterior hindbrain (96). In mammals and zebrafish Wnt
signalling play a crucial role in the early development of lungs and swim
bladder, respectively (97). Also, Wnt signalling is responsible for the
development of tail in zebrafish along with BMP and nodal signalling
pathways (98).
18
2.4. Wnt signalling in adult tissue homeostasis
Wnt signalling is widely studied for its role in the maintenance and
activation of stem cell reservoirs. Stem cells are a niche of cells that have
a high potential to maintain tissue homeostasis in adults by renewing
themselves by cell division. Lineage tracing experiments provided
evidence that Wnt signalling is crucial for stem cell niches in several
tissues such as intestine, stomach, bone, liver, skin and hair follicles (99).
In the intestinal epithelium, Wnt co-receptor and target gene LGR5
identified as a novel stem cell marker. In intestinal crypt base columnar
cells, LGR5 is exclusively expressed (100). These basal crypt stem cells
are highly proliferative and regenerate throughout adult life. Wnt and R-
spondin promote the self-renewal of the basal crypt LGR5+ stem cells
which migrate to intestinal villi and further differentiate into intestinal cell
types for maintaining intestinal homeostasis (101, 102).
Bone remodelling is a crucial process that occurs throughout adult life for
maintaining calcium homeostasis and meeting the functional demands due
to the mechanical stress of bone. Bone resorption by osteoclasts and new
bone formation and maintenance by osteoblasts and osteocytes occurs in
the process of remodelling. Wnt signalling increases the bone mass by its
activity through Wnt co-receptor LRP5 on mesenchymal progenitor cells.
SOST (sclerostin), a Wnt repressor secreted by osteoclasts reduces
osteoblast formation by inhibiting LRP5 activity, thus maintaining balance
in the process of bone remodelling (103-105).
19
2.5. Wnt signalling in cancer
Wnt signalling is associated with cancer, and its aberrant activation plays
a crucial role in multiple pathogeneses along with cancer. Targeting Wnt
signalling have a great significance in the treatment of cancer. Dysfunction
of components in Wnt canonical signalling was known to develop several
types of cancers such as colorectal, ovarian, hepatocellular carcinoma
(HCC), breast, myelomas, respiratory and prostate. Loss or gain of
function mutations in Wnt signalling components have a high chance of
cancer-promoting or cancer-driving capabilities. Majority of tumour
causing mutations of Wnt components occurs in APC, AXIN1-2 and β-
catenin, which leads to the inappropriate stabilisation of β-catenin to
transactivate the downstream target genes (c-Myc, CCND1, etc.)
persistently (45, 54, 63).
Different mutations in APC and β-catenin are found to be the leading cause
of colorectal carcinogenesis (45, 106). In multiple myelomas, epigenetic
alterations affect the Wnt signalling such as promoter methylation of wnt
antagonists DKK1-2 and sFRP1,2&4 and also overexpression of
transcriptional factor BCL9 and Wnt co-receptor LGR4 (107). 17%
inactivating mutations in AXIN1-2 and 15-33% of activating mutations in
β-catenin were reported in sporadic HCC (108, 109). 16-54% of Ovarian
endometrioid adenocarcinomas (OEA) characterised by common
mutations in β-catenin resulted in a two-fold increase of β-catenin/TCF
target genes such as BMP4, CCND1, MSX2, MMP7, FGF9, CD44 and
EPHB3 (110). In prostate cancer, 18% of alterations in the Wnt signalling
pathway have been identified (111). 5% of tumours harbours mutations in
the β-catenin gene and recurrent mutations have been identified in APC
20
and βTRC genes. Mutations in E3 ligases ZNRF3 and RNF43 were
identified and were exclusive with APC mutations (111, 112). A fusion of
genes GRHL2- RSPO2 and RSPO2 overexpression due to gene
rearrangement, increases R-spondin levels, an agonist of Wnt signalling.
These fusion events discovered in metastatic castration-resistant prostate
cancer (mCRPC) (111, 113). Frequent hypermethylation of the APC gene
was identified during prostate cancer progression (114, 115). Canonical
Wnt pathway is known to regulate cellular metabolism in OEA and breast
cancer by its effects on downstream target genes, which control oxidative
phosphorylation, glutamine and fatty acid metabolism (110, 116, 117). C-
Myc an important Wnt target gene known to control mitochondrial
bioenergetics and lipid synthesis and also synergistic cross-talk between
Canonical Wnt pathway and c-Myc in cancer cells regulate tumour cell
metabolism and promotes aerobic glycolysis in cancer cells (117, 118).
These examples represent the importance of Wnt signalling in the
regulation of cancer development and progression.
21
3. TGF-β signalling pathway:
TGF-β (Transforming growth factor-β) is an intriguing cytokine, belongs
to a large family of secreted proteins, known as TGF-β superfamily that
have a wide range of properties including cell proliferation, migration and
apoptosis during embryonic development, tissue homeostasis and immune
system modulation. TGF-β is also known to drive cancer progression by
its effects through immunosuppression, proangiogenesis and inducing
epithelial plasticity leading to Epithelial-Mesenchymal transition (EMT).
Also, TGF-β can induce antiproliferative effects by regulating the genes
responsible for cell cycle progressions such as cyclin-dependent kinases
(Cdks) and downregulation of c-Myc. Thus TGF-β showing its properties
of a potent growth inhibitor in normal epithelial tissues and display both
tumour suppressor and promoter properties (119-121).
TGF-β was discovered in 1978 while working on murine sarcoma virus-
transformed cells, initially known as Sarcoma growth factor (SGF) (122).
In humans, the TGF-β superfamily consists of nearly 33 members which
can be further subdivided into two subfamilies depending on the type of
signalling they activate; TGF-β/nodal/activin subfamily and BMP (bone
morphogenetic protein) subfamily include BMPs and GDFs (growth and
differentiation factors) (119, 120, 123).
TGF-β signalling is activated through its TGF-β ligands which exist in
three isoforms TGF-β1, TGF-β2 and TGF-β3; these are secreted into the
extracellular matrix in its latent form with its propeptide and LTBP (latent
TGF-β binding protein) (124). Propeptide and LTBP further cleaved by
proteases from TGF-β ligand for final activation (125, 126). Other ligands
22
involved in the TGF-β superfamily signalling are BMP-2/4/6, GDF-5,
activin, AMH (Anti-Mullerian Hormone) and OP-1 (123). TGF-β ligand
signals through two pairs of heterodimeric serine/threonine receptor
complexes type I (ALK 1-7) and type II (TβRII, ActR-IIA, ActR-IIB,
BMPRII and AMHRII).
Mature TGF-β ligand binds to the constitutive kinase active TβRII, which
recruits and phosphorylates active kinase domain of TβRI (ALK5) and
results in the formation of receptor hetero-tetrameric complex with two
TβRII and two TβRI receptors. This complex further activates receptor
(R)-Smads (Smad signalling) and also several pathways which do not
involve conventional Smads (Non-Smad signalling) (120, 127, 128)
3.1. Smad signalling (Canonical):
The signals from the activated receptor-ligand complex are transmitted
into the cytoplasm through R-Smads. Further, R-Smads form complexes
with Common-mediator Smads (Co-Smad), which enters the nucleus for
driving the expression target genes. Smads are vertebrate ortholog to
MAD protein in Drosophila. There are three different kinds of Smads
based on their functionality; R-Smads (Smad-1/2/3/5/8), Co-Smad (Smad-
4) and inhibitory (I)-Smads (Smad-6/7). R-Smads 2/3 involved in TGF-
β/Activin signalling, and R-Smads 1/5/8 transduces BMP signalling. I-
Smads inhibit TGF-β signalling by binding to R-Smads or receptors (129,
130)
R-Smad and Co-Smads have conserved structural domains N-terminal
MH1 and C-terminal MH2 connected through a proline-rich linker region.
The linker domain contains phosphorylation sites for kinases like MAPKs
23
and CDKs, and R-Smads have a PY motif an interaction site for E3
ubiquitin ligase Smurf1/2. These phosphorylation and ubiquitination
events inhibit Smads from nuclear transport and result in proteasomal
degradation, along regulating the TGF-β signalling. I-Smads lack MH1
domain. MH1 domain interacts with Smad binding elements (SBE) on the
promoter sites of target genes. MH1 domain is also responsible for nuclear
localisation signal for both R-Smad and Co-Smads. MH2 domain is highly
conserved in all the Smads, which is responsible for receptor interaction.
R-Smads-MH2 domain contains specific motifs SSXS, which are
phosphorylated by TβRI receptors. These phosphorylation motifs are
absent in Co-Smads and I-Smads (131).
When the TGF-β ligand interaction activates the TβRI and TβRII, this
allows binding of MH1 domain of R-Smads to the c-terminal intracellular
domain of TβRI. This results in the phosphorylation of Smad-2 and Smad-
3 by activated TβRI at SSXS motifs. Phosphorylation of R-Smads recruits
Smad-4, which they form a heteromeric complex and further dissociates
from the receptor complex (Fig 5). These complexes translocate into the
nucleus and carry a wide range of target gene transcriptional regulation
(120, 123, 129, 130). R-Smad and Smad4 complexes bind to the SBE
elements on the promoter sites of several target genes like p15INK4B,
p21CIP1, c-Myc, PAI-1, ZEB1/2, SNAI1, Twist1, Smad7 and many more
that are involved in apoptosis, immune responses, embryonic
development, cell differentiation and migration (132-135). Smad
complexes bind to several transcription factors (Runx, bHLH, NFκB and
forkhead, etc.) and co-activators (CBP/p300, TGIF, c-Ski) to mediate cell-
24
specific or pathway-specific responses to TGF-β signalling (123, 127, 136,
137).
3.2. Non-Smad signalling (Non-Canonical):
Apart from conventional Smad activation, TGF-β signals also transduce
several non-canonical activations through proteins Ras-ERKs
(extracellular signal-regulated kinases)-MAPK (mitogen-activated protein
kinase), Par6-Rho GTPases, PI3K (phosphatidylinositol-3´kinase)-AKT-
mTOR (mammalian target of rapamycin), and TAK1 (TGF-β activated
kinase 1)/TRAF6- p38/JNK (c-Jun N-terminal kinases) (128) (Fig 5).
Fig 5: TGF-β signalling pathway: Canonical pathway transmits its signals through Smad 2/3 and 4 while in the non-canonical pathway several factors are involved in signal transmissions such as PI3K, TRAF6, MAPKinases, Rho GTPases and ERK proteins. Reprinted with permission from the publisher (128)
25
In epithelial cells and fibroblasts, phosphorylated TβRI can activate the
MAPK pathway to activate ERK 1/2 via Ras to revive stress signals (138).
TβRII phosphorylates Par6, which inhibits small GTPase Rho, through
recruitment of Smurf1 to regulate actin reorganisation and cell polarization
(139, 140). TGF-β signals activate the PI3K pathway through subunit p85
and induce rapid phosphorylation of AKT and activate mTOR. These
signals are essential during protein synthesis and cell cycle progression.
Besides, the PI3K/AKT pathway through TGF-β signalling involved in
EMT, invasion and migration in cancer progression by its effects through
SNAI1 (141-143).
TRAF6, an E3 ubiquitin ligase interacts with TβRI at a consensus motif.
This TRAF6-TβRI complex undergoes oligomerisation when the TGF-β
ligand binds to the TβRII-TβRI complex (144). The oligomerisation of the
TRAF6-TβRI leads to autoubiquitination and activation of TRAF6 and
recruitment of TAK1. TAK1 gets activated by Lys-63 ubiquitination
causing activation of TAK1-p38/JNK pathway, which promotes apoptosis
and EMT (144-146). TGF-β mediated TRAF6 ubiquitination of TACE
mediates cleavage of TβRI at the ectodomain region. Also, TRAF6
activates and recruit PS1 (Presenilin 1), a component of the γ-secretase
complex through TGF-β mediated Lys-63 polyubiquitination to cleave
TβRI at the transmembrane region generating an ICD (Intracellular
domain). This TβRI-ICD translocates into the nucleus and drives the
expression of SNAI1, Jagged1, MMP2 by interacting with NICD (Notch-
ICD) and transcription co-activator p300 (147, 148).
26
3.3. TGF-β signalling in cancer:
TGF-β is known to be both tumour-suppressor and tumour promoter with
its effects through growth regulation and cancer progression. It is an
essential mediator of cell proliferation, migration and apoptosis, in
contrast, it also mediates cancer cell invasion, metastasis and angiogenesis
(121, 123). Understanding the context-based regulation through TGF-β
provides crucial insights for the therapeutic strategies.
In epithelial cells and during the tumour initiation, TGF-β is mainly
responsible for growth inhibition via Smad dependent signalling. TGF-β
exerts its pro-apoptotic effects through both Smad-dependent and
independent pathways by induction of pro-apoptotic proteins like Death-
associated protein kinase (DAPK), BIM and caspase 9 (149). Mutations in
Endoglins, an agonist of TGF-β signalling, is reported to cause
hemorrhagic telangiectasia syndrome, mirroring TGF-β tumour
suppressor properties (150). Many reports with TβRI and TβRII mutations
were known to cause various cancer such as prostate, breast, colon,
ovarian, lung and pancreas, and these mutations are common in tumours
with microsatellite instabilities (151-153). hTERT (human telomerase
reverse transcriptase), a protein which is known to stabilise and extend
chromosomal telomers is inhibited in normal cells by TGF-β via
interaction of Smad3 to hTERT promoter and direct cells for apoptosis,
reflecting its role for inhibiting cell immortality. In most of the cancers,
the inhibitory effect of TGF-β on hTERT is lost, making them immortal
and with dysregulated growth (154-156). Further, the antiproliferative
roles of TGF-β are explained by transcriptional downregulation of c-Myc.
TGF-β induced downregulation of c-Myc results in the induction of CDK
27
inhibitors p15 and p21 for cell cycle arrest. Induction of p15 and p21 can
also happen independently of c-Myc but through TGF-β direct induction
(120, 157, 158).
Tumour promoting roles of TGF-β is widely studied. TGF-β can switch
from tumour suppressor to tumour promoter role in the presence of
oncogenic and epigenetic events. In the late stages of cancer progression
due to the mutational burden in its components, TGF-β drive cancer
towards aggressive mode accompanied by EMT, angiogenesis, invasion
and metastasis. TGF-β promotes tumorogenesis by modulating tumour
stroma. Several clinical investigations demonstrated that TGF-β levels are
elevated in tumour stroma and linked to poor prognosis (159, 160). TGF-
β promotes transcription of SNAI1, which results in loss of E-Cadherin
and epithelial cells acquires EMT phenotype to cancer cells (161). Cancer-
associated fibroblasts (CAFs) in tumour stroma mature from resident
fibroblast by TGF-β stimulation and inturn these CAFs promotes
metastasis through secretion of IL-6/11, which promote of JAK-STAT
oncogenic signalling (162). TGF-β promotes cancer progression by
upregulating several target genes which promote angiogenesis such as
FGF-2 (fibroblast growth factor-2), Angptl4 (Angiopoietin-like 4) and
TGF-β mediated stromal-derived angiogenic factors like VEGF (Vascular
endothelial growth factor), CTGF (connective tissue growth factor) and
PDGF (Platelet-derived growth factor) (163-166).
28
4. HIF (Hypoxia-inducible factor) system
Oxygen is an essential component of metabolism in aerobic organisms. It
is required for survival, and it is essential in generating the cellular
adenosine triphosphate (ATP) during oxidative phosphorylation in
mitochondria, the energy resource of the cell. Oxygen (O2) is transported
by red blood cells throughout the body to enable normal cellular functions
(167). Normoxia, a normal physiological O2 level, is different between
different tissues. In adult human tissues, the physiological oxygen levels
vary between 1%-14%, which provides a microenvironment for cells. Low
oxygen tension is found in venous blood, retina, bone marrow and brain.
Arterial blood, lung tissue, heart, liver and kidney shows high oxygen
tension (168, 169). When the O2 levels fall below the physiological level,
the condition is termed as hypoxia. Localised transient O2 deficiency leads
to a metabolic crisis and can produce irreversible cellular damage.
Hypoxia is a driver of several cellular functions and occurs when the
demand for O2 exceeds supply. Hypoxia can contribute to a wide range of
pathophysiological conditions and also normal physiological processes
such as embryonic development. Various pathological conditions involve
chronic lung disease, stroke, obstructive sleep apnea and cancer (170-172).
Normal mammalian embryonic development occurs in a hypoxic
environment where tissue growth is higher than available oxygen, and here
HIFs (Hypoxia-inducible factors) play a vital role in embryos to enable
survival in low oxygen conditions (173). Other important physiological
processes activated by HIFs during hypoxia are hyperventilation,
erythropoiesis, activation of glucose metabolism and angiogenesis (174).
Angiogenesis is a process of formation of new blood vessels and involves
29
activation and migration of endothelial cells, which branch from existing
blood vessels to form vascular branches. VEGF, a significant contributor
to angiogenesis, is a direct target of HIFs and is activated upon hypoxia.
TGF-β, FGFs, MMPs and Angiopoietin-1&2 also contribute to
angiogenesis (175, 176). Angiogenesis is essential in embryogenesis and
also in cancer progression. Hypoxia, along with inappropriate activation
of HIFs cause tumorigenesis (177).
4.1. Components of the HIF pathway
The HIF family of transcription factors are responsible for the maintenance
of oxygen homeostasis in living cells. HIFs are composed of oxygen labile
α and stable β heterodimer subunits. There are three different α subunits
HIF-1α, HIF-2α and HIF-3α; and one β subunit HIF- β.
HIF proteins:
HIF-α proteins are oxygen labile transcription factors, and in low oxygen
tension conditions, HIF-α protein levels increase rapidly. Conversely, the
HIF-β subunit is constitutively expressed independent of oxygen
concentration. Three subunits HIF-1α, HIF-2α and HIF-3α, are encoded
by genes HIF1A, EPAS1 and HIF3A. HIF-β is also known as aryl
hydrocarbon receptor nuclear translocator (ARNT) encoded by gene
ARNT (178). HIF-α proteins binds to HIF- β and translocate to the nucleus
where they bind to hypoxia-responsive elements (HREs) of the target
genes (175). HIF-1α, HIF-2α and HIF-β have been characterised
thoroughly. They possess N-terminal basic helix-loop-helix domain
(bHLH) responsible for binding to DNA, followed by PAS (Per-Arnt-
30
Sim)-A, PAS-B, PAC (PAS-associated COOH) domain which is
responsible for heterodimerisation of HIF-α and β subunit. HIF-1α and
HIF-2α possess oxygen-dependent degradation domain (ODD) followed
by two transactivation domains NTAD and CTAD at the C-terminal, while
HIF-β has only CTAD but lacks ODD and NTAD (178, 179) (Fig 6). HIF-
1α is ubiquitously expressed, while HIF-2α is detected only in specific
tissues, including endothelium, lung, kidney, brain and heart (180).
Fig 6: Diagrammatic overview of the domain structures of HIF-α and HIF-β isoforms. Adapted from Yang SL et al. 2015 (181).
The HIF-3α subunits are the most recently identified members of the HIF
family and are a relatively weak transcriptional activator of hypoxia-
responsive genes. Human HIF-3α has ten splice variants, namely, HIF3α1-
10. Several splice variants of HIF-3α are due to unique transcription
initiation sites in three different exons, namely exon 1a, 1b and 1c of
HIF3A gene (182). Structurally, HIF-3α1, 2 and 4 variants posses bHLH,
31
PAS domains and HIF-3α1-3 have an oxygen-sensing ODD domain but
HIF-3α4-6 lack ODD domain. The CTAD domain is absent in HIF-3α, but
HIF-3α1 has a unique DNA and protein binding domain LZIP. HIF-3α4 is
similar to mouse inhibitory PAS (IPAS), which lacks the ODD and LZIP
domain (Fig 6). HIF-3α4 dimerise with HIF-β and also with HIF-1α, which
results in a transcriptionally inactive dimer, thus acting as a dominant-
negative regulator of HIF-1α and HIF-2α (182-185).
VHL:
VHL is known to be a tumour suppressor gene, and germline mutations in
this gene cause a hereditary cancer syndrome called von Hippel-Lindau
disease, which leads to the development of clear cell renal carcinoma and
hemangioblastomas of the central nervous system and retina (186, 187).
VHL inactivation in both the alleles is frequent in sporadic ccRCC (32).
VHL (von Hippel-Lindau) protein is an E3 RING-type ubiquitin ligase
know to target several proteins for proteasomal degradation. The important
proteins which were polyubiquitinated by VHL are HIF-1α, HIF-2α and
HIF-3α during normoxia, which makes VHL an important negative
regulator of HIF pathway (170, 179, 188). The VHL protein is ubiquitously
expressed and evolutionarily conserved across species. The human VHL
gene is located in chromosome 3p25 contains 4.5 kb mRNA with three
exons (187). There are two isoforms of VHL, VHL30 and VHL19. VHL30 is
a larger protein with 30kD with 213 amino acids and other VHL19 derived
from a 54th methionine codon residue of the coding exon 1 with 160 amino
acids (189). VHL30 is mainly localised to the cytoplasm, endoplasmic
reticulum (ER) and minimal concentrations in the nucleus and VHL19 is
32
localised to both cytosol and nucleus, but not in ER (190). VHL protein
has two functional domains α subunit and β subunit. VHL α subunit
associates with elongin C, elongin B, Cul2, and Rbx1 for its ubiquitin
ligase activity with which it targets proteins. β subunit is responsible for
binding to prolyl hydroxylated HIFα (187).
4.2. HIF signalling:
Protein stability of HIF-α is dependent on oxygen tension in the tissues,
while HIF-β is insensitive to oxygen tension and stable. During normoxia,
when oxygen is available, a family of dioxygenase enzymes called PHDs
(prolyl-hydroxylases) hydroxylate two prolyl residues in the amino- and
the carboxy-terminal oxygen-dependent degradation (ODD) domains in
HIF-α (191). The hydroxylated prolines create a recognition site for VHL
protein, an E3 ubiquitin ligase, which binds to and polyubiquitinates HIF-
α by K-48 linked ubiquitins and directs it for proteasomal degradation (Fig
7) (192, 193).
In hypoxia, when oxygen concentration drops, PHDs become inactive,
resulting in HIF-α accumulation and HIF-α dimerises with HIF-β and
translocates into the nucleus and bind to the consensus motif HREs
(Hypoxia responsive elements) on the promoter regions of HIF-target
genes to activate the transcription of genes in order to adapt to the hypoxic
stress (170, 179, 188) (Fig 7). In the nucleus, HIF-α and β complex bind
to coactivators like CBP/p300 to form an active transcriptional complex
for driving the target genes (194).
33
Fig 7: Hypoxia-inducible factors (HIFs) activity under normoxia and hypoxic conditions. Adapted from Simon et al. 2016 (195).
HIF activates a large number of genes in response to hypoxia, which is
required for many cellular processes including energy metabolism,
apoptosis, angiogenesis, cytoskeleton formation, autophagy, cell
differentiation and maintaining oxygen homeostasis (196). HIF factors
contribute to epithelial to mesenchymal transition through its effects on
VEGF, which enhances angiogenesis in cancer (175, 176). Hypoxia also
activates important transcription factors, such as p53, NF-κB, AP-1 and
c-Myc (197, 198).
34
5. Epithelial to mesenchymal transition (EMT)
The epithelial to mesenchymal transition (EMT) is characterised by loss
of cell-cell adhesion, increased motility and changes in polarization of the
cells. EMT is an important phenomenon that occurs during embryogenesis
and cancer progression (199, 200). Epithelial cells acquire mesenchymal
phenotype, leading to enhanced motility and invasion. During EMT,
epithelial cells lose E-cadherin expression, which holds the cell-cell
junctions and attains mesenchymal markers, such as vimentin and
fibronectin. EMT is a crucial process before metastasis can occur (121,
201).
Epithelial cells are closely connected by tight junctions, with an
apicobasal polarity, actin cytoskeleton polarisation and are bound by
a basal lamina at their basal surface. Mesenchymal cells lack polarisation
and are characterised by spindle-shaped morphology (202). Cancer cell
dissemination is vital in cancer progression leading to invasion and
metastasis. Dissemination of cancer cells from the primary tumour is
initiated by loss of cell-cell adhesion, increased motility of cells and
breakthrough of basement membrane causing invasion and spreading into
surrounding tissues or distant organs using bloodstream or lymph (200).
The mesenchymal transition of epithelial cells is characterised by
expression of vimentin, and the increased deposition of extracellular
matrix (ECM) proteins, including collagens and fibronectin and loss of E-
cadherin, promotes high expression of N-Cadherin, which attains high
motility for cells. Loss of polarity to cells allows them to migrate easily.
Increased expression of matrix metalloproteinases (MMP7, MMP9) allow
35
the cells to degrade basement membrane and escape into surrounding
tissue (Fig 8) (121, 203, 204).
Fig 8: Schematic representation of epithelial-mesenchymal transition. EMT characterised by gain of a mesenchymal phenotype, loss of cell-to-cell adhesion, loss of polarity, and acquire migratory and invasive properties.
TGF-β is a potent driver of EMT. Canonical TGF-β signalling regulates
the expression of EMT-inducing transcription factors Snail/Slug, ZEB1/2,
and Twist (121, 204). Non-canonical TGF-β signalling contributes to the
increased motility, invasion, and actin reorganisation (202). Hypoxia also
contributes to EMT (172). Hypoxia upregulates HIF-1α/HIF-2α and in
turn modulates EMT, angiogenesis and metastasis. HIFs under hypoxia
activates several EMT transcriptional regulators such as Twist1, Snail,
Slug, ZEB1/2, and E12/E47 which further bind to the promoter sequences
of EMT marker genes to facilitate EMT (205, 206). Sequestration of β-
catenin in the cytoplasm is an essential function of E-cadherin at the cell
36
junctions. Loss of E-Cadherin from cell junctions due to EMT results in
the release of β-catenin into the cytoplasm and translocate into nucleus to
drive the transcription of mesenchymal markers such as fibroblast-
specific protein 1 (FSP1), Snail, vimentin, slug; which further enhances
migration and invasion (115, 207-209).
6. Ubiquitination:
Ubiquitination is a process of post-translational modification of proteins
through 76 aminoacid polypeptide known as ‘Ubiquitin’. Ubiquitin family
proteins display a remarkable similarity in their structure. Other members
of the family include Nedd8, Sumo1, ThiS and Fat10 etc. (210, 211). These
ubiquitins are small regulatory proteins and are ubiquitously expressed in
most tissues in all eukaryotes. These ubiquitins are covalently attached to
its target protein at the amino group of lysine residue through an isopeptide
bond (212). Substrates marked with ubiquitins are targeted by multisubunit
ATP dependent protease called 26S proteasome and form ubiquitin-
proteosome system (UPS), which regulates the turnover of misfolded and
damaged proteins and also controls the stability of short-lived proteins
such as transcription factors (213). The ubiquitination process also affects
proteins in several ways like controlling protein activity, signal
transduction, cellular localisation of proteins and prevent or promote
protein interactions. Many biological processes are regulated by
ubiquitination such as inflammatory responses, cell cycle regulation, DNA
repair, endocytosis and antigen presentation (214-216).
The human ubiquitin is encoded by four genes UbB, UbC, UBA52 and
RPS27A/UBA80 and they are rapidly processed by DUB
37
(deubiquitinating enzymes) family of enzymes to produce free ubiquitin
proteins in the cytoplasm (217). DUBs are mainly responsible for
reversing the process of ubiquitination. This process of deubiquitination is
equally crucial as ubiquitination for maintaining the cellular homeostasis
and regulation of cellular signals. Ubiquitination involves three essential
steps catalysed by three different enzyme groups namely ubiquitin-
activating enzymes (E1), ubiquitin-conjugating enzymes (E2) and
ubiquitin ligases (E3) which mark activation, conjugation and ligation
respectively (Fig 9). In humans, there are two ubiquitin E1s, ~40 E2s
(UbcH5A, UbcH7/E2-F1, UbcH8, Ubc13, BRUCE, E2-EPF) and ~600
E3s (E3α/Ubr1, Mdm2, TRAF6, IAPs, Smurf1, E6-AP). E3 interacts with
its target protein through one of the two structural domains either HECT
domain or RING domain and are thus categorised into HECT Domain E3s
and RING domain E3s (218-220).
Ubiquitins must be activated to bind to the substrate proteins at the C-
terminus. At first, ubiquitin is adenylated by E1 enzyme using ATP source.
The activated ubiquitin in a complex with E1 called E1-ubiquitin thiol
ester is covalently linked to the large group of E2 conjugating enzymes.
Further, E2 proteins transiently carry the activated complex and catalyse
substrate ubiquitination either alone or in conjunction with a ubiquitin-
protein ligase, E3. E3 ligases, transfer activated ubiquitin from E2 to
substrate lysine residue (monoubiquitination) or ubiquitin lysine residue
(polyubiquitination) (212, 216, 219, 220).
38
Fig 9: Schematic illustration of the ubiquitin-proteasome system. K48- linked polyubiquitination drives proteins for proteasome-mediated degradation. K63- linked polyubiquitination signals for DNA repair, translation, signal transduction and endocytosis. Reprinted with permission from the publisher (213).
Protein modifications can occur either by a single ubiquitin-protein called
monoubiquitination or chain of ubiquitin proteins known as
polyubiquitination. Secondary ubiquitin always links to lysine residue (K)
or the N-terminal methionine of preceding ubiquitin protein. Ubiquitin has
seven lysine residues K6, K11, K27, K29, K33, K48 and K63, all of which
conjugate with other ubiquitin in the process of polyubiquitination (221).
Each lysine binding has a different cellular response. K48-linked
polyubiquitination directs proteins to proteasomal degradation (212, 219)
whereas K63-linked polyubiquitination performs processes like DNA
repair, endocytosis and signal transduction (218).
39
7. TRAF6:
TRAF6 belongs to the family of TRAFs (TNF (Tumor necrosis factor)-
receptor-associated factors) which have essential roles in intracellular
signal transduction of IL-1 (Interleukin-1) receptor/TLR (toll-like
receptor), BCR /TCR (B-cell/T-cell receptors) and TNFR (Tumor necrosis
factor receptor) superfamily (222, 223). TRAFs are a family of adapter
proteins and ubiquitin ligases and are known to associate with cytoplasmic
domains of TNF receptors. TRAFs activate several signalling pathways,
including NF-κB (nuclear factor-Kappa B), MAPK and JNK p38 (224).
TRAFs regulate apoptosis, haematopoiesis, adaptive and innate immune
responses and bone metabolism (222). The TRAF family includes seven
different TRAFs (TRAF1-7) in mammals (224, 225). TRAF2, 3 and 6 are
expressed ubiquitously in most cell and tissue types (226), while TRAF1
and TRAF5 are confined to spleen, lungs and thymus (171, 172) and
TRAF4, is mainly expressed in neuroepithelium during embryogenesis
(227). TRAFs are characterised by an N-terminal RING (Really interesting
new gene) finger domain, one to seven Zinc finger (ZF) domains followed
by conserved and distinct carboxy-terminal containing a coiled-coil (CC)
domain (TRAF-N) and a TRAF-C domain. TRAF1 does not have a RING-
finger domain (223). The Carboxyl domain of TRAF6 is a trimeric
structure. It is mushroom-shaped with the TRAF-C domain as the head and
coiled-coil as the stalk for trimeric structure. The TRAF-C is mainly
responsible for interaction with receptors, other TRAFs and various
adapter proteins (228, 229). The RING domain and adjacent ZFs are
essential for the activation of downstream signalling (230). All TRAFs are
localised to cytoplasm except for TRAF4, which is also found in the
40
nucleus (231). In breast cancer, TRAF6 has also been found in the nucleus
in hypoxic cells (232).
TRAF6 is an adapter protein and E3 ubiquitin ligase known to promote
various inflammatory responses through different signalling pathways
such as NF-κB and Mitogen-activated protein kinases (MAPKs) (233).
TRAF6 was first identified by a yeast two-hybrid screen and found to be a
signal transducer of CD40 and also by EST library screening by using
TRAF2 sequence homology (223, 234). TRAF6 contains a coiled-coil
domain (TRAF-N), four zinc fingers, and a RING domain (Fig 10) (235).
Fig 10: Diagrammatic representation of the structure of TRAF6 with its domains. N-terminal RING domain and Zinc fingers 1-4; C-terminal coiled-coil (CC) and TRAF-C domains. Adapted from Yin et al. (235)
TRAF6 is pleiotropic in participating in various signal transduction
pathways unlike other TRAFs, thus showing its distinct features and
physiological functions. TRAF6 has a unique TRAF-C domain among
TRAFs with least homology and with an overall sequence identity of
~30% when compared to other TRAFs (223). TRAF6 is ubiquitously
expressed (223, 234). TRAF6 interacts with other protein through
consensus motif Pro-X-Glu-X-X-(Ar/Ac), where Ar is an aromatic and
Ac an acidic residue in its TRAF-C domain (228). TRAF1, 2, 3 and 5 do
not share the same consensus binding motif, and they bind instead to
Pro/Ser/Thr/Ala)-X-(Gln/Glu)-Glu motif (236, 237). TRAF6 bind to
41
consensus motifs of CD40, IRAKs (Interleukin-1 receptor-associated
kinase) and RANK (Receptor activator of nuclear factor κ B). The TRAF6
binding region is required for CD40-mediated NF-kB activation, which is
known to play an essential role in adaptive immunity and, maturation and
survival of B-cells and dendritic cells (238, 239). Mutations in the three
residues of the consensus motif in CD40 significantly reduce NF-kB
reporter activity (228, 234). TRAF6 can transduce signals from both IL-
1R/TLR family and TNFR family proteins. In IL-1R/TLR signalling
TRAF6 binds to kinases-IRAK through recruitment of adapter proteins
MyD88, TRIF-related adaptor molecule (TRAM) and toll/interleukin-1
receptor adaptor protein (TIRAP) which elicit NF-kB activation and IL-1-
mediated JNK activation (223, 240). RANK and TRAF6 interaction have
a functional role in bone metabolism, where TRAF6 is a critical adapter in
RANK-mediated differentiation of osteoclasts maintaining the bone
homeostasis (239-242).
TRAF6 N-terminal RING and zinc fingers are rigid and elongated
structures and exist in dimeric structure in both crystal and solution (235)
(Fig 11). The C-terminal CC domain and TRAF-C have a trimeric
mushroom-shaped structure. This trimeric structure is transient and
attained upon signal reception to modulate downstream signalling. The
trimer is the functional form of TRAFs, and trimeric structure of the
TRAF6 C-terminal is an important post-translation event for its role in
interaction with different proteins (243).
In its function as an E3 ubiquitin ligase, the RING domain of TRAF6 is
known to facilitate downstream signalling by K63-linked
polyubiquitination driving the proteins for DNA repair signal transduction
42
and endocytosis. Upon activation with relevant signalling ligand, TRAF6
promotes its activation by K63-linked autoubiquitination (244, 245).
Further, in conjunction with E2 ubiquitin-conjugating enzymes Ubc13-
UeV1A, the RING domain attain E3 ligase activity and catalyses the
formation of K63-linked polyubiquitination of target proteins, resulting in
activation of the pathways such as NFκB and MAPK (235, 245).
Fig 11: Dimeric structure of TRAF6 protein with RING domain and Three zinc fingers 1-3 (Z1-3). PDB ID: 3HCS (235)
Previous studies reported that TRAF6 knockout mice develop
osteopetrosis, exencephaly, defects in mammary and lymph nodes (233,
239, 246), and hypohidrotic ectodermal dysplasia (247). TRAF6
deficiency in knock out mice shows reduced responses to IL-1R, TNFR
signalling family members, causing an imbalance between immune
activation and suppression (248). TRAF6 is involved in pathogenesis and
progression of several cancers, and overexpression of TRAF6 is reported
in Multiple myelomas (249), lung cancer (250), colon cancer (251), gastric
cancer (252), hepatocellular carcinoma (253), breast cancer (232) and
prostate cancer (254, 255). TRAF6 promotes prostate cancer growth and
invasion by activation of the AKT pathway (256, 257).
43
Aims
The thesis aims to study the biological functions of interactions between several components in different pathways such as Wnt, TGF-β and HIF for cancer progression
Paper I:
To study functional role for TRAF6 in Wnt3a signalling and prostate cancer progression.
Paper II:
To investigate the potential crosstalk between TGF-β and HIF pathways and understanding the biological significance of interactions between components of TGF-β and HIF pathways in clear cell renal cell carcinoma.
Paper III:
To study the expression and association of HIF-3α with the components of HIF and TGF-β pathways and its biological relevance in the progression of renal cell carcinoma.
44
Materials and Methods
Materials: Chemicals and reagents:
4, 6-Diamidino-2-phenylindole Vector Laboratories dihydrochloride (DAPI) 3-8%, 7% Tris-acetate Invitrogen polyacrylamide precast gels 4-12%, 10%, 12% Bis-Tris Invitrogen polyacrylamide precast gels 4% formaldehyde APL Pharma specials Agarose Sigma-Aldrich Alizarin red Sigma-Aldrich Antigen Retrieval Reagents Biocare Medical BCA protein assay kit Thermo Scientific Bovine serum albumin (BSA) Roche Cas9 nuclease, S. pyogenes New England BioLabs Chloroform Sigma-Aldrich COCl2 Tocris DMEM Sigma-Aldrich Dual-luciferase® reporter Promega assay system Duo-link detection kit Sigma-Aldrich ECL kit GE Healthcare EMEM ATCC Ethanol Sigma-Aldrich Ethylenediaminetetraacetic acid Sigma-Aldrich (EDTA) Foetal bovine serum (FBS) Sigma-Aldrich Fugene 6, Fugene HD Promega Glutamine Sigma-Aldrich Glycerol Sigma-Aldrich Hydrogen peroxide (H2O2) solution Sigma-Aldrich Invasion assay kit cell Biolabs LDS sample buffer Invitrogen Methanol Sigma-Aldrich NP-40 Calbiochem
45
Nucleospin® RNA XS columns MACHEREY-NAGEL Odyssey blocking buffer Licor Biosciences Oligofectamine Invitrogen PBS tablets Sigma-Aldrich Pefabloc Roche Penicillin-streptomycin (PEST) Sigma-Aldrich Power SYBR Green PCR master mix Applied Biosystems Prestained PageRuler protein ladder Thermo Fisher Scientific Protein-G Sepharose beads GE Healthcare Recombinant human Wnt3a R&D systems Recombinant TRAF6-Flag Origene RepSox Tocris RIPA buffer Thermo Fisher Scientific RNAimax Thermo Fisher Scientific RNeasy Mini Kit Qiagen RPMI 1640 Sigma-Aldrich Sodium chloride (NaCl) Sigma-Aldrich Sodium citrate Sigma-Aldrich Sodium orthovanadate Sigma-Aldrich Spectra Multicolor High Range Thermo Fisher Scientific Protein ladder TGF-β1 R&D system ThermoScript RT-PCR system Invitrogen Tricaine mesylate Sigma-Aldrich Tris Sigma-Aldrich TritonX-100 Sigma-Aldrich TRIzol Thermo Fisher Scientific Trypsin-EDTA solution Sigma-Aldrich Tween Sigma-Aldrich T7 mMESSAGE mMACHINE Ambion transcription kit
Instruments:
Agilent 2100 Bioanalyzer Agilent Applied Biosystems 7900HT Applied Biosystems fast Real-time PCR system Amersham Imager 600 GE Healthcare
46
BLItz system FORTÉBIO Bright-field microscope 3D Histech Compact desktop centrifuge Eppendorf ELISA scanner Thermo Scientific GloMax®96 Luminometer Promega Interferometry Bio-Layer detection BLItz System Laminar flow hood Labogene NanoDrop 1000 Spectrophotometer Thermo Fisher Scientific Nikon D5200 digital camera Nikon Nikon SMZ1500 stereomicroscope Nikon Odyssey CLx Imaging System Licor Biosciences PCR thermocycler Applied Biosystems See-saw rocker Stuart equipment Tissuelyser II Qiagen Transblot Turbo transfer system Bio-Rad Laboratories ZEISS Axio Imager 2 Carl Zeiss MicroImaging Zeiss LSM 710 Meta microscope Carl Zeiss MicroImaging
Cell lines:
A498 Human Renal cancer cell line which has a loss of expression of VHL due to functional mutation in the VHL gene.
ACHN Human Renal cancer cell line which has intact expression VHL. ACHN is of the clear cell type of RCC.
DU145 Human prostate carcinoma cell line derived from metastatic brain site. DU145 are not hormone-sensitive and lack prostate-specific antigen (PSA) expression.
HEK293 Human embryonic kidney (HEK) cells derived from human embryonic kidney used for expression of LRP5-ICD plasmids and further protein purification.
LNCaP Human prostate cancer androgen-dependent cell line derived from lymph node metastatic site. Epithelial in morphology and adherent.
PC3U Human prostate cancer androgen-independent cell-line. A clonal derivative of a PC3 cell line (258). Derived from the metastatic bone site. Epithelial in morphology and adherent.
47
SW480 Human colon adenocarcinoma cell line. Epithelial in morphology and adherent.
Plasmids:
3xHA-tagged wild-type ubiquitin a gift from V. M. Dixit, Genetech, USA
TCF-reporter TOPflash firefly plasmid Merck-Millipore
pGL4.73 [hRluc/SV40] renilla plasmid Promega
LRP51407–1615HA-(His)6 WT A synthetic gene encoding for LRP51407–1615 HA-(His)6 E1425A the intracellular domain of
human LRP5 from amino acid 1407 until 1615 as WT or with a mutant TRAF6 consensus binding motif ordered from Eurofinsgenomics, Germany and further cloned into pCMV tag5.
pDR274 Zebrafish single guide RNA (sgRNA) expression vector, Addgene
ALK5-HA (TβRI) Gift from P. ten Dijke, University of Leiden, the Netherlands
pcDNA 3.1-VHL Origene technologies
siRNA:
TRAF6 siGENOME human Dharmacon Research
SMARTpool siRNA
Non-specific control siRNA Dharmacon Research
siVHL Ambion, Thermo Fisher Scientific
48
Patients and tumour samples:
The study involves 154 patients with ccRCC (Fig 12). All clinical samples used were collected after obtaining informed and signed consent from patients. The study is approved by the institutional review board and the ethical committee of northern Sweden. Tumour and adjacent kidney cortex samples were obtained after nephrectomy from the patients. The samples were used for the protein studies, and the number of samples for each protein depended on the sample availability. Patient follow-up performed in a scheduled program and used for survival analysis.
Fig 12: Categorisation of ccRCC Patients involved in the study based on gender, age, tumour size, stage, grade and patient follow up.
Methods:
Invitro cell culture and transfections:
Cell lines were grown in the corresponding media as represented in Table 1. Cells were transfected with corresponding plasmids using Fugene 6 or Fugene HD according to the manufacturer's protocol. siRNA was transfected using oligofectamine or RNAimax according to Manufactures protocol. Cells were starved for 12 hrs (ACHN & A498) or 16-18 hrs
49
(PC3U, DU145, LNCaP, SW480) and further stimulated with Wnt3a (50 ng/ml) or TGF-β (10 ng/ml) for different time points.
Cell line Culture Conditions Growth Media Starving media Paper
A498 37 ⁰C + 5% CO2
RPMI1640 + 10% FBS + 1% L-Glutamine RPMI1640 + 2% FBS II&III
ACHN 37 ⁰C + 5% CO2
EMEM + 10% FBS + 1% L-Glutamine EMEM + 2% FBS II&III
DU145 37 ⁰C + 5% CO2
RPMI1640 + 10% FBS + 1% PEST + 1% L-
Glutamine
RPMI1640 + 1% FBS + 1% PEST + 1% L-
Glutamine I
HEK293 37 ⁰C + 5% CO2
EMEM + 10% FBS + 1% PEST + 1% L-Glutamine I
LNCaP 37 ⁰C + 5% CO2
RPMI1640 + 10% FBS + 1% PEST + 1% L-
Glutamine
RPMI1640 + 1% FBS + 1% PEST + 1% L-
Glutamine I
PC3U 37 ⁰C + 5% CO2
RPMI1640 + 10% FBS + 1% PEST + 1% L-
Glutamine
RPMI1640 + 1% FBS + 1% PEST + 1% L-
Glutamine I
SW480 37 ⁰C + 5% CO2
DMEM + 10% FBS + 1% PEST
DMEM + 1% FBS + 1% PEST I
Table 1: Culture conditions and growth media for different cell lines used in the study.
Immunoblotting (IB) and Immunoprecipitation (IP):
Cells were harvested after stimulation and lysis of cells was carried out using RIPA buffer (50 mM Tris (pH 8), 150 mM NaCl, 1% TritonX-100, 10% (v/v) glycerol, 1 mM aprotinin, 1 mM Pefabloc and 1 mM Sodium orthovanadate) and total cell proteins were extracted. Protein concentrations were determined by BCA kit. Total cell lysates were subjected to immunoprecipitation using corresponding antibodies overnight and incubated with protein-G beads for 1hr at 4⁰C. Beads were washed four times, and LDS sample buffer was added to the beads and boiled for 5 min to elute the immunocomplexes. Further samples were loaded on to precast SDS PAGE gels and blotted on to nitrocellulose filters using iBlot or Transblot Turbo transfer system. Membranes were blocked in 5% BSA or Odyssey blocking buffer for 1h at room temperature and
50
incubated overnight at 4°C with gentle agitation with the corresponding primary antibodies (Table 2). Primary antibodies were detected using HRP-conjugated antibodies or light chain specific HRP-antibodies or IRDye® secondary antibodies (Licor) (Table 2) and developed using the enhanced chemiluminescence (ECL) kit from GE Healthcare or Odyssey CLx Imaging System. Image Studio SystemTM software version 3.1 (Licor Biosciences) was used to measure the density of proteins and β-actin was used as an internal control for measuring relative density values for all the proteins.
Antibody Species Catalogue number
Company Application
TRAF6 Rabbit ab40675 Abcam IB, IP
TRAF6; D10 Mouse sc-8409 Santa Cruz IF
TRAF6 Rabbit ab33915 Abcam PLA
K63 Mouse BML-PW0600 Enzo Life Sciences Inc PLA
LRP5 (D80F2) Rabbit 5731 Cell signalling technology IB, IP, IF
LRP5 Goat ab36121 Abcam PLA, IF
β-Catenin Mouse 610154 BD Biosciences IB,IP,IF
Active β-Catenin Rabbit 8814 Cell signalling
technology IB
β-Actin Mouse A5441 Sigma-Aldrich IB
c-Myc Rabbit 5605S Cell signalling technology IB
Anti-HA Mouse 11666606001 Roche IB
HIF-1α Rabbit NB100-134 Novus Biologicals IB, IP, PLA
HIF-2α Rabbit, Mouse
NB100-122, NB100-132 Novus Biologicals IB, IP, PLA
HIF-3α Rabbit ab10134 Abcam IB, IP, PLA
SNAI1 Rabbit 3879 Cell Signaling Technology IB
HA Rabbit 2367 Cell Signaling Technology IB, IP, PLA
51
TβRI or ALK5 (V-22) Rabbit sc-398 Santa Cruz
Biotechnology IB, IP
Phospho-SMAD2 Rabbit 3108 Cell Signaling
Technology IB
SMAD2 Mouse 3103 Cell Signaling Technology IB
PAI-1/Serpine1 Rabbit NBP1-19773 Novus Biologicals IB
VHL (G-7) Mouse SC-17780 Santa Cruz Biotechnology IB
VHL Rabbit NB100-485 Novus Biologicals IB
CA9 Rabbit ab15086 Abcam IB
GLUT-1 Rabbit PA1-46152 Thermo Fischer Scientific IB
E-Cadherin Mouse ab76055 Abcam IB
N-Cadherin Rabbit ab18203 Abcam IB
Danio rerio TRAF6 Rabbit GenScript HK Ltd. IB
Secondary Antibodies for IB and IP
Goat anti-rabbit HRP Rabbit P0448 Dako
Goat anti-mouse HRP Mouse P0447 Dako
Light chain anti-rabbit Rabbit 211-032-171 Jackson Immuno-
research laboratories
Light chain anti-mouse Mouse 115-035-174 Jackson Immuno-
research laboratories
IRDye® 800CW Goat anti-Rabbit
Rabbit 925-32211 Licor Biosciences
IRDye® 680RD goat anti-
Mouse Mouse 925-68070 Licor Biosciences
Secondary Antibodies for Immunofluorescence (IF)
Alexa Flour 555 donkey anti-rabbit
Rabbit A-31572 Invitrogen
Alexa Flour 488 goat anti-
mouse Mouse A-10680 Invitrogen
Alexa Flour 555 Rabbit anti-goat
Goat A-21431 Invitrogen
52
Table 2: List of antibodies used in the studies. Primary and secondary antibodies used for Immunoblotting, Immunoprecipitation and Immunofluorescence.
Immunofluorescence:
PC3U cells were grown on sterile coverslips, and after stimulation, cells were collected and washed with PBS. Then the cells were fixed and permeabilised for 10 min each with 4% formaldehyde and 2% Triton-X100 and blocked with 5% BSA for 1 hr. Cells were incubated with primary and secondary antibodies for 1 hr each and mounted onto a glass slide with mounting media containing DAPI. Co-localisation of proteins were visualised using confocal microscopy.
Dual-Luciferase assay:
TCF reporter plasmid TOPflash is transfected along with either siTRAF6 or siCtrl to measure the Wnt signalling activity in the presence and absence of TRAF6 in PC3U and SW480 cells. Renilla Luciferase is also transfected into cells to serve as internal transfection control. After cells were treated with Wnt3a, lysates were made, and Dual-Luciferase assay is performed using Luminometer according to the manufacturers' protocol.
Proximity Ligation assay (PLA):
In situ Proximity ligation assay in cells:
Cells were grown in eight-well or six-well dishes and stimulated with Wnt3a or TGF-β accordingly. After stimulation cells were fixed, permeabilised and blocked using 4% formaldehyde, 2% Triton-X100 and Duo-link blocking buffer respectively. The further assay was performed according to the manufacturer's protocol using Duo-link detection kit (Sigma). Cells were mounted on to slide using mounting media containing DAPI and images were taken at 40× objective lens using confocal microscopy. The analysis was performed using Duo-link image tool software to quantify the signals.
53
In situ Proximity ligation assay in prostate adenocarcinoma tissue sections:
Malignant tissue sections from prostate adenocarcinoma were obtained from male patients who had undergone through prostatectomy. Tissue sections were rehydrated in an ethanol gradient, and heat-induced antigen retrieval performed followed by blocking with Duolink blocking solution or 5% normal goat serum for 1 hr. Tissue sections were further incubated with primary antibodies overnight at 4⁰C and treated with PLA Duolink probes. For fluorescent imaging, amplification was performed with 1x amplification buffer red and counterstained with phalloidin –Alexa 488, and for brightfield detection, amplification was performed followed by bright-field detection, substrate development and nuclear staining. Sections were mounted, and images were obtained either by using Zeiss Imager Z2, with objectives plan-Apochromat dry NA 0.8 and Plan-Apochromat oil immersion NA 1.4 or bright field microscope. From the whole scanning pictures, three different images with at least 300 cells were taken at random, and the mean PLA dots versus total cells (mean ± S.E.M) were counted and analysed by Mann-Whitney U test.
Ubiquitination Assay:
PC3U cells were transfected with HA-tagged ubiquitin and harvested after stimulation with Wnt3a. Cells were heated at 95⁰C in the presence of 1% SDS and diluted with lysis buffer containing 0.5% NP-40, followed by centrifugation. The slimy layer was collected and incubated with TRAF6 primary antibody overnight and then incubated with protein-G beads for 1hr at 4⁰C. Beads were washed four times, and sample buffer along with a reducing agent, was added to the beads and boiled for 5 min (144).
Quantitative real-time PCR:
RNA was extracted from cancer cell lines using the RNeasy Mini Kit according to the manufacturer's protocol and the RNA concentration, was measured using a NanoDrop 1000 Spectrophotometer. cDNA synthesised
54
from total RNA using the ThermoScript RT-PCR system. qRT PCR was performed using Power SYBR Green PCR master mix, and forward and reverse primers (primers used presented in Table 3) in Applied Biosystems 7900HT Fast Real-time PCR system.
Gene Forward Primer Reverse primer
TRAF6 GTTGCTGAAATCGAAGCACA CGGGTTTGCCAGTGTAGAAT
β-Catenin CCAATAGGGGCACAAAACGT CCTCTTCCCCATCTCTGTCA
LRP5 ACGTCAGCCTGAAGACCATC GCGCCACTTCGATTCTGTTG
c-Myc CTTCTCTGAAAGGCTCTCCTTG GTCGAGGTCATAGTTCCTGTTG
GAPDH CTCTGGTAAAGTGGATATTGT GGTGGAATCATATTGGAACA
Table 3: Primers for human prostate cancer cell line (PC3U) mRNA qRT-PCR analysis.
Invasion Assay:
Cells were transfected with respective siRNA or plasmids and starved for 12 hrs. The invasion kit chambers were coated with Bovine Type I collagen and the assay was performed according to the manufacturers' protocol. Trypsinised cells were seeded into the upper chamber containing media with 2% FBS. The chambers are immersed into a 24-well plate containing 10% FBS with media. Cells were stimulated with either Wnt3a (50 ng/ml) or TGF-β (10 ng/ml) for 24 hrs. Upon stimulation, invasive cells migrate from the upper chamber to the 24-well plate through collagen filter and captured in the filter. The process was stopped by removing the upper chambers from 24-well plate, and collagen filter with cells was stained with a staining solution and photographed with a Zeiss light microscope. Next, the invaded cells were lysed, and the optical density (OD) was measured at 560 nm.
Label-free monitoring of a TRAF6-LRP5 protein interaction:
To measure the protein interaction between two proteins in real-time, we have used interferometry Bio-layer detection with BLItz system.
55
Recombinant LRP51407–1615HA-(His)6WT was immobilised on Ni-NTA sensor, washed once with PBS and Kon determined by adding TRAF6-Flag at a concentration of 167 nM or 822 nM. Next, Koff determined by washing with PBS until a stable binding curve was achieved.
In silico gene expression analysis:
cBioPortal, an online repository to study gene expression using Provisional TCGA databases in prostate cancer and renal cell carcinoma, was used. Gene expression correlations between the genes were quantified using these databases. We also obtained the survival analysis data from the Human Protein Atlas using TCGA databases where Kaplan-Meier plots showing the correlation between patient survival and mRNA expression levels. GENEVESTIGATOR®, a public database, was used to find the TRAF6 mRNA expression levels among various cancers. KM-plotter and OncoLnc databases were also used to obtain cancer-specific and overall survival curves for RCC patients.
Statistical analysis:
All the experiments were performed at least three times independent of each other unless otherwise stated. IBM SPSS Statistics 24.0 was the software used to perform statistical analysis. Student's t-test and Mann-Whitney U test was used to show the difference in expression of two independent variables and bivariate correlations between two proteins were analysed using Spearman's correlation. Kaplan-Meier curves were used to show the survival data in cancer patients and zebrafish. Error bars indicate standard error of the mean (S.E.M). P values <0.05 were considered statistically significant.
Zebrafish Experiments:
Zebrafish Strains and Maintainance:
Zebrafish (Danio rerio) was used in the experiments and the mutants generated were under permits from the ethical board (permit: A-13-15;
56
Umeå Djurförsöksetiska nämnd). Either London wild Type or tupfel long fin strains were used to obtain embryos and Larvae. Zebrafish (ZF) were maintained by standard procedures at the zebrafish facility at Umea University.
CRISPR/Cas9 mediated generation Zebrafish TRAF6 mutants:
Clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR associated protein-9 nuclease (Cas9)-CRISPR/Cas9 technique was employed to generate ZF TRAF6 mutants. TRAF6 exon-2 was targeted for the generating mutations using customised 20 nucleotide sequence pair; 5′-CTGTCTGATGGGTCTCCGCT-3′ (right) and 5′-AGCGGAGACCCATCAGACAG-3′ (left). CAS9 nuclease along with transcribed sgRNA containing nucleotide sequence pair injected into single-cell staged zebrafish embryos. Mutated DNA loci in Fo fish were identified by a restriction enzyme MbiI recognises incorporated restriction site in each customised target nucleotide sequence. Sequencing is later performed to confirm the mutations in the DNA sequence.
Zebrafish DNA - RNA extraction and quantitative RT-PCR:
Heterozygous TRAF6 male and female were incrossed, and seven days post fertilisation (dpf) embryos were collected for RNA extractions. Single embryos were transferred into Eppendorf tubes with TRIzol and homogenised in a tissuelyser. After chloroform added, the samples were centrifuged and the transparent top aqueous layer used for RNA extraction and bottom organic layer for DNA extraction. RNA containing aqueous layer precipitated with 70% RNA and applied to Nucleospin® RNA XS columns. Further procedures were performed according to the manufacturer's protocol. RNA quality is assessed using Agilent bioanalyser. cDNA and qRT PCR performed as described in the above sections. Primers used in qRT PCR presented in Table 4.
57
Zebrafish gene Forward Primers Reverse Primer
β-Catenin1 CCATTGGCAGCAACAGTCTT GAAGGACTGGTTGAAGCCCT
β-Catenin2 CCATGGAGCAGGACCGTAA CCTGCTCCCACTCGTACAG
LRP5 AGTAGGACGAGCAAACGGAC GATCTCTCGCTGTAGACTTTGC
Cyclin D1 TTGTTTTGCTGCGAAGTGGA TCGCGACGATTTTCCTCATT
CBX8a GAATATTCTGGATGAGCGTC GCTTTTGCCTTCATTAGAAAC
CBX8b CCACAGGACTAATCCACAAT TGAATAGTGCTTCAGGTGTT
MSXd AGTTTGGTCAGAGGAGAAAT CTTGTGGAGTCTTGAGAGAA
β-Actin CGAGCTGTCTTCCCATCCA TCACCAACGTAGCTGTCTTTCTG
Table 4: Primers for zebrafish mRNA qRT-PCR analysis
Whole Mount staining for Zebrafish bone:
Adult WT and TRAF6-/- zebrafish (50 dpf) were treated with a lethal dose of tricaine mesylate and fixed in 10% formalin. Visceral organs were surgically removed, and the body cavity was rinsed with distilled water. Further clearing procedures were performed by placing fish in 1% KOH + 3% H2O2 solution for 2 hr followed by 2 hr with half this concentration, rinsed with distilled water twice and transferred into 30% saturated sodium tetraborate solution and incubated overnight. Soft tissues were digested using a solution with 1% trypsin and 2% borax for 4 hrs or more depending on the amount of tissue left. Then fishes were stained in 1% KOH + Alizarin red solution for 12 hrs or more. Specimens were rinsed with distilled water several times to remove excess stain and transferred to 100% glycerol before a series of 1% KOH: glycerol solutions (80:20, 60:40, 30:70) (259). Specimens were photographed using Nikon SMZ1500 stereomicroscope and a Nikon D5200 digital camera.
58
Results and Discussion
Paper I: TRAF6 function as a novel co-regulator of Wnt3a target genes in
prostate cancer
Prostate cancer is the second most frequently diagnosed cancer and the
fifth leading cause of cancer-related death in men (6, 7). Wnt signalling is
a vital growth factor signalling pathway involved in embryo development
and is also implicated in cancer progression (45, 53, 54). Aberrant Wnt
signalling due to either genetic or epigenetic changes in Wnt components
leads to the development of castration-resistant prostate cancer, but the
underlying molecular mechanisms remained elusive. Targeting Wnt
signalling by downregulation could prevent the progression of prostate
cancer (115, 260). In this paper, we have elucidated an important co-
regulatory role of TRAF6 in the Wnt pathway in human prostate and
colorectal cancer cells, which was confirmed in vivo by using
CRISPR/Cas9 genomic editing, in zebrafish.
TRAF6, an E3 ubiquitin ligase and an adapter protein promote
inflammatory responses to various cytokines (223). We found that TRAF6
has a functional role as a positive co-regulator of Wnt components and
their target genes. We found that TRAF6 interacts and co-localises with
Wnt hallmark protein β-Catenin and the Wnt co-receptors LRP5 and LRP6
upon Wnt3a stimulation in human prostate cancer cell lines and also in
human prostate cancer tissues. TRAF6-LRP5 interaction was also
observed in SW480 cells, a colon adenocarcinoma cell line, demonstrating
that interaction also occurs in other cancer forms. TRAF6
59
autoubiquitination is an essential event for its activation (244), and we
found that upon Wnt3a stimulation TRAF6 undergoes K63-linked
ubiquitination for its enzymatic activity. By in silico analysis, we looked
for a possible consensus binding motif (Pro-X-Glu-X-X-(aromatic/acidic
residue)) (228, 235) for TRAF6 in the LRP5 protein structure and found
the motif PHEYVS. We speculate that phospho-serine in the last position
of the consensus sequence in LRP5 may substitute the properties of acidic
amino acid, making it a binding site for TRAF6. By mutagenesis studies
in PC3U cell lines we observed reduced association between TRAF6-
LRP5 observed in mutant LRP5. No direct interaction between the
recombinant proteins was observed, suggesting that it is likely due to that
both TRAF6 and LRP5 undergo post-translational modifications in cancer
cells, which contribute to the regulation of their binding activity. From
these findings, we speculate that Wnt3a promotes TRAF6 interaction with
Wnt components (LRP5, LRP6 and β-Catenin), both in vivo and in vitro.
By using siRNA in prostate cancer and colon cancer cell lines, we found
that TRAF6 is required for gene expression of β-Catenin as well as for the
Wnt-ligand co-receptor LRP5 and effects c-MYC mRNA and protein
expression. Earlier studies reported that the high expression of both
TRAF6 and c-Myc is correlated with poor survival in patients with prostate
cancer (261-263). We further investigated a functional role for TRAF6 in
Wnt3a-induced cancer responses, by silencing TRAF6 expression in
prostate cancer (PC3U) and colon adenocarcinoma (SW480) cell lines and
observed that expression of TRAF6 was required in both cancer cell lines
to promote Wnt3a-induced invasion of cancer. Our observations from the
invasion assay explain the potential role of TRAF6 in cancer cells for their
60
invasion capabilities, which is identical with earlier studies in the lung,
gastric and colon cancer (250-252). This positive regulation of TRAF6 is
essential for Wnt3a induced responses in prostate cancer and colon cancer.
We generated CRISPR/Cas9 mediated TRAF6 deficient zebrafish, where
the majority of TRAF6 mutant zebrafish did not survive into
adulthood, which is consistent with survival studies on TRAF6 deficient
mice. Previous studies show that TRAF6 and LRP5 were involved in bone
metabolism, and defects in both the genes were reported to have a severe
bone malformation in humans and mice (54, 239, 246, 264, 265). Similar
to the effects in mice, TRAF6 deficient zebrafish show signs of defective
bone formation with a fusion of tail vertebrae which resulted in the
abnormal tail formation and a malformed body axis. TRAF6 deficient
zebrafish also show decreased mRNA expression levels of the Wnt
components LRP5, β-Catenin1/2 and other target genes such as Cyclin
D1, Msxd, CBX8a/b. TRAF6 induced positive regulation of these genes is
crucial for the survival and development of zebrafish.
This study identifies TRAF6 as an evolutionary conserved co-regulatory
protein for transduction of the canonical Wnt3a pathway that also
promotes progression and invasion of prostate cancer through its positive
effects on Wnt signalling. In future, TRAF6 may contribute as a
therapeutic target for inhibiting prostate cancer progression and improving
the prognosis for patients with prostate cancer
61
Paper II: Interactions between TGF-β type I receptor and hypoxia-inducible
factor-α mediates a synergistic crosstalk leading to poor prognosis for
patients with clear cell renal cell carcinoma.
Effective delivery of oxygen is essential in multicellular organisms to
perform normal metabolic activities. Hypoxia is a condition with deprived
oxygen content in the tissues. Hypoxia can lead to several physiological
and pathophysiological conditions like cancer. HIFs (Hypoxia-inducible
factors) regulate the hypoxia-mediated cellular responses. HIF pathway
deregulation such as epigenetic silencing of the VHL gene is one of the
common cause in Renal Cell Carcinoma (RCC) (266). RCC is a common
malignancy in adults which originates from renal tubular epithelium in
kidneys. In this study we have investigated the possible cross-talk between
HIF and TGF-β pathways in clear cell Renal cell carcinoma (ccRCC)
We demonstrated that HIF-1α and HIF-2α were significantly higher in
ccRCC tumour samples compared to adjacent kidney cortex. Earlier
studies also elaborated the increased roles of HIF-1α and HIF-2α in cancer
progression (267, 268). Survival analysis showed increased expression of
HIF-2α, which was associated with poor cancer-specific survival but not
with HIF-1α. Expression of HIF-1α negatively correlated with VHL but
not with HIF-2α. HIF-1α is reported to be degraded by hypoxia-associated
factors (HAFs) in normoxia, and it is dependent on VHL. However, HIF-
2α was regulated differently by HAFs, driving them towards
transactivation. HIF-2α was reported to be associated with chronic
prolonged hypoxia, and HAFs regulate the switch from HIF-1α to HIF-2α,
i.e., during early hypoxia to sustained hypoxia (269, 270). Also, we found
62
HIF-1α associated with smaller tumours and HIF-2α associated with
advanced tumour stage supporting the earlier observations.
Further, we investigated the association between the proteins in HIF and
TGF-β signalling pathways in ccRCC. HIF-2α significantly correlated
with ALK5-ICD, pSMAD2/3, PAI-1 and SNAI1 proteins and a close to
positive association trend with ALK5-FL was observed while HIF-1α was
found to be associated with only pSMAD2/3. Also, SNAI1 was found to
be significantly correlated with all the TGF-β components. From earlier
reports, it is known that HIF-1α mediated hypoxia induces upregulation of
Smad dependent TGF-β pathway (271), PAI-1 is a known target gene of
both HIF-1α and HIF-2α (272) and SNAI1 is known to be induced by both
TGF-β and hypoxia (273) which is consistent with our data.
It is reported that ectopic ALK5 expression in Renal cell carcinoma cell
lines leads to activation of TGF-β signalling and ALK5-ICD is correlated
with poor prognosis and tumour progression (274). Also, VHL is known
to ubiquitinate ALK5 for its proteasomal degradation (275). From these
observations, we speculate that ALK5 is a crucial player in the regulation
of TGF-β and hypoxia signalling, and we, therefore, investigated its role
in the functional crosstalk. We found that in normoxia, ectopic expression
of ALK5 induced increased expression of HIF-1α and HIF-2α and their
classic target genes CA9 and GLUT1 (276, 277). Also, VHL expression is
negatively correlated with levels of HIF-1α, HIF-2α and PAI-1 levels.
Further we demonstrated that ALK5 kinase activity is needed for its
expression and induction of TGF-β and Hypoxic factors along with their
target genes. We also reported that ALK5 induced invasiveness of RCC
cell lines and leads to reduced E-cadherin expression. Further, we
63
confirmed an increased expression of ALK5 under hypoxic conditions
using CoCl2, a chemical inducer of hypoxia (278, 279). Importantly, we
showed that ALK5 interacts with both HIF-1α and HIF-2α, and these
complexes were localised both in cytoplasm and nucleus.
From these results, we conclude that cancer progression is mediated by
crosstalk between various signalling pathways and here our findings shed
light on the critical aspects of Hypoxia and TGF-β induced ccRCC tumour
progression by their synergistic crosstalk in which ALK5 potentially
drives the expression of HIF-1α and HIF-2α even under normoxic
conditions. Also, the novel finding of an interaction between ALK5 and
HIF-α might provide a more in-depth understanding of mechanisms
behind tumour progression.
64
Paper III: Expression and association of HIF-3α with hypoxic and TGF-β
signalling components in Renal cell carcinoma.
HIF-3α exists in ten different functional splice variants, which makes it
challenging to characterise their biological importance during hypoxia.
HIF-3α is known to be relatively weak transcriptional activators of
hypoxia-responsive genes. HIF-3α has dual roles that are regulation of its
target genes and suppressing the levels of HIF-1α and HIF-2α by
competitive binding with HIF-β subunit and thereby regulating the target
genes of HIF-1α and HIF-2α (184). Also, HIF-3α4 has a dominant-
negative function of inactivating HIF-1-mediated transcription. This HIF-
3α4 is down-regulated in ccRCC patients leading to increased HIF-1α
levels, suggesting potential significance in renal tumorigenesis (280, 281).
HIF-3α has unique c-terminal LZIP domain which enables it to bind to
DNA and proteins, thereby promoting HIF-3α-specific gene transcription
(282).
In this paper, which is an ongoing study, we investigated the role of HIF-
3α in the progression of Renal cell carcinoma and its association with the
components of TGF-β. We investigated ccRCC and pRCC patient tumour
tissue samples and observed that HIF-3α protein levels were increased in
patient tumour samples compared to adjacent kidney cortex. We further
analysed the clinicopathological parameters and found that HIF-3α levels
were associated with advanced tumour stage and metastasis in ccRCC and
associated with larger tumours in pRCC. It has previously been reported
that HIF-3α is known to be associated with prolonged hypoxia (269). Data
from public databases show that HIF-3α is a significant prognostic factor
65
associated with improved survival in pRCC patients and total RCC
patients. However, HIF-3α was not associated with cancer-specific
survival in both patient sample data and also from public databases.
In our previous study (Paper-II) (283), we have shown a significant
association between HIF-1α and HIF-2α and TGF-β components. In this
study, we observed that HIF-3α show a significant positive correlation
with HIF-1α and HIF-2α in pRCC and, in ccRCC, it has a significant
positive correlation with VHL. Besides, in ccRCC HIF-3α show a
significant positive association with pro-invasive gene SNAI1, which is a
crucial regulator of epithelial to mesenchymal transition.
TRAF6 an E3 ligase known to be a prognostic marker in RCC and we
observed that HIF-3α associates with TRAF6. From earlier studies,
TRAF6 is known to be a positive regulator of HIF-1α levels independent
of oxygen availability. TRAF6 is also known to polyubiquitinate HIF-1α
and enhances its expression (284, 285). In this study, using cBioportal
TCGA provisional database, we found that TRAF6 has a significant
positive correlation with HIF-3α and TRAF6 was associated with better
overall survival in both pRCC and ccRCC. From the in vitro studies by
using immunoprecipitation and PLA, we have found that HIF-3α interacts
with TRAF6 in ACHN cell line and TGF-β enhances the expression of
HIF-3α and TRAF6.
From these data, we conclude that HIF-3α could play a vital role in the
RCC progression via its effects through increased levels and significant
association with clinicopathological parameters. The interactions with
TGF-β components might have positive effects on migration and invasion
66
primarily through SNAI1, and also TRAF6 could be a key player. As a low
expression of TRAF6 related to poor prognosis, its normal levels might be
essential to maintain homeostasis and regulation of HIF-3α through its
direct interaction. We are still working on the other experiments to
investigate if TRAF6 can ubiquitinate HIF-3α and regulate its role in
hypoxia and normoxia.
67
Concluding remarks
PAPER I:
• TRAF6 is an E3 ligase which interacts with Wnt components
LRP5, β-Catenin and positively regulates their expression.
• TRAF6 is an important co-regulator of Wnt3a signalling and
thereby promote activation of Wnt target genes and drives prostate
cancer progression.
• TRAF6 regulates Wnt3a-induced invasion of cancer cells and
promote cancer progression.
• TRAF6 is crucial in the embryonic development and crucial for
survival and bone development zebrafish through its positive
regulation of Wnt target genes.
PAPER II:
• HIF-1α and HIF-2α protein levels were increased in ccRCC
tumours, and they are positively associated with TGF-β
components such as ALK5, ALK5-ICD, pSMAD2/3, PAI-1 and
SNAI1.
• HIF-1α and HIF-2α associated with smaller tumours and advanced
tumour stage, respectively. In addition, increased expression of
HIF-2α significantly associated with poor cancer-specific survival
but not HIF-1α.
• ALK5, through its kinase activity, potentially drives the expression
and increases HIF-1α and HIF-2α levels under normoxic
68
conditions and further effects expression of hypoxic target genes
CA9 and GLUT1. Further VHL dictates the expression of hypoxic
factors under normoxia.
• Hypoxia induces the expression of ALK5 and also phosphorylates
SMADs in RCC cell lines. ALK5 also induces invasiveness in
renal cell carcinoma.
• ALK5 interacts with both HIF-1α and HIF-2α in normoxic
conditions.
PAPER III:
• HIF-3α protein levels were increased in both ccRCC and pRCC
patient tumour samples. HIF-3α associated with advanced tumour
stage and metastasis in ccRCC and larger tumours in pRCC.
• HIF-3α significantly associates with SNAI1 and VHL in ccRCC,
and in pRCC, it is associated with HIF-1α and HIF-2α.
• HIF-3α interacts with TRAF6 in vitro, and TGF-β enhances the
expression of HIF-3α and TRAF6
69
Acknowledgements
It was a great journey. Full of beautiful memories and happy moments. I have experienced both the roller-coaster rides and smooth rides. Ups and downs. Failures and success. Disappointments and achievements. ‘Your best teacher is your last mistake’ – I made many mistakes, and I earned many teachers. I learnt from my mistakes and always tried to make new mistakes. The journey of my PhD happened with years of groundwork not only from me but also from my family and my teachers. In the journey of my PhD, I got a chance to meet different people with different backgrounds. It was a great experience getting to know people which helped me in paving my path towards PhD studies. I want to thank each and everyone who helped me to reach my goals.
I want to thank Umea University and the funding agencies Knut and Alice Wallenberg Foundation (KAW 2012.0090), Swedish Cancer Society (CAN 2017/544), Swedish Medical Research Council (2016-02513), Prostatacancerförbundet, Konung Gustaf den V:s och Drottning Victorias Frimurarestiftelse and Cancerforskningsfonden Norrland for financially supporting my PhD studies.
Firstly, I want to thank and express my immense gratitude to my supervisor, Marene Landström, who believed in me and provided the opportunity to do a PhD. You are an inspiration to me. During the experiments, the immense support and encouragement you gave enabled me to work with a positive attitude. No matter the result, your support always drove me towards the final destination. You are an excellent teacher, providing scientific insights and guided me throughout the journey. Your caring, patience and motivation helped to complete my PhD with flying colours. Thank you for everything.
I want to express sincere thanks to Jonas von Hofsten, my co-supervisor. I started my research journey at your lab as a master student during my early days in Umea. You taught me right from basics in research and handling fishes. I haven’t met such a calm and a composed person like you in the field of research. You always supported when Marene and I wanted to generate TRAF6 mutants and encouraged us to go further with CRISPR technology. We had excellent talks in the fish room during genotyping and discussions about TV series. I hope you finished watching all the seasons of ‘walking dead’. I always annoyed you with my time sense and my lethargic work in cleaning fish tanks, but you tolerated me so much (I am getting better with cleaning nowadays). Thank you so much for guidance and help during my PhD studies.
I want to thank my co-supervisor Carl-Henrik Heldin for your feedback on my TRAF6 project and always enjoyed your views and inputs on our projects during the KAW meetings and conferences. You are such an inspiration. I also want to thank my co-supervisor Ruth Palmer for your inputs on TRAF6 project and discussions about possible work with Drosophila during the initial days of my PhD.
I would like to acknowledge Börje Ljungberg for his advice and scientific inputs for the RCC projects.
70
I would like to acknowledge Anders Bergh and Pernilla Anderson for helping in providing patient tissue samples and pleasant interactions during prostate cancer meetings along with Pernilla Wikström, Emma Persson, Maria Brattsand and all other.
I especially want to thank my present and past colleagues from Marene’s group with whom I grew up in research.
Shyam and Reshma, who initially guided me in the lab when I joined as a student and taught me everything related to cell culture and many.Thank you, Shyam for introducing me to TRAF6-Wnt project. I have much enjoyed your company in the lab, and the excellent time we spent together. My wishes to Ameya. I always enjoyed Reshma’s oven biryani. Hope we will have more food in future together. Thanks for your support.
I am grateful to Yabing Mu and Guangxiang for their suggestions and help with experiments in TRAF6 project. Thank you
Stina Rudolfsson, you are always welcoming. Thanks for teaching me the basics of prostate cancer during the initial days of my PhD. I really enjoyed our pleasant times during the conferences in Leiden and Uppsala.
Jie Song, we shared office space right throughout our PhD studies. We shared sweet talks, jokes, gossips and many. We had delightful times during the conferences. Thank you for your help with my experiments, especially PLA experiments (I troubled you with a lot of questions). All the best for your research carrier.
I also want to thank Alexej Schmidt for your help in the TRAF6 project. Your contribution to the project has increased the standard of the paper. Your feedback and inputs in the manuscript helped a lot. We had a pleasant conversation about food, culture, beer.. many. I like your multilingual email about the lab duties (PS: Our Indian lab members do not speak Hindi). Thank you.
Lennart, you are such a happy man. Our never-ending discussions on the whiteboard. They were fun. Your constant new ideas about Wnt and TRAF6 really helped in completing the project. You made work easy with so many plasmid constructs. I hope we will have many more ideas for designing new projects. Thank you for your contributions.
Olena Rakhimova, you are such a nice person with all positive vibes. I always enjoyed our conversations, and I cannot forget your instant help when I asked for a phone conversation with airport people. I still remember your piano skills (at a meeting in Olofsfors bruk). Thank you.
Samaneh, I am always jealous of your hard work and your skills with managing things. Your contribution to TRAF6 project really helped in speeding up the project. I enjoyed your food and a delightful dinner with your family. Thank you for your contributions.
I would also like to thank past members of Marene’s group Linda Köhn – for great times and discussions in the lab and during TGF-β conferences. Anders Wallenius – we used to sit next to each other in the conferences. I used to like your abstract drawings in your
71
notes during conference talks and the ideas about your tattoos and of course, surfing. Thanks for sharing your thoughts about CRISPR. Also, I would like to thank Maria, Gizem, Li Wang, Chunyan Li, Yang Zhou, Tommy Etekal and Dincer for beautiful times during my PhD studies in the lab.
I would like to thank Ravi, Vidya and little Kanasu. We had delightful times with our families on many occasions with yummy food. I always love your instincts Ravi, and your humour and jokes. Our lively conversations at Kahls for years together and your help during gowthami pregnancy really boosted our energies. Thanks for always being with us. Thank you for introducing me to ccRCC project which helped me for the completion of my PhD studies. Thank you for everything.
Thanks to Pramod and Neetha for our wonderful times together in Umea. Pramod, I don’t know where to start because you are with me all the time. We started our journey together and happy that it is still going and hope it continues further. We experienced everything together. You are a great friend and always supportive. I always feel so glad that our relationship is happening in both the personal and professional lives of ours. Our journey together is a roller-coaster ride. We shared our happy and sad moments together. I am glad that we have such kind of relationship between us. I would like to congratulate you and wish you all the best for your PhD thesis defence. It's always lovely to see Praneetha, Aaryan and Raaga grow up together. Thanks for your encouragement and support all through these years.
I want to specially acknowledge the administrative staff of Medical Biosciences, Terry Persson, Clas Wikström, Carina Ahlgren, Ida Laestander, Karin Boden and Åsa Lundsten for their continuous and constant help all throughout my PhD studies. Thank you for your unconditional support.
Terry, you are such a sweet person. I still remember your constant emails to both Migrationsverket and US embassy for my visa issues. Oh... I cannot ask you for more. Also during my thesis writing, you took good care of me with chocolates and fruits late in the evenings. Thanks for everything.
I would like to acknowledge Maria Brattsand, for introducing me to cross-country skiing (which I failed miserably by not following basics) during winter 2014. It was a lifetime experience.
I also want to thank Karin Nylander, Jonathan Gilthorpe and Gunilla Olivercrona for their advice and encouragements.
I would like to thank colleagues from Jonas von Hofsten group. Hanna Nord - you introduced me to the research work environment during my master thesis. Thanks for your patience and help in teaching me the basics about zebrafish. Thanks for your advice in generating CRISPR knockout fishes. Nils – we had wonderful conversations together. I always enjoyed your company. Your inputs with TALENS designing really helped me.
72
Thanks for your help with genotyping. I would also like to acknowledge the past and current members of the zebrafish group.
Building 6M, 2nd floor, I spent more time here than home. The people around made it a wonderful place. I had great times with my fellow PhD students and also other people in the department. I am privileged to get to know about Xingru, Zahra, Lee-Ann, Manuela, Maria N, Ela, Erik B, Erik D, Isil, Elin, Denise, Björn, Kestin, Johan B, Vicky, Sandhya, Mahmood, Anika, Mona, Helena, Max, Saba, Greg, Rob, Parviz and many more. The trips to Horse-back riding and high rope challenge and beer-corners were unforgettable.
I would like to thank Celia, Maria, Ela and Anika for making their presence during my wedding and the lovely time we spent in India. I always cherish those moments.
Chaitu, you are always a good friend of mine. We cherished our best moments during our masters in India. We dreamt together to pursue higher studies abroad. We worked really hard for it. I wouldn’t be here in Umea if you are not here. I lost hope in the journey, but you always encouraged me. Your support and affection towards me are unconditional. I always admire you for your determination. Thank you for everything. All the very best for your future.
My Indian friends in Umea, it is a big list. They made my stint in Umea a memorable one. Cricket, cooking food, movies, photoshoots, conversations, volleyball, badminton.. so many. I never felt bored. The trips to Narvik and Stockholm cruise brought lifetime memories. These moments I can cherish throughout my life. I made many lifetime friends on this journey. I would like to thank Harsha, Jani, Raghu, Edward, Sampath, Gaurav, Mahesh, Kamraj, Vishnu, Saravana, Ganesh, Vivek, Sridhar, Mahesh N, Srinivas Oruganti, Mohan, Edvin, Yugnadhar, Sharat, Krishna, Anil, Mridula, Hareesha, Lalitha, Jonitta, Lokesh, Praneeth, Faizal, Bharat and my recent Indian friends Raviteja, Maruthi, Bala, Vijay, Prasad and Raghav. Faizal and Bharat (raja’s) we still have to go for long Euro road trip on open-top mini cooper as we planned. You both are such sweet friends and companions to cherish the moments for life.
Venky, Bindu and Eeshu, you people are really close to us. We had wonderful times together along with our families. Venky (Guruvu garu), you are always like a mentor giving expert advice in crucial situations. Hoping for beautiful times together in future in India. I also like to thank Vijay & Kamala, Munender & Sharvani and Chandra Kiran & Kalyani for their support and parenting tips to make life easy. Also I would like to thank Raghav and Yashasvini for lively conservations and dinners together. I also want to acknowledge Anubhav forhis well wishes and constant support and of course tasty dinners are unforgettable.
I was always inspired by people and nature around me. I was greatly influenced by my teachers, who helped in guiding me towards biological sciences. I would like to acknowledge and thank my natural science teacher Suchala Devi madam and Zoology teacher Vishnu sir who greatly influenced me to pursue my carrier in science.
73
My friends are my significant assets who always inspired me and always prompted me to concentrate on my goals. I would like to thank my school friends DV, Rama Krishna, Rajesh, Soma Sekhar and many. I always cherished great moments with my friends Anil, Vikram, Praveen, Manikanth, Santhosh, Sai, Reddy, Naveen Raj Kumar and Gopi baaa. A special mention about a wonderful person Umapathi Anna, who always took good care of me and supported in every part of my dreams for pursuing PhD. Never got bored when Harsha RV,Venu Gopal, Srinivas and Kiran around me. Full of fun and adventure. Harsha, we shall finish what we are dreaming now, the target is getting close. Rohita, Santhi, Deepthi, Maitu, Sahithi and Suma I always remember the good times we spent. I also want to remember my juniors during my masters Anil, Kuttu, Deepika, Yugandhar, Amulya, Mitra, Deepthi and many more for our constant talk about research and fun
I am deeply and emotionally connected to my best buddies Deviram, Sushma, Vishnu Priya and Chiranjeevi. You guys always there with me every part of my life. Your encouragements and love towards me were still inspiring. Thank you for being in my life.
I would also like to thank my in-laws for their constant support and encouragement. Shivani, you will reach great heights, I always like the way you think. Thanks for your endless love and affection.
My family has more confidence in me than I have on myself. They always believed in me. Daddy and Mommy, I dedicate this thesis to you. It wouldn’t have been possible without your constant support. You made my dreams come true. Whatever I achieved or will achieve is because of you. You sacrificed all through your life to fulfil our dreams. I will always work hard to make you proud. Thank you for everything. My brother Sanjay is a significant asset for me. We went through life events together. You have always supported me and also believed in me. I will always be there for you. All the best for your PhD studies.
My two strands of DNA, the amazing twins, Raaganjali and Aaryan. My life took an unimaginable turn by their birth. They are my stress busters. Such cute and beautiful twins. I love you guys. I will always try to make you proud.
Finally, everything comes to life partner. It is always sweet when someone is always next to you to give a little push for the next level. Gowthami, you are such a lovely and admirable person. You added that tinge of spice to my life. I am bad in expressing my feeling directly to you, but all these years, your presence made my life more lively and happy. During my PhD studies, you tolerated me so much. We had good and bad days, but we survived together with more love and affection. Your support and belief in me inspired to go further. The way you handle the situations with kids during my busy times is incredible. You are a wonderful mother and best wife. Thanks for coming into my life and making it colourful.
74
References
1. J. P. Greenstein, in Biochemistry of Cancer, J. P. Greenstein, Ed. (Academic Press, 1947), pp. v.
2. R. Kalluri, R. A. Weinberg, The basics of epithelial-mesenchymal transition. The Journal of Clinical Investigation 119, 1420-1428 (2009).
3. S. I. Grivennikov, F. R. Greten, M. Karin, Immunity, Inflammation, and Cancer. Cell 140, 883-899 (2010).
4. B. Vogelstein et al., Cancer Genome Landscapes. Science 339, 1546 (2013).
5. D. Hanahan, Robert A. Weinberg, Hallmarks of Cancer: The Next Generation. Cell 144, 646-674 (2011).
6. F. Bray et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA: A Cancer Journal for Clinicians 68, 394-424 (2018).
7. C. K. Zhou et al., Prostate cancer incidence in 43 populations worldwide: An analysis of time trends overall and by age group. International Journal of Cancer 138, 1388-1400 (2016).
8. S.-L. Chen et al., Prostate Cancer Mortality-To-Incidence Ratios Are Associated with Cancer Care Disparities in 35 Countries. Scientific Reports 7, 40003 (2017).
9. M. Frydenberg, S. Wijesinha, Diagnosing prostate cancer - what GPs need to know. Australian family physician 36, 345-347 (2007).
10. W. Hamilton, D. Sharp, Symptomatic diagnosis of prostate cancer in primary care: a structured review. Br J Gen Pract 54, 617-621 (2004).
11. P. Rawla, Epidemiology of Prostate Cancer. World J Oncol 10, 63-89 (2019).
12. J. H. Hayes, M. J. Barry, Screening for Prostate Cancer With the Prostate-Specific Antigen Test: A Review of Current Evidence. JAMA 311, 1143-1149 (2014).
13. G. Attard et al., Prostate cancer. The Lancet 387, 70-82 (2016). 14. C. H. Pernar, E. M. Ebot, K. M. Wilson, L. A. Mucci, The
Epidemiology of Prostate Cancer. Cold Spring Harbor Perspectives in Medicine 8, (2018).
15. M. N. Bashir, Epidemiology of Prostate Cancer. Asian Pac J Cancer Prev 16, 5137-5141 (2015).
16. M. N. Okobia, J. M. Zmuda, R. E. Ferrell, A. L. Patrick, C. H. Bunker, Chromosome 8q24 variants are associated with prostate cancer risk in a
75
high risk population of African ancestry. The Prostate 71, 1054-1063 (2011).
17. D. Hatcher, G. Daniels, I. Osman, P. Lee, Molecular mechanisms involving prostate cancer racial disparity. American journal of translational research 1, 235-248 (2009).
18. C. M. Ewing et al., Germline Mutations in HOXB13 and Prostate-Cancer Risk. New England Journal of Medicine 366, 141-149 (2012).
19. H. Chen et al., <em>RNASEL</em> mutations in hereditary prostate cancer. Journal of Medical Genetics 40, e21 (2003).
20. N. Ahmadiyeh et al., 8q24 prostate, breast, and colon cancer risk loci show tissue-specific long-range interaction with <em>MYC</em>. Proceedings of the National Academy of Sciences 107, 9742 (2010).
21. H. T. Kissick et al., The transcription factor ERG increases expression of neurotransmitter receptors on prostate cancer cells. BMC cancer 15, 604 (2015).
22. D. Noda et al., ELAC2, a putative prostate cancer susceptibility gene product, potentiates TGF-β/Smad-induced growth arrest of prostate cells. Oncogene 25, 5591-5600 (2006).
23. S. M. Harman, E. J. Metter, M. R. Blackman, P. K. Landis, H. B. Carter, Serum levels of insulin-like growth factor I (IGF-I), IGF-II, IGF-binding protein-3, and prostate-specific antigen as predictors of clinical prostate cancer. Journal of Clinical Endocrinology and Metabolism 85, 4258-4265 (2000).
24. T. Visakorpi et al., In vivo amplification of the androgen receptor gene and progression of human prostate cancer. Nature Genetics 9, 401-406 (1995).
25. S. Rohrmann et al., Meat and dairy consumption and subsequent risk of prostate cancer in a US cohort study. Cancer causes & control : CCC 18, 41-50 (2007).
26. W. Cazzaniga et al., Population-based, nationwide registration of prostatectomies in Sweden. Journal of Surgical Oncology 120, 803-812 (2019).
27. A. Znaor, J. Lortet-Tieulent, M. Laversanne, A. Jemal, F. Bray, International Variations and Trends in Renal Cell Carcinoma Incidence and Mortality. European Urology 67, 519-530 (2015).
76
28. M. Medina-Rico, H. L. Ramos, M. Lobo, J. Romo, J. G. Prada, Epidemiology of renal cancer in developing countries: Review of the literature. Can Urol Assoc J 12, E154-E162 (2018).
29. G. Scelo, T. L. Larose, Epidemiology and Risk Factors for Kidney Cancer. Journal of Clinical Oncology 36, 3574-3581 (2018).
30. W.-H. Chow, L. M. Dong, S. S. Devesa, Epidemiology and risk factors for kidney cancer. Nat Rev Urol 7, 245-257 (2010).
31. B. Ljungberg et al., Renal Cell Carcinoma Guideline. European Urology 51, 1502-1510 (2007).
32. P. Cairns, Renal cell carcinoma. Cancer biomarkers 9, 461-473 (2011). 33. E. C. Nelson, C. P. Evans, P. N. Lara, Renal cell carcinoma: Current
status and emerging therapies. Cancer Treatment Reviews 33, 299-313 (2007).
34. W. Y. Kim, W. G. Kaelin, Role of VHL Gene Mutation in Human Cancer. Journal of Clinical Oncology 22, 4991-5004 (2004).
35. N. R. Zambrano, I. A. Lubensky, M. J. Merino, W. M. Linehan, M. M. Walther, HISTOPATHOLOGY AND MOLECULAR GENETICS OF RENAL TUMORS: TOWARD UNIFICATION OF A CLASSIFICATION SYSTEM. The Journal of Urology 162, 1246-1258 (1999).
36. G. Kovacs, Molecular genetics of human renal cell tumours. Nephrology Dialysis Transplantation 11, 62-65 (1996).
37. H. T. Cohen, F. J. McGovern, Renal-Cell Carcinoma. New England Journal of Medicine 353, 2477-2490 (2005).
38. B. I. Rini, S. C. Campbell, B. Escudier, Renal cell carcinoma. The Lancet 373, 1119-1132 (2009).
39. H. Contractor, M. Zariwala, P. Bugert, J. Zeisler, G. Kovaks, Mutation of the p53 tumour suppressor gene occurs preferentially in the chromophobe type of renal cell tumour. The Journal of Pathology: A Journal of the Pathological Society of Great Britain and Ireland 181, 136-139 (1997).
40. M. L. Nickerson et al., Mutations in a novel gene lead to kidney tumors, lung wall defects, and benign tumors of the hair follicle in patients with the Birt-Hogg-Dube syndrome. Cancer cell 2, 157-164 (2002).
41. J. R. Toro et al., Birt-Hogg-Dube syndrome: a novel marker of kidney neoplasia. Archives of dermatology 135, 1195-1202 (1999).
42. B. Escudier et al., Sorafenib in advanced clear-cell renal-cell carcinoma. The New England journal of medicine 356, 125-134 (2007).
77
43. J. C. Yang et al., Randomized study of high-dose and low-dose inter leukin-2 in patients with metastatic renal cancer. Journal of clinical oncology: official journal of the American Society of Clinical Oncology 21, 3127 (2003).
44. K. M. Cadigan, R. Nusse, Wnt signaling: a common theme in animal development. Genes & Development 11, 3286-3305 (1997).
45. H. Clevers, Wnt/β-Catenin Signaling in Development and Disease. Cell 127, 469-480 (2006).
46. J. C. Sullivan, J. F. Ryan, J. C. Mullikin, J. R. Finnerty, Conserved and novel Wnt clusters in the basal eumetazoan Nematostella vectensis. Development Genes and Evolution 217, 235-239 (2007).
47. T. W. Holstein, The Evolution of the Wnt Pathway. Cold Spring Harbor Perspectives in Biology 4, (2012).
48. K. Pang et al., Genomic insights into Wnt signaling in an early diverging metazoan, the ctenophore Mnemiopsis leidyi. EvoDevo 1, 10 (2010).
49. K. M. Loh, R. van Amerongen, R. Nusse, Generating Cellular Diversity and Spatial Form: Wnt Signaling and the Evolution of Multicellular Animals. Developmental cell 38, 643-655 (2016).
50. R. Nusse, H. E. Varmus, Many tumors induced by the mouse mammary tumor virus contain a provirus integrated in the same region of the host genome. Cell 31, 99-109 (1982).
51. C. Nüsslein-Volhard, E, 1980. Mutations affecting segment number and polarity in Drosophila. Nature 287, 795801.
52. H. F. Farin et al., Visualization of a short-range Wnt gradient in the intestinal stem-cell niche. Nature 530, 340 (2016).
53. R. Nusse, Wnt signaling. Cold Spring Harb Perspect Biol 4, (2012). 54. R. Nusse, Wnt signaling in disease and in development. Cell Research
15, 28-32 (2005). 55. T. Kadowaki, E. Wilder, J. Klingensmith, K. Zachary, N. Perrimon, The
segment polarity gene porcupine encodes a putative multitransmembrane protein involved in Wingless processing. Genes & Development 10, 3116-3128 (1996).
56. K. Willert et al., Wnt proteins are lipid-modified and can act as stem cell growth factors. Nature 423, 448-452 (2003).
57. K. Bartscherer, N. Pelte, D. Ingelfinger, M. Boutros, Secretion of Wnt ligands requires Evi, a conserved transmembrane protein. Cell 125, 523-533 (2006).
78
58. R. van Amerongen, A. Mikels, R. Nusse, Alternative Wnt Signaling Is Initiated by Distinct Receptors. Science Signaling 1, re9-re9 (2008).
59. B. T. MacDonald, X. He, Frizzled and LRP5/6 receptors for Wnt/β-catenin signaling. Cold Spring Harbor perspectives in biology 4, a007880 (2012).
60. X. He, M. Semenov, K. Tamai, X. Zeng, LDL receptor-related proteins 5 and 6 in Wnt/beta-catenin signaling: arrows point the way. Development (Cambridge, England) 131, 1663-1677 (2004).
61. O. Tacchelly-Benites et al., Axin phosphorylation in both Wnt-off and Wnt-on states requires the tumor suppressor APC. PLOS Genetics 14, e1007178 (2018).
62. S. Angers, R. T. Moon, Proximal events in Wnt signal transduction. Nat Rev Mol Cell Biol 10, 468-477 (2009).
63. B. T. MacDonald, K. Tamai, X. He, Wnt/beta-catenin signaling: components, mechanisms, and diseases. Developmental cell 17, 9-26 (2009).
64. M. Gammons, M. Bienz, Multiprotein complexes governing Wnt signal transduction. Current Opinion in Cell Biology 51, 42-49 (2018).
65. C. Niehrs, S. P. Acebron, Wnt Signaling: Multivesicular Bodies Hold GSK3 Captive. Cell 143, 1044-1046 (2010).
66. J. Li et al., LATS2 suppresses oncogenic Wnt signaling by disrupting β-catenin/BCL9 interaction. Cell reports 5, 1650-1663 (2013).
67. W.-H. Lien, E. Fuchs, Wnt some lose some: transcriptional governance of stem cells by Wnt/β-catenin signaling. Genes & development 28, 1517-1532 (2014).
68. R. Nusse, Disarming Wnt. Nature 519, 163 (2015). 69. P. Bovolenta, P. Esteve, J. M. Ruiz, E. Cisneros, J. Lopez-Rios, Beyond
Wnt inhibition: new functions of secreted Frizzled-related proteins in development and disease. Journal of Cell Science 121, 737 (2008).
70. R. C. L. Ng et al., Dysregulation of Wnt inhibitory factor 1 (Wif1) expression resulted in aberrant Wnt-β-catenin signaling and cell death of the cloaca endoderm, and anorectal malformations. Cell Death & Differentiation 21, 978-989 (2014).
71. T. Zhan, N. Rindtorff, M. Boutros, Wnt signaling in cancer. Oncogene 36, 1461-1473 (2017).
72. B. Mao, C. Niehrs, Kremen2 modulates Dickkopf2 activity during Wnt/lRP6 signaling. Gene 302, 179-183 (2003).
79
73. K. K. Kumar, A. W. Burgess, J. M. Gulbis, Structure and function of LGR5: an enigmatic G-protein coupled receptor marking stem cells. Protein Sci 23, 551-565 (2014).
74. M. Zebisch et al., Structural and molecular basis of ZNRF3/RNF43 transmembrane ubiquitin ligase inhibition by the Wnt agonist R-spondin. Nature Communications 4, 2787 (2013).
75. W. de Lau, W. C. Peng, P. Gros, H. Clevers, The R-spondin/Lgr5/Rnf43 module: regulator of Wnt signal strength. Genes & Development 28, 305-316 (2014).
76. Q. Xu et al., Vascular Development in the Retina and Inner Ear: Control by Norrin and Frizzled-4, a High-Affinity Ligand-Receptor Pair. Cell 116, 883-895 (2004).
77. G. Shen et al., Structural basis of the Norrin-Frizzled 4 interaction. Cell Research 25, 1078-1081 (2015).
78. J. Harb, P.-J. Lin, J. Hao, Recent Development of Wnt Signaling Pathway Inhibitors for Cancer Therapeutics. Current Oncology Reports 21, 12 (2019).
79. J. A. Zallen, Planar polarity and tissue morphogenesis. Cell 129, 1051-1063 (2007).
80. Y. Komiya, R. Habas, Wnt signal transduction pathways. Organogenesis 4, 68-75 (2008).
81. M. T. Veeman, J. D. Axelrod, R. T. Moon, A second canon. Functions and mechanisms of beta-catenin-independent Wnt signaling. Developmental cell 5, 367-377 (2003).
82. F. Pez et al., Wnt signaling and hepatocarcinogenesis: Molecular targets for the development of innovative anticancer drugs. Journal of Hepatology 59, 1107-1117 (2013).
83. A. De, Wnt/Ca2+ signaling pathway: a brief overview. Acta Biochimica et Biophysica Sinica 43, 745-756 (2011).
84. P. G. Hogan, L. Chen, J. Nardone, A. Rao, Transcriptional regulation by calcium, calcineurin, and NFAT. Genes & development 17, 2205-2232 (2003).
85. C. P. Petersen, P. W. Reddien, Wnt Signaling and the Polarity of the Primary Body Axis. Cell 139, 1056-1068 (2009).
86. H. Clevers, Wnt/beta-catenin signaling in development and disease. Cell 127, 469-480 (2006).
87. K. Itoh, S. Y. Sokol, Axis determination by inhibition of Wnt signaling in Xenopus. Genes & development 13, 2328-2336 (1999).
80
88. O. A. Mohamed, H. J. Clarke, D. Dufort, β-catenin signaling marks the prospective site of primitive streak formation in the mouse embryo. Developmental Dynamics 231, 416-424 (2004).
89. H. Verkade, J. K. Heath, in Wnt Signaling, E. Vincan, Ed. (Humana Press, Totowa, NJ, 2009), pp. 225-251.
90. H. Hikasa, S. Y. Sokol, Wnt signaling in vertebrate axis specification. Cold Spring Harbor perspectives in biology 5, a007955-a007955 (2013).
91. A. Schohl, F. Fagotto, Beta-catenin, MAPK and Smad signaling during early Xenopus development. Development 129, 37-52 (2002).
92. N. Itasaki, S. Hoppler, Crosstalk between Wnt and bone morphogenic protein signaling: a turbulent relationship. Dev Dyn 239, 16-33 (2010).
93. T. Grocott, S. Johnson, A. P. Bailey, A. Streit, Neural crest cells organize the eye via TGF-β and canonical Wnt signalling. Nature Communications 2, 265 (2011).
94. V. Munnamalai et al., Wnt9a Can Influence Cell Fates and Neural Connectivity across the Radial Axis of the Developing Cochlea. The Journal of neuroscience : the official journal of the Society for Neuroscience 37, 8975-8988 (2017).
95. F. Girardi, F. Le Grand, in Progress in Molecular Biology and Translational Science, J. Larraín, G. Olivares, Eds. (Academic Press, 2018), vol. 153, pp. 157-179.
96. A. C. Lekven, G. R. Buckles, N. Kostakis, R. T. Moon, Wnt1 and wnt10b function redundantly at the zebrafish midbrain–hindbrain boundary. Developmental Biology 254, 172-187 (2003).
97. A. Yin, S. Korzh, C. L. Winata, V. Korzh, Z. Gong, Wnt signaling is required for early development of zebrafish swimbladder. PloS one 6, e18431-e18431 (2011).
98. A. Agathon, C. Thisse, B. Thisse, The molecular nature of the zebrafish tail organizer. Nature 424, 448-452 (2003).
99. Z. Steinhart, S. Angers, Wnt signaling in development and tissue homeostasis. Development 145, dev146589 (2018).
100. A. Haegebarth, H. Clevers, Wnt Signaling, Lgr5, and Stem Cells in the Intestine and Skin. The American Journal of Pathology 174, 715-721 (2009).
101. H. Clevers, K. M. Loh, R. Nusse, An integral program for tissue renewal and regeneration: Wnt signaling and stem cell control. science 346, 1248012 (2014).
81
102. T. Fevr, S. Robine, D. Louvard, J. Huelsken, Wnt/β-catenin is essential for intestinal homeostasis and maintenance of intestinal stem cells. Molecular and cellular biology 27, 7551-7559 (2007).
103. T. F. Day, X. Guo, L. Garrett-Beal, Y. Yang, Wnt/β-catenin signaling in mesenchymal progenitors controls osteoblast and chondrocyte differentiation during vertebrate skeletogenesis. Developmental cell 8, 739-750 (2005).
104. M. E. Brunkow et al., Bone dysplasia sclerosteosis results from loss of the SOST gene product, a novel cystine knot–containing protein. The American Journal of Human Genetics 68, 577-589 (2001).
105. R. D. Little et al., A mutation in the LDL receptor–related protein 5 gene results in the autosomal dominant high–bone-mass trait. The American Journal of Human Genetics 70, 11-19 (2002).
106. M. Christie et al., Different APC genotypes in proximal and distal sporadic colorectal cancers suggest distinct WNT/β-catenin signalling thresholds for tumourigenesis. Oncogene 32, 4675 (2013).
107. H. van Andel, K. A. Kocemba, M. Spaargaren, S. T. Pals, Aberrant Wnt signaling in multiple myeloma: molecular mechanisms and targeting options. Leukemia 33, 1063-1075 (2019).
108. P. Laurent-Puig, P. Legoix, Bluteau 0, Belghiti J, Franco D, Binot F, Monges G, Thomas G, Bioulac-Sage P, Zucman-Rossi J. Genetic alterations associated with hepatocellular carcinomas define distinct pathways of hepatocarcinogenesis. Gastroenterology 120, 1763-1773 (2001).
109. E. Kim et al., Promotion of growth factor signaling as a critical function of β-catenin during HCC progression. Nature Communications 10, 1909 (2019).
110. D. R. Schwartz et al., Novel Candidate Targets of β-Catenin/T-cell Factor Signaling Identified by Gene Expression Profiling of Ovarian Endometrioid Adenocarcinomas. Cancer Research 63, 2913-2922 (2003).
111. D. Robinson et al., Integrative clinical genomics of advanced prostate cancer. Cell 161, 1215-1228 (2015).
112. A. V. Gerstein et al., APC/CTNNB1 (β-catenin) pathway alterations in human prostate cancers. Genes, Chromosomes and Cancer 34, 9-16 (2002).
82
113. M. Linch et al., Intratumoural evolutionary landscape of high-risk prostate cancer: the PROGENY study of genomic and immune parameters. Ann Oncol 28, 2472-2480 (2017).
114. C. Jerónimo et al., Epigenetics in prostate cancer: biologic and clinical relevance. European urology 60, 753-766 (2011).
115. R. M. Kypta, J. Waxman, Wnt/beta-catenin signalling in prostate cancer. Nat Rev Urol 9, 418-428 (2012).
116. S. Y. Lee et al., Wnt/Snail signaling regulates cytochrome C oxidase and glucose metabolism. Cancer research 72, 3607-3617 (2012).
117. V. Sherwood, WNT Signaling: an Emerging Mediator of Cancer Cell Metabolism? Molecular and Cellular Biology 35, 2 (2015).
118. C. V. Dang, A. Le, P. Gao, MYC-Induced Cancer Cell Energy Metabolism and Therapeutic Opportunities. Clinical Cancer Research 15, 6479 (2009).
119. C. H. Heldin, K. Miyazono, P. ten Dijke, TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390, 465-471 (1997).
120. J. Massague, S. W. Blain, R. S. Lo, TGFbeta signaling in growth control, cancer, and heritable disorders. Cell 103, 295-309 (2000).
121. Y. Katsuno, S. Lamouille, R. Derynck, TGF-β signaling and epithelial–mesenchymal transition in cancer progression. Current Opinion in Oncology 25, 76-84 (2013).
122. J. E. de Larco, G. J. Todaro, Growth factors from murine sarcoma virus-transformed cells. Proc Natl Acad Sci U S A 75, 4001-4005 (1978).
123. K. Miyazono, TGF-β signaling by Smad proteins. Cytokine & Growth Factor Reviews 11, 15-22 (2000).
124. D. B. Rifkin, Latent Transforming Growth Factor-β (TGF-β) Binding Proteins: Orchestrators of TGF-β Availability. Journal of Biological Chemistry 280, 7409-7412 (2005).
125. Q. Yu, I. Stamenkovic, Cell surface-localized matrix metalloproteinase-9 proteolytically activates TGF-beta and promotes tumor invasion and angiogenesis. Genes Dev 14, 163-176 (2000).
126. J. E. Murphy-Ullrich, M. Poczatek, Activation of latent TGF-β by thrombospondin-1: mechanisms and physiology. Cytokine & Growth Factor Reviews 11, 59-69 (2000).
83
127. R. Janknecht, N. J. Wells, T. Hunter, TGF-β-stimulated cooperation of Smad proteins with the coactivators CBP/p300. Genes & development 12, 2114-2119 (1998).
128. Y. Mu, S. K. Gudey, M. Landström, Non-Smad signaling pathways. Cell and tissue research 347, 11-20 (2012).
129. C. H. Heldin, A. Moustakas, Role of Smads in TGFbeta signaling. Cell and tissue research 347, 21-36 (2012).
130. Y. Shi, J. Massague, Mechanisms of TGF-beta signaling from cell membrane to the nucleus. Cell 113, 685-700 (2003).
131. Y. Shi et al., Crystal structure of a Smad MH1 domain bound to DNA: insights on DNA binding in TGF-beta signaling. Cell 94, 585-594 (1998).
132. D. Peng, L. Fu, G. Sun, Expression analysis of the TGF-β/SMAD target genes in adenocarcinoma of esophagogastric junction. Open Med (Wars) 11, 83-86 (2016).
133. P. Papageorgis, TGFbeta Signaling in Tumor Initiation, Epithelial-to-Mesenchymal Transition, and Metastasis. Journal of oncology 2015, 587193 (2015).
134. J. Yang et al., Twist, a master regulator of morphogenesis, plays an essential role in tumor metastasis. Cell 117, 927-939 (2004).
135. X. H. Feng, X. Lin, R. Derynck, Smad2, Smad3 and Smad4 cooperate with Sp1 to induce p15(Ink4B) transcription in response to TGF-beta. The EMBO journal 19, 5178-5193 (2000).
136. T. Lopez-Rovira, E. Chalaux, J. L. Rosa, R. Bartrons, F. Ventura, Interaction and functional cooperation of NF-kappa B with Smads. Transcriptional regulation of the junB promoter. The Journal of biological chemistry 275, 28937-28946 (2000).
137. N. G. Iyer, H. Özdag, C. Caldas, p300/CBP and cancer. Oncogene 23, 4225-4231 (2004).
138. M. K. Lee et al., TGF-beta activates Erk MAP kinase signalling through direct phosphorylation of ShcA. The EMBO journal 26, 3957-3967 (2007).
139. B. Ozdamar et al., Regulation of the polarity protein Par6 by TGFbeta receptors controls epithelial cell plasticity. Science 307, 1603-1609 (2005).
140. Y. Mu, G. Zang, U. Engström, C. Busch, M. Landström, TGFβ-induced phosphorylation of Par6 promotes migration and invasion in prostate cancer cells. British Journal Of Cancer 112, 1223 (2015).
84
141. L. Zhang, F. Zhou, P. ten Dijke, Signaling interplay between transforming growth factor-β receptor and PI3K/AKT pathways in cancer. Trends in Biochemical Sciences 38, 612-620 (2013).
142. D. Morgensztern, H. L. McLeod, PI3K/Akt/mTOR pathway as a target for cancer therapy. Anti-Cancer Drugs 16, 797-803 (2005).
143. J. Song, M. Landström, TGFβ activates PI3K-AKT signaling via TRAF6. Oncotarget 8, 99205-99206 (2017).
144. A. Sorrentino et al., The type I TGF-beta receptor engages TRAF6 to activate TAK1 in a receptor kinase-independent manner. Nature cell biology 10, 1199-1207 (2008).
145. M. Landström, The TAK1–TRAF6 signalling pathway. The International Journal of Biochemistry & Cell Biology 42, 585-589 (2010).
146. N. Thakur, A. Sorrentino, C. H. Heldin, M. Landstrom, TGF-beta uses the E3-ligase TRAF6 to turn on the kinase TAK1 to kill prostate cancer cells. Future oncology (London, England) 5, 1-3 (2009).
147. Y. Mu et al., TRAF6 ubiquitinates TGFbeta type I receptor to promote its cleavage and nuclear translocation in cancer. Nat Commun 2, 330 (2011).
148. S. K. Gudey et al., TRAF6 stimulates the tumor-promoting effects of TGFbeta type I receptor through polyubiquitination and activation of presenilin 1. Sci Signal 7, ra2 (2014).
149. M. Ohgushi et al., Transforming growth factor beta-dependent sequential activation of Smad, Bim, and caspase-9 mediates physiological apoptosis in gastric epithelial cells. Mol Cell Biol 25, 10017-10028 (2005).
150. K. A. McAllister et al., Endoglin, a TGF-β binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1. Nature Genetics 8, 345-351 (1994).
151. T. Chen et al., Transforming growth factor-beta receptor type I gene is frequently mutated in ovarian carcinomas. Cancer Res 61, 4679-4682 (2001).
152. L. Levy, C. S. Hill, Alterations in components of the TGF-beta superfamily signaling pathways in human cancer. Cytokine Growth Factor Rev 17, 41-58 (2006).
153. S. Markowitz et al., Inactivation of the type II TGF-beta receptor in colon cancer cells with microsatellite instability. Science 268, 1336-1338 (1995).
85
154. H. LI, J.-P. LIU, Mechanisms of Action of TGF-β in Cancer. Annals of the New York Academy of Sciences 1114, 56-68 (2007).
155. C. O. Gigek et al., hTERT methylation and expression in gastric cancer. Biomarkers 14, 630-636 (2009).
156. R. Janknecht, On the road to immortality: hTERT upregulation in cancer cells. FEBS Letters 564, 9-13 (2004).
157. C. Sandhu et al., Transforming growth factor beta stabilizes p15INK4B protein, increases p15INK4B-cdk4 complexes, and inhibits cyclin D1-cdk4 association in human mammary epithelial cells. Mol Cell Biol 17, 2458-2467 (1997).
158. G. F. Claassen, S. R. Hann, A role for transcriptional repression of p21CIP1 by c-Myc in overcoming transforming growth factor beta -induced cell-cycle arrest. Proc Natl Acad Sci U S A 97, 9498-9503 (2000).
159. A. Calon et al., Dependency of colorectal cancer on a TGF-beta-driven program in stromal cells for metastasis initiation. Cancer Cell 22, 571-584 (2012).
160. H. Tsushima et al., High levels of transforming growth factor beta 1 in patients with colorectal cancer: association with disease progression. Gastroenterology 110, 375-382 (1996).
161. T. Kokudo et al., Snail is required for TGFbeta-induced endothelial-mesenchymal transition of embryonic stem cell-derived endothelial cells. J Cell Sci 121, 3317-3324 (2008).
162. R. Y. Liu et al., JAK/STAT3 signaling is required for TGF-beta-induced epithelial-mesenchymal transition in lung cancer cells. International journal of oncology 44, 1643-1651 (2014).
163. F. Yang, D. W. Strand, D. R. Rowley, Fibroblast growth factor-2 mediates transforming growth factor-beta action in prostate cancer reactive stroma. Oncogene 27, 450-459 (2008).
164. D. Padua et al., TGFbeta primes breast tumors for lung metastasis seeding through angiopoietin-like 4. Cell 133, 66-77 (2008).
165. D. Donovan et al., TGF beta-1 regulation of VEGF production by breast cancer cells. Annals of surgical oncology 4, 621-627 (1997).
166. A. Igarashi, H. Okochi, D. M. Bradham, G. R. Grotendorst, Regulation of connective tissue growth factor gene expression in human skin fibroblasts and during wound repair. Molecular biology of the cell 4, 637-645 (1993).
86
167. J. Lopez-Barneo, R. Pardal, P. Ortega-Saenz, Cellular mechanism of oxygen sensing. Annual review of physiology 63, 259-287 (2001).
168. K. Stamati, V. Mudera, U. Cheema, Evolution of oxygen utilization in multicellular organisms and implications for cell signalling in tissue engineering. J Tissue Eng 2, 2041731411432365-2041731411432365 (2011).
169. M. A. Bellio et al., Physiological and hypoxic oxygen concentration differentially regulates human c-Kit+ cardiac stem cell proliferation and migration. Am J Physiol Heart Circ Physiol 311, H1509-H1519 (2016).
170. M. C. Brahimi-Horn, J. Chiche, J. Pouyssegur, Hypoxia signalling controls metabolic demand. Current opinion in cell biology 19, 223-229 (2007).
171. M. C. Brahimi-Horn, J. Pouysségur, Oxygen, a source of life and stress. FEBS letters 581, 3582-3591 (2007).
172. S. H. Kao, K. J. Wu, W. H. Lee, Hypoxia, Epithelial-Mesenchymal Transition, and TET-Mediated Epigenetic Changes. J Clin Med 5, (2016).
173. S. L. Dunwoodie, The Role of Hypoxia in Development of the Mammalian Embryo. Developmental cell 17, 755-773 (2009).
174. José López-Barneo, a. Ricardo Pardal, P. Ortega-Sáenz, Cellular Mechanism of Oxygen Sensing. Annual review of physiology 63, 259-287 (2001).
175. C. W. Pugh, P. J. Ratcliffe, Regulation of angiogenesis by hypoxia: role of the HIF system. Nat Med 9, 677-684 (2003).
176. P. Carmeliet, VEGF as a Key Mediator of Angiogenesis in Cancer. Oncology 69(suppl 3), 4-10 (2005).
177. N. Nishida, H. Yano, T. Nishida, T. Kamura, M. Kojiro, Angiogenesis in cancer. Vasc Health Risk Manag 2, 213-219 (2006).
178. A. Loboda, A. Jozkowicz, J. Dulak, HIF-1 and HIF-2 transcription factors—similar but not identical. Molecules and cells 29, 435-442 (2010).
179. J. Adams et al., HIF-1: a key mediator in hypoxia. Acta Physiologica Hungarica 96, 19-28 (2009).
180. K. L. Talks et al., The expression and distribution of the hypoxia-inducible factors HIF-1alpha and HIF-2alpha in normal human tissues, cancers, and tumor-associated macrophages. The American journal of pathology 157, 411-421 (2000).
87
181. S. L. Yang, C. Wu, Z. F. Xiong, X. Fang, Progress on hypoxia-inducible factor-3: its structure, gene regulation and biological function. Molecular medicine reports 12, 2411-2416 (2015).
182. M. A. Maynard et al., Multiple splice variants of the human HIF-3 alpha locus are targets of the von Hippel-Lindau E3 ubiquitin ligase complex. The Journal of biological chemistry 278, 11032-11040 (2003).
183. H. Ando et al., A hypoxia-inducible factor (HIF)-3α splicing variant, HIF-3α4 impairs angiogenesis in hypervascular malignant meningiomas with epigenetically silenced HIF-3α4. Biochem Biophys Res Commun 433, 139-144 (2013).
184. S. Hara, J. Hamada, C. Kobayashi, Y. Kondo, N. Imura, Expression and characterization of hypoxia-inducible factor (HIF)-3alpha in human kidney: suppression of HIF-mediated gene expression by HIF-3alpha. Biochemical and biophysical research communications 287, 808-813 (2001).
185. Q. F. Li, X. R. Wang, Y. W. Yang, H. Lin, Hypoxia upregulates hypoxia inducible factor (HIF)-3alpha expression in lung epithelial cells: characterization and comparison with HIF-1alpha. Cell Res 16, 548-558 (2006).
186. L. Gossage, T. Eisen, E. R. Maher, VHL, the story of a tumour suppressor gene. Nature Reviews Cancer 15, 55 (2015).
187. W. G. Kaelin Jr, Von hippel-lindau disease. Annu. Rev. Pathol. Mech. Dis. 2, 145-173 (2007).
188. J. Schoedel et al., Hypoxia, hypoxia-inducible transcription factors, and renal cancer. European urology 69, 646-657 (2016).
189. O. Iliopoulos, M. Ohh, W. G. Kaelin, Jr., pVHL19 is a biologically active product of the von Hippel-Lindau gene arising from internal translation initiation. Proc Natl Acad Sci U S A 95, 11661-11666 (1998).
190. M. Ohh et al., The von Hippel-Lindau tumor suppressor protein is required for proper assembly of an extracellular fibronectin matrix. Molecular cell 1, 959-968 (1998).
191. R. K. Bruick, S. L. McKnight, A conserved family of prolyl-4-hydroxylases that modify HIF. Science 294, 1337-1340 (2001).
192. P. Jaakkola et al., Targeting of HIF-α to the von Hippel-Lindau ubiquitylation complex by O2-regulated prolyl hydroxylation. Science 292, 468-472 (2001).
88
193. P. Maxwell, M. Wiesener, G. Chang, al, e., 1999. The tumor suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271-285.
194. S. J. Freedman et al., Structural basis for recruitment of CBP/p300 by hypoxia-inducible factor-1α. Proceedings of the National Academy of Sciences 99, 5367-5372 (2002).
195. M. C. Simon, The Hypoxia Response Pathways — Hats Off! New England Journal of Medicine 375, 1687-1689 (2016).
196. R. Chowdhury, A. Hardy, C. J. Schofield, The human oxygen sensing machinery and its manipulation. Chemical Society reviews 37, 1308-1319 (2008).
197. Niall S. Kenneth, S. Rocha, Regulation of gene expression by hypoxia. Biochemical Journal 414, 19-29 (2008).
198. I. Amelio, G. Melino, The p53 family and the hypoxia-inducible factors (HIFs): determinants of cancer progression. Trends in Biochemical Sciences 40, 425-434 (2015).
199. M. A. Nieto, Ruby Y.-J. Huang, Rebecca A. Jackson, Jean P. Thiery, EMT: 2016. Cell 166, 21-45 (2016).
200. A. Puisieux, T. Brabletz, J. Caramel, Oncogenic roles of EMT-inducing transcription factors. Nature cell biology 16, 488 (2014).
201. T. Brabletz, R. Kalluri, M. A. Nieto, R. A. Weinberg, EMT in cancer. Nature Reviews Cancer 18, 128-134 (2018).
202. A. Moustakas, C.-H. Heldin, Induction of epithelial–mesenchymal transition by transforming growth factor β. Seminars in Cancer Biology 22, 446-454 (2012).
203. C. L. Chaffer, B. P. San Juan, E. Lim, R. A. Weinberg, EMT, cell plasticity and metastasis. Cancer and Metastasis Reviews 35, 645-654 (2016).
204. J. Xu, S. Lamouille, R. Derynck, TGF-beta-induced epithelial to mesenchymal transition. Cell Res 19, 156-172 (2009).
205. M. H. Yang, K. J. Wu, TWIST activation by hypoxia inducible factor-1 (HIF-1): implications in metastasis and development. Cell cycle (Georgetown, Tex.) 7, 2090-2096 (2008).
206. M. H. Yang et al., Direct regulation of TWIST by HIF-1alpha promotes metastasis. Nature cell biology 10, 295-305 (2008).
207. X. Tian et al., E-cadherin/β-catenin complex and the epithelial barrier. BioMed Research International 2011, (2011).
89
208. O. Schmalhofer, S. Brabletz, T. Brabletz, E-cadherin, β-catenin, and ZEB1 in malignant progression of cancer. Cancer and Metastasis Reviews 28, 151-166 (2009).
209. N. Cong et al., Downregulated microRNA-200a promotes EMT and tumor growth through the wnt/β-catenin pathway by targeting the E-cadherin repressors ZEB1/ZEB2 in gastric adenocarcinoma. Oncology reports 29, 1579-1587 (2013).
210. P. Bayer et al., Structure determination of the small ubiquitin-related modifier SUMO-1. Journal of molecular biology 280, 275-286 (1998).
211. C. Wang, J. Xi, T. P. Begley, L. K. Nicholson, Solution structure of ThiS and implications for the evolutionary roots of ubiquitin. Nature Structural & Molecular Biology 8, 47 (2001).
212. C. M. Pickart, M. J. Eddins, Ubiquitin: structures, functions, mechanisms. Biochimica et Biophysica Acta (BBA) - Molecular Cell Research 1695, 55-72 (2004).
213. J. E. Rodríoguez, J. C. Schisler, C. Patterson, M. S. Willis, Seek and destroy: The ubiquitin-proteasome system in cardiac disease. Current Hypertension Reports 11, 396 (2009).
214. D. M. Koepp, J. W. Harper, S. J. Elledge, How the cyclin became a cyclin: regulated proteolysis in the cell cycle. Cell 97, 431-434 (1999).
215. Y. Shimizu, L. Taraborrelli, H. Walczak, Linear ubiquitination in immunity. Immunological reviews 266, 190-207 (2015).
216. M. J. Clague, C. Heride, S. Urbé, The demographics of the ubiquitin system. Trends in cell biology 25, 417-426 (2015).
217. B. Monia et al., Gene synthesis, expression, and processing of human ubiquitin carboxyl extension proteins. Journal of Biological Chemistry 264, 4093-4103 (1989).
218. C. M. Pickart, Mechanisms Underlying Ubiquitination. Annual Review of Biochemistry 70, 503-533 (2001).
219. M. Hochstrasser, UBIQUITIN-DEPENDENT PROTEIN DEGRADATION. Annual Review of Genetics 30, 405-439 (1996).
220. P. S. Freemont, Ubiquitination: RING for destruction? Current Biology 10, R84-R87 (2000).
221. J. Peng et al., A proteomics approach to understanding protein ubiquitination. Nature Biotechnology 21, 921-926 (2003).
222. B. B. Aggarwal, Signalling pathways of the TNF superfamily: a double-edged sword. Nature reviews immunology 3, 745 (2003).
90
223. Z. Cao, J. Xiong, M. Takeuchi, T. Kurama, D. V. Goeddel, TRAF6 is a signal transducer for interleukin-1. Nature 383, 443-446 (1996).
224. H. Ha, D. Han, Y. Choi, TRAF-Mediated TNFR-Family Signaling. Current Protocols in Immunology 87, 11.19D.11-11.19D.19 (2009).
225. L.-G. Xu, L.-Y. Li, H.-B. Shu, TRAF7 potentiates MEKK3-induced AP1 and CHOP activation and induces apoptosis. Journal of Biological Chemistry 279, 17278-17282 (2004).
226. M. Rothe, S. C. Wong, W. J. Henzel, D. V. Goeddel, A novel family of putative signal transducers associated with the cytoplasmic domain of the 75 kDa tumor necrosis factor receptor. Cell 78, 681-692 (1994).
227. C. H. Régnier et al., Impaired neural tube closure, axial skeleton malformations, and tracheal ring disruption in TRAF4-deficient mice. Proceedings of the National Academy of Sciences 99, 5585-5590 (2002).
228. H. Ye et al., Distinct molecular mechanism for initiating TRAF6 signalling. Nature 418, 443 (2002).
229. Y. C. Park, V. Burkitt, A. R. Villa, L. Tong, H. Wu, Structural basis for self-association and receptor recognition of human TRAF2. Nature 398, 533 (1999).
230. M. Takeuchi, M. Rothe, D. V. Goeddel, Anatomy of TRAF2. Distinct domains for nuclear factor-kappaB activation and association with tumor necrosis factor signaling proteins. The Journal of biological chemistry 271, 19935-19942 (1996).
231. X. Gu et al., TRAF4 is potently induced by TAp63 isoforms and localised according to differentiation in SCCHN. Cancer Biology & Therapy 6, 1986-1990 (2007).
232. A.-H. Rezaeian et al., A hypoxia-responsive TRAF6–ATM–H2AX signalling axis promotes HIF1α activation, tumorigenesis and metastasis. Nature cell biology 19, 38 (2016).
233. N. Kobayashi et al., Segregation of TRAF6‐mediated signaling pathways clarifies its role in osteoclastogenesis. The EMBO journal 20, 1271-1280 (2001).
234. T. Ishida et al., Identification of TRAF6, a Novel Tumor Necrosis Factor Receptor-associated Factor Protein That Mediates Signaling from an Amino-terminal Domain of the CD40 Cytoplasmic Region. Journal of Biological Chemistry 271, 28745-28748 (1996).
235. Q. Yin et al., E2 interaction and dimerization in the crystal structure of TRAF6. Nature structural & molecular biology 16, 658-666 (2009).
91
236. Y. C. Park, V. Burkitt, A. R. Villa, L. Tong, H. Wu, Structural basis for self-association and receptor recognition of human TRAF2. Nature 398, 533-538 (1999).
237. S. M. McWhirter et al., Crystallographic analysis of CD40 recognition and signaling by human TRAF2. Proc Natl Acad Sci U S A 96, 8408-8413 (1999).
238. S. S. Pullen et al., CD40-tumor necrosis factor receptor-associated factor (TRAF) interactions: regulation of CD40 signaling through multiple TRAF binding sites and TRAF hetero-oligomerization. Biochemistry 37, 11836-11845 (1998).
239. M. A. Lomaga et al., TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling. Genes & Development 13, 1015-1024 (1999).
240. H. Wu, J. R. Arron, TRAF6, a molecular bridge spanning adaptive immunity, innate immunity and osteoimmunology. BioEssays 25, 1096-1105 (2003).
241. E. M. Tan, L. Li, I. R. Indran, N. Chew, E. L. Yong, TRAF6 Mediates Suppression of Osteoclastogenesis and Prevention of Ovariectomy-Induced Bone Loss by a Novel Prenylflavonoid. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research 32, 846-860 (2017).
242. K. Wang et al., BCL3 regulates RANKL-induced osteoclastogenesis by interacting with TRAF6 in bone marrow-derived macrophages. Bone 114, 257-267 (2018).
243. R. Biswas, A. Bagchi, Structural Characterization of the Trimerization of TRAF6 Protein Through Molecular Dynamics Simulations. Interdisciplinary sciences, computational life sciences 11, 428-436 (2019).
244. L. Deng et al., Activation of the IκB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 103, 351-361 (2000).
245. M. C. Walsh, G. K. Kim, P. L. Maurizio, E. E. Molnar, Y. Choi, TRAF6 autoubiquitination-independent activation of the NFκB and MAPK pathways in response to IL-1 and RANKL. PloS one 3, e4064 (2008).
246. A. Naito et al., Severe osteopetrosis, defective interleukin-1 signalling and lymph node organogenesis in TRAF6-deficient mice. Genes to cells : devoted to molecular & cellular mechanisms 4, 353-362 (1999).
92
247. A. Naito et al., TRAF6-deficient mice display hypohidrotic ectodermal dysplasia. Proc Natl Acad Sci U S A 99, 8766-8771 (2002).
248. C. G. King et al., TRAF6 is a T cell–intrinsic negative regulator required for the maintenance of immune homeostasis. Nature medicine 12, 1088 (2006).
249. M. Li et al., Higher TRAF6 and Fbxo 3 Expression Is With Progressive Multiple Myeloma and Blockage Of TRAF6 Inhibits Tumor Growth and Bone Resorption. Blood 122, 5362-5362 (2013).
250. D. T. Starczynowski et al., TRAF6 is an amplified oncogene bridging the RAS and NF-κB pathways in human lung cancer. The Journal of clinical investigation 121, 4095-4105 (2011).
251. H. Sun et al., TRAF6 is upregulated in colon cancer and promotes proliferation of colon cancer cells. The international journal of biochemistry & cell biology 53, 195-201 (2014).
252. F. Han, L. Zhang, W. Qiu, X. Yi, TRAF6 promotes the invasion and metastasis and predicts a poor prognosis in gastric cancer. Pathology-Research and Practice 212, 31-37 (2016).
253. J.-j. Li et al., Relationship between TRAF6 and deterioration of HCC: an immunohistochemical and in vitro study. Cancer Cell International 16, 76 (2016).
254. K. Aripaka et al., TRAF6 function as a novel co-regulator of Wnt3a target genes in prostate cancer. EBioMedicine 45, 192-207 (2019).
255. H. Beltran et al., Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nat Med 22, 298-305 (2016).
256. A. Hamidi et al., TGF-β promotes PI3K-AKT signaling and prostate cancer cell migration through the TRAF6-mediated ubiquitylation of p85α. Sci. Signal. 10, eaal4186 (2017).
257. W.-L. Yang et al., The E3 ligase TRAF6 regulates Akt ubiquitination and activation. Science 325, 1134-1138 (2009).
258. P. Franzén, H. Ichijo, K. Miyazono, Different signals mediate transforming growth factor-β1-induced growth inhibition and extracellular matrix production in prostatic carcinoma cells. Experimental cell research 207, 1-7 (1993).
259. M. H. Connolly, P. C. Yelick, High‐throughput methods for visualizing the teleost skeleton: capturing autofluorescence of alizarin red. Journal of Applied Ichthyology 26, 274-277 (2010).
260. G. W. Yardy, S. F. Brewster, Wnt signalling and prostate cancer. Prostate cancer and prostatic diseases 8, 119-126 (2005).
93
261. M. Uhlen et al., A pathology atlas of the human cancer transcriptome. Science 357, eaan2507 (2017).
262. C. M. Koh et al., MYC and Prostate Cancer. Genes Cancer 1, 617-628 (2010).
263. R. J. Rebello, R. B. Pearson, R. D. Hannan, L. Furic, Therapeutic Approaches Targeting MYC-Driven Prostate Cancer. Genes (Basel) 8, 71 (2017).
264. Y. Gong et al., LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 107, 513-523 (2001).
265. M. L. Johnson, K. Harnish, R. Nusse, W. Van Hul, LRP5 and Wnt signaling: a union made for bone. Journal of Bone and Mineral Research 19, 1749-1757 (2004).
266. D. J. Sanchez, M. C. Simon, Genetic and metabolic hallmarks of clear cell renal cell carcinoma. Biochim Biophys Acta Rev Cancer 1870, 23-31 (2018).
267. T. Klatte et al., Hypoxia-inducible factor 1α in clear cell renal cell carcinoma. Clinical Cancer Research 13, 7388-7393 (2007).
268. J. Timar et al. (American Society of Clinical Oncology, 2013). 269. M. Serocki et al., miRNAs regulate the HIF switch during hypoxia: a
novel therapeutic target. Angiogenesis 21, 183-202 (2018). 270. M. Y. Koh, R. Lemos, X. Liu, G. Powis, The hypoxia-associated factor
switches cells from HIF-1α-to HIF-2α-dependent signaling promoting stem cell characteristics, aggressive tumor growth and invasion. Cancer research 71, 4015-4027 (2011).
271. N. Kushida et al., Hypoxia-inducible factor-1α activates the transforming growth factor-β/SMAD3 pathway in kidney tubular epithelial cells. American journal of nephrology 44, 276-285 (2016).
272. E. M. Wallace et al., A small-molecule antagonist of HIF2α is efficacious in preclinical models of renal cell carcinoma. Cancer research 76, 5491-5500 (2016).
273. K. Lundgren, B. Nordenskjöld, G. Landberg, Hypoxia, Snail and incomplete epithelial–mesenchymal transition in breast cancer. British journal of cancer 101, 1769 (2009).
274. R. T. Sitaram, P. Mallikarjuna, M. Landström, B. Ljungberg, Transforming growth factor-β promotes aggressiveness and invasion of clear cell renal cell carcinoma. Oncotarget 7, 35917 (2016).
94
275. P. Mallikarjuna, R. T. Sitaram, M. Landström, B. Ljungberg, VHL status regulates transforming growth factor-β signaling pathways in renal cell carcinoma. Oncotarget 9, 16297 (2018).
276. K. J. Turner et al., The hypoxia-inducible genes VEGF and CA9 are differentially regulated in superficial vs invasive bladder cancer. British Journal of Cancer 86, 1276-1282 (2002).
277. G. L. Semenza, HIF-1 and tumor progression: pathophysiology and therapeutics. Trends in Molecular Medicine 8, S62-S67 (2002).
278. J. P. Piret, D. Mottet, M. Raes, C. Michiels, CoCl2, a chemical inducer of hypoxia-inducible factor-1, and hypoxia reduce apoptotic cell death in hepatoma cell line HepG2. Ann N Y Acad Sci 973, 443-447 (2002).
279. Q. Li, R. Ma, M. Zhang, CoCl(2) increases the expression of hypoxic markers HIF-1α, VEGF and CXCR4 in breast cancer MCF-7 cells. Oncol Lett 15, 1119-1124 (2018).
280. M. A. Maynard et al., Human HIF-3α4 is a dominant-negative regulator of HIF-1 and is down-regulated in renal cell carcinoma. The FASEB Journal 19, 1396-1406 (2005).
281. M. A. Maynard et al., Dominant-negative HIF-3 alpha 4 suppresses VHL-null renal cell carcinoma progression. Cell cycle (Georgetown, Tex.) 6, 2810-2816 (2007).
282. M. A. Maynard, M. Ohh, Von Hippel-Lindau tumor suppressor protein and hypoxia-inducible factor in kidney cancer. American journal of nephrology 24, 1-13 (2004).
283. P. Mallikarjuna, T. S. Raviprakash, K. Aripaka, B. Ljungberg, M. Landström, Interactions between TGF-β type I receptor and hypoxia-inducible factor-α mediates a synergistic crosstalk leading to poor prognosis for patients with clear cell renal cell carcinoma. Cell cycle (Georgetown, Tex.) 18, 2141-2156 (2019).
284. H. Sun et al., TRAF6 upregulates expression of HIF-1alpha and promotes tumor angiogenesis. Cancer Res 73, 4950-4959 (2013).
285. A. H. Rezaeian et al., A hypoxia-responsive TRAF6-ATM-H2AX signalling axis promotes HIF1alpha activation, tumorigenesis and metastasis. Nature cell biology 19, 38-51 (2017).